|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
doi: 10.1242/10.1242/jcs.00523
Research Article |
expression and function in mouse mammary epithelial cells
1 Life Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA
94720, USA
2 Department of Anatomy, University of British Columbia, Vancouver, British
Columbia, V6T 1Z3, Canada
* Author for correspondence (e-mail: mjbissell{at}lbl.gov)
Accepted 31 March 2003
| Summary |
|---|
|
|
|---|
is an important determinant of breast physiology and breast cancer treatment.
However, it has been difficult to identify the signals that regulate estrogen
receptor because cultured mammary epithelial cells generally do not respond to
estrogenic signals. Here, we use a combination of two- and three-dimensional
culture systems to dissect the extracellular signals that control endogenous
estrogen receptor
. Its expression was greatly reduced when primary
mammary epithelial cells were placed on tissue culture plastic; however, the
presence of a reconstituted basement membrane in combination with lactogenic
hormones partially prevented this decrease. Estrogen receptor
expression in primary mammary fibroblasts was not altered by these culture
conditions, indicating that its regulation is cell type specific. Moreover,
estrogen receptor-dependent reporter gene expression, as well as estrogen
receptor
levels, were increased threefold in a functionally normal
mammary epithelial cell line when reconstituted basement membrane was added to
the medium. This regulatory effect of reconstituted basement membrane was
reproduced by two of its components, collagen-IV and laminin-1, and it was
blocked by antibodies against
2,
6 and ß1 integrin
subunits. Our results indicate that integrin-mediated response to specific
basement membrane components, rather than cell rounding or cell growth arrest
induced by reconstituted basement membrane, is critical in the regulation of
estrogen receptor
expression and function in mammary epithelial
cells.
Key words: Basement membrane, Extracellular matrix, Mammary fibroblasts, Integrins
| Introduction |
|---|
|
|
|---|
and ß (ER
and
ERß act as hormone-dependent transcriptional regulators controlling many
aspects of cell proliferation and differentiation (reviewed by
Cunha et al., 2000
is believed to be responsible for the majority of estrogenic effects
in the mammary ductal development, and its deregulation correlates with the
progression of mammary neoplasia to invasive carcinoma
(Sommer and Fuqua, 2001
and growth response to
estrogen (reviewed by Ronnov-Jessen et
al., 1996
require additional functions of molecules not present under these
culture conditions. Isolated mammary epithelial cells in culture recover
growth response to estrogen when co-cultured with stromal cells (reviewed by
Haslam and Woodward, 2001
is maintained at
higher levels in normal mouse and human mammary epithelial cells cultured in
three-dimensional collagen-I gels (Edery
et al., 1985
In the normal mammary gland, BM is a continuous deposit that separates
epithelial cells from the surrounding stroma. It is rich in laminins and
collagen-IV, and also contains entactin, proteoglycans and other glycoproteins
(reviewed by Aumailley and Gayraud,
1998
). Signals from the BM regulate epithelial cell morphology,
growth, functional differentiation and apoptosis in mammary cells
(Streuli et al., 1991
;
Boudreau et al., 1995
;
Muschler et al., 1999
;
Weaver et al., 2002
).
Cultivated in three-dimensional cultures in the presence of a reconstituted BM
(rBM) and lactogenic hormones, mammary epithelial cells arrest growth and
reorganize into tissue-like structures (acini) that secrete milk proteins into
a central lumen (Barcellos-Hoff et al.,
1989
). Using Scp2, a clonal mammary epithelial cell line
established in our laboratory that is unable to produce and organize its own
BM (Desprez et al., 1993
), we
found previously that two distinct signals control ß-casein expression in
response to laminin-1. These include a morphogenic signal that leads to
changes in cell shape (cell rounding) and most probably involves dystroglycan
(Muschler et al., 1999
;
Muschler et al., 2002
), and a
subsequent biochemical signal that involves integrin activation
(Roskelley et al., 1994
).
Given that cell contact with the BM constitutes a crucial regulator of cell
structure and gene expression, we hypothesized that a cause of deregulation of
ER expression and function in culture may be the result of loss of BM
integrity. Here, we have used non-malignant primary mammary epithelial cells
to investigate whether and how the signals from the BM may be required to
maintain ER
expression. We find that biochemical signals from
collagen-IV and laminin-1, transmitted through
2,
6 and ß1
integrins, are required to maintain the majority of ER
expression. We
also use Scp2 cells to show that these same signals and signaling molecules
can increase the expression of ER
in cultured mammary epithelial
cells.
| Materials and Methods |
|---|
|
|
|---|
1 (Ha31/8),
2 (HM
2),
6 (GoH3) and ß1 (Ha2/5) subunits were
purchased as sodium azide- and endotoxin-free reagents from PharMingen (San
Diego, CA). The anti-ER
polyclonal antibody (MC-20) was purchased from
Santa Cruz (Santa Cruz, CA) and the anti-ER
monoclonal antibody
(NCL-ER-6F11) was purchased from NovoCastra (Newcastle, UK). The monoclonal
anti-rat ß-casein antibody was a gift from C. Kaetzel (Case Western
Reserve University, Cleveland, OH). The anti-E-cadherin antibody (C20820) was
purchased from Transduction Laboratories (Lexington, KY). Reconstituted
basement membrane (rBM; Matrigel), purified laminin-1, purified collagen-IV
and MatriSperse Cell Release Solution were purchased from Collaborative
Biomedical Products (Bedford, MA). Collagen-I was purchased from Vitrogen
(Palo Alto, CA). Poly(2-hydroxyethyl methacrylate) (polyHEMA) and fibronectin
were purchased from Sigma Chemical. Collagenase type A and
5-bromo-2'-deoxy-uridine (BRdU) were purchased from Boehringer-Mannheim
(Indianapolis, IN). Alamar blue was purchased from Accumed International
(Westlake, OH).
Cell culture
Primary cultures
Primary mammary epithelial cells were obtained by a procedure slightly
modified from Kittrell et al. (Kittrell et
al., 1992
). Briefly, after removal of the 4th inguinal mammary
glands from nulliparous 12-week-old virgin BALB/c mice, the glands were minced
by chopping with two razor blades in parallel. Mammary cells were dissociated
by collagenase type A (2 mg/ml) in the presence of 5 µg/ml insulin (Sigma
Chemical) and with antibiotics [600 U/ml nystatin (Sigma Chemical), 100 U/ml
penicillin-streptomycin and 50 µg/ml gentamycin (Gibco, Rockville, MA)] in
DMEM/F12 medium for 3 hours at 37°C with constant shaking (100 rpm). The
resulting suspension was centrifuged at 1000 g for 10 minutes,
and the pellet resuspended in 4 ml DMEM/F12 containing 2 U/ml DNase (Sigma
Chemical). After gently shaking for 2 minutes the DNase was diluted by adding
4% fetal bovine serum (FBS) in 4 ml of DMEM/F12 medium, and the final
suspension (containing 2% FBS in DMEM/F12) was centrifuged again at 1000
g for 10 minutes. The resulting pellet was resuspended in
phosphate-buffered saline (PBS) containing 5% adult bovine serum (Atlanta
Biologicals, Norcross, GA), and this procedure was repeated six times at 1500
g for 15 seconds each time to remove stromal cells. This
protocol yielded 90% or greater purity of epithelial cells (mostly as
organoids of approximately 100 cells) as determined by immunofluorescence for
keratin (data not shown). Each fraction, pellet (epithelial cells) and
supernatant (mostly fibroblast cells, according to vimentin staining) was
resuspended in growth medium (indicated below). The day of the isolation from
the gland was considered time 0 in the culture period.
Cell lines
Scp2 is a functionally normal mouse mammary epithelial cell line
established in our laboratory (Desprez et
al., 1993
). The Scp2-ERETK-CAT cell line is a derivative of Scp2
that has been stably transfected by cotransfecting 30 µg of the
pA2(-331/-87)tk-CAT8+ plasmid and 3 µg of pSV2neo plasmid.
pA2(-331/-87)tk-CAT8+ contains the chloramphenicol acetyltransferase (CAT)
enzyme as a reporter gene, under the control of a minimal thymidine kinase
(TK) promoter containing an upstream consensus estrogen-response element
(ERE). The ERE corresponds to the region -331 to -87 of the Xenopus
vitellogenin A2 gene (Klein-Hitpass
et al., 1986
). The resulting SCp2-ERE-TK-CAT cells were obtained
by pooling neomycin-resistant colonies. They were selected under 400 µg/ml
G418 (Gibco, Rockville, MA) and maintained under 40 µg/ml G418. These cells
were used at passage 6-8 after transfection/selection.
Scp2, Scp2-ERE-TK-CAT and primary mammary cells were cultured at a density
of
50,000 cells/cm2 or
100,000 cells/cm2 (for
cultures on top rBM and on polyHEMA, see below) in DMEM/F12 medium containing
50 µg/ml gentamycin, 5 µg/ml of insulin, 1 µg/ml of hydrocortisone
and 3 µg/ml of prolactin (Sigma Chemical). For primary cultures, the growth
medium was supplemented with epidermal growth factor (EGF, 5 ng/ml; Sigma),
linoleic acid (5 µg/ml; Sigma) and bovine serum albumin (BSA, 5 mg/ml;
Sigma). Attachment and spreading of the cells to the covered-glass chamber
slide (for immunofluorescence) or the plastic dish were performed for 24 hours
of culture in the presence of 2% FBS. The cells were then grown for the period
indicated in each case with fresh serum-free medium containing insulin,
hydrocortisone and prolactin, with or without addition of ECM components (see
below). In experiments where the ER activity was measured (CAT reporter
assays) we used charcoal-treated FBS (HyClone, Logan, Utah) and phenol
red-free DMEM/F12 medium to avoid interference from exogenous estrogens. When
indicated, 10-8 M of 17ß-estradiol (Sigma Chemical),
10-7 M of the antagonist ICI 182,780 (Tocris Cookson, Ellisville,
MO) or the same volume of ethanol (vehicle) were added to the medium for the
last 48 hours.
Culture substrata
The culture conditions for cell lines or primary cells consisted of
untreated tissue culture plastic or plastic covered by a thick layer (50
µl/cm2) of growth factor-reduced rBM derived from
Englebreth-Holm-Swarm tumor (Matrigel). For this last condition, the cells
were seeded on top of the gel (on top rBM) and covered with the corresponding
serum-free medium (see above). Matrigel was previously allowed to solidify at
37°C for 40 minutes. For assays in pre-rounded cells, primary or Scp2
cells were cultured in suspension by placing
100,000 cells/cm2
in a culture dish coated with the nonadhesive substratum polyHEMA in
serum-free medium. PolyHEMA-coated dishes were prepared using a solution of 6
mg/ml polyHEMA in 95% ethanol added to culture plates at 0.05
ml/cm2 and allowed to evaporate to dryness.
For the 'dripping' conditions, soluble rBM or purified ECM components laminin-1, collagen-I, collagen-IV or fibronectin were diluted in the culture medium, and were added as an overlay to previously attached and spread cells in the case of Scp2 cells or immediately after isolation from the gland in the case of primary cultures. In the case of polyHEMA cultures, when indicated, rBM was mixed in the medium with the cells. For rBM we tested 1%, 2% and 5% dilution from a 10 mg/ml protein concentration of Matrigel. Because the most effective dilution was 2%, we estimated the final concentration for the ECM components corresponding to their relative proportion in 2% Matrigel. The final concentrations used were: 150 µg/ml of laminin-1, 20 µg/ml of collagen-I, 20 µg/ml of collagen-IV and 10 µg/ml fibronectin. Under these conditions, the components form a precipitate covering the cultured cells.
Cellular lysis
Cells were treated for the required number of days (as indicated in results
and legends to figures), with one change of medium every 2 days, and at the
end of the culture period, cells were lysed and extracted for protein or RNA
analysis. For lysis and extraction, cells were rinsed once with PBS; for
protein extraction, we used the protein extraction reagent for mammalian cells
(M-PER; Pierce, Rockford, IL) and for total RNA extraction, we used the RNeasy
Mini kit (Qiagen, Valencia, CA) following the manufacturer's directions. For
cells growing on top of rBM, cells were removed from the gel by using
enzymatic digestion with MatriSperse for 1 hour on ice, followed by a
centrifugation for 5 minutes at 1000 g. The resulting pellet
was then subjected to protein or RNA extraction. For cells growing on
polyHEMA-coated dishes, they were transferred to Eppendorf tubes, centrifuged
and lysed.
Integrin blocking
Scp2 cells or primary mammary epithelial cells were grown on plastic or in
the presence of rBM, collagen-IV or laminin-1 for 3 days in the presence of 10
µg/ml of mouse IgG (control, c) or in the presence of 10 µg/ml of
1,
2 or
6 or 5 µg/ml of ß1 integrin blocking
antibodies. The antibodies were diluted in the corresponding medium at the
time of plating the cells on top of rBM, or after 24 hours of plating under
other conditions to let them attach and spread. At the end of the experiment,
cell lysis followed by protein extraction was performed as described above.
Cell viability using Alamar blue vital dye assay was carried out in parallel
cultures according to manufacturer's instructions.
Immunofluorescence for ER
For ER
detection, cells were fixed with -20°C methanol:acetone
(1:1) solution for 5 minutes, air dried for 10 minutes, rehydrated in PBS,
blocked with Super Block Blocking Buffer in PBS (Pierce) and incubated with
ER
monoclonal antibody (NCL-ER-6F11) followed by FITC-conjugated
secondary antibody (Jackson Immuno Research, West Grove, PA), mounted and
observed under fluorescence microscopy. Before mounting,
4',6-diamidino-2-phenylindole (DAPI, Sigma) was used to stain DNA.
Control experiments were carried out omitting the primary antibody. Images
were captured using Spot RT camera and software (Technical Instruments,
Burlingame, CA). Cellular labeling indices for ER
were determined by
counting at least 100 cells from randomly selected visual fields and
calculating the intensity of labeling in the cells by using Simple PCI imaging
software (Compix Imaging Systems, Cranberry Township, PA).
Cell proliferation assay
To study the influence of cell proliferation on ER
expression, Scp2
cells cultured for 2 days on plastic or in the presence of rBM were treated
with increasing amounts of insulin (between 0 and 10 µg/ml). The cells were
maintained for another 24 hours, including a 6 hours labeling period with 10
µM BrdU (BrdU labeling and detection kit to measure DNA synthesis)
according to the manufacturer's instructions. Nuclear labeling indices were
determined by counting at least 100 cells from randomly selected visual fields
and calculating the percentage of cells with labeled nuclei. Parallel
experiments were performed to detect ER
levels by western blot.
CAT assay
We used the nonradioactive FLASH CAT Assay kit (Stratagene, La Jolla CA) to
measure the CAT activity in cell lysates from Scp2-ERETK-CAT cells. Briefly,
we mixed 5 µg protein/sample quantified by protein assay (Protein Assay DC,
Bio Rad, Hercules, CA) with the fluorescent derivative of chloramphenicol
BODIPY (borondipyrromethane difluoride fluorophore). This substrate is
converted to a single monoacetylated product by CAT that is separated from the
substrate by thin layer chromatography (TLC). The TLC plates were scanned
using STORM fluoroimager (Amersham Biosciences, Sunnyvale, CA) and
quantitation was performed using ImageQuant (Amersham).
Western blot for ER
and ß-casein detection
Equal amounts of protein (20 µg of cellular extracts) were treated with
reducing protein sample buffer and were size-fractionated in a 10% SDS-PAGE
gel. The resulting gel slabs were electrotransferred to a nitrocellulose
membrane (Schleicher and Schuell, Keene, NH), and the membranes incubated for
2 hours at room temperature in blocking buffer containing 5% non-fat milk in
0.1% Tween-PBS, pH 7.5. The blots were incubated with specific primary
antibodies for 1 hour at room temperature. The antibody used for loading
control recognizes the 120 kDa transmembrane glycoprotein E-cadherin. To
detect ER
, we used a polyclonal antibody raised against the C-terminus
of the protein, MC-20 (Santa Cruz Biotechnology, Santa Cruz, CA), which
recognizes a band of
67 kDa. The monoclonal antibody used to detect
ß-casein recognizes a band of
30 kDa. The blots were washed
appropriately with 0.1% Tween-PBS followed by the addition of the appropriate
horseradish-peroxidase-conjugated secondary antibody. After 1 hour of
incubation and appropriate washes, the signal was detected using the
SuperSignal West Dura detection kit (Pierce, Rockford, IL). The intensity of
each band was quantified using the ChemiImager (Alpha Innotech Corporation,
San Leandro, CA) scanning densitometry equipment.
Quantitative PCR
cDNA was prepared with 2 µg of total RNA using M-MLV reverse
transcriptase and oligo-dT primer (Gibco Life Technologies, Gaithersburg, MD)
according to the manufacturer's instructions. Quantification was done using
LightCycler and the DNA Master Syber Green I kit (Roche, Indianapolis, IN).
The set of primers used in the PCR (forward primer 5'
AGACCGCCGAGGAGGGAGAATGTT 3' and reverse primer 5'
GGAGCGCCAGACGAGACCAATC 3') amplify the region between +783 and +1197 of
ER
mRNA corresponding to the C-terminus of the protein. To
normalize the values of ER
we performed a quantification of
glyceraldehyde-3-phosphate dehydrogenase (GAPDH, forward
primer 5' CCCCTGGCCAAGGTCATCCATGAC 3' and reverse primer 5'
CATACCAGGAAATGAGCTTGACAAAG 3') in the same samples. The reactions for
both amplifications were carried out for 40 cycles with an annealing
temperature of 59°C.
Statistics
All values presented in this study are means±the standard error of
the mean (s.e.m.) of at least three independent experiments. Comparisons
between groups were performed employing one-way analysis of variance, and
differences between means were determined by a Student-Newman-Keuls multiple
comparison test.
| Results |
|---|
|
|
|---|
expression levels in primary mammary epithelial cells
expression in culture is
caused by disruption of signals from the endogenous BM, we cultured mouse
mammary epithelial organoids (Fig.
1Aa) in the presence or absence of rBM
(Fig. 1Ab,c). Twenty-four hours
after plating, almost 70% of the organoids had attached and spread on plastic,
and by 2 days almost all of them had formed monolayers
(Fig. 1Ab). There was a
significant reduction of ER
protein levels in epithelial cells cultured
on tissue culture plastic as early as 1 day after isolation
(Fig. 1Ba), and an additional
steady decrease throughout the rest of the culture period (9 days). When the
organoids were cultured on rBM, however, their morphology was retained to day
10, the longest time tested (Fig.
1Ac), and the early loss of ER
levels was significantly
attenuated (Fig. 1Bb,c). To
rule out differential adhesiveness of ER
-negative cells to tissue
culture plastic, we measured ER
protein levels in cells and organoids
that failed to attach to tissue culture plastic during the first 24 hours of
culture. ER
protein levels were similar in attached and detached cells
(data not shown). As a measure of functional integrity of the organoids, we
measured ß-casein synthesis and, as expected, cells grown on plastic did
not synthesize ß-casein (Fig.
1Ba), even in the presence of lactogenic hormones, hydrocortisone
and prolactin. But appreciable expression of this milk protein was found after
4 days of culture on rBM (Fig.
1Bb), and its expression continued to increase throughout 10 days
of culture. Furthermore, we observed that in the absence of lactogenic
hormones, the regulatory effect of rBM on ER
expression disappeared
(Fig. 1Bd). For this reason,
the next series of experiments were all performed in the presence of insulin,
hydrocortisone and prolactin.
|
ER
is expressed in both the epithelial and stromal components of the
mammary gland (Shyamala et al.,
2002
). To determine which of the two cell types loses ER
expression in culture, we separated them by differential centrifugation of
collagenase-dissociated mammary tissue. The stromal component thus obtained
contained mainly fibroblasts as determined by vimentin staining (data not
shown). We measured ER
levels in mouse primary fibroblasts immediately
after isolation (time 0), and after 2 and 6 days of culture in the presence or
absence of rBM. Primary fibroblasts cultured on plastic adopted the
characteristic spindle-shaped morphology
(Fig. 1Ca), but aggregated when
cultured on rBM (Fig. 1Cb). The
level of ER
in fibroblasts was significantly lower than that in
epithelial cells at the time of isolation, time 0
(Fig. 1D, t0), and this level
did not change either during the course of the culture or after the addition
of rBM (Fig. 1D). These results
indicate that loss of BM is partially responsible for the selective loss of
ER
in the epithelial component of the mammary gland.
A functionally normal mammary epithelial cell line can be used to
dissect the BM response
To dissect the molecular mechanisms involved in the response of mammary
epithelial cells to BM and to determine whether BM only reduces degradation of
ER
or whether it can also induce ER
de novo, we used a clonal
mouse mammary epithelial cell line, Scp2
(Desprez et al., 1993
). These
cells synthesize little or no BM components in culture. Scp2 cells cultured on
plastic adopted the typical flattened morphology
(Fig. 2Aa). BM components were
provided by culturing the cells either on top of a rBM gel ('top cultures';
Fig. 2Ab) or by the addition of
rBM to the medium of Scp2 cells cultured on plastic
(Fig. 2Ac,d,e). An effect on
cell morphology (cell rounding) was evident 6 hours after the addition of rBM.
The technique of adding a diluted rBM solution to the medium, 'rBM dripping',
enables a cleaner dissection of biochemical signals from exogenous ECM
components (Roskelley et al.,
1994
; Streuli et al.,
1995b
).
|
The addition of 2% dripped rBM produced a significant increase in the basal
ER
expression level in Scp2 cells, although to a lesser extent than in
cells plated on top of rBM (Fig.
2Ba). We found that the ER
level was upregulated as early
as 12 hours after culturing Scp2 cells in the presence of 2% rBM and reached
its maximum level by 24 hours (Fig.
2Bb). Note that, as cells reach high densities, there is
endogenous production of BM components that raises the base line of ER
levels on tissue culture plastic as would be expected from our data above. Our
experiments also suggested that the effect of rBM on ER
expression was
not directly related to the effect of rBM on cellular morphology, given that
addition of 5% rBM to the medium had no additional effect in regulating
ER
levels (Fig. 2Ba) in
spite of its more profound effect on cell morphology
(Fig. 2Ac,d,e).
In the mammary gland, ER
is expressed in a fraction of the luminal
epithelial cell population (Shyamala et
al., 2002
). The effect of rBM on ER
levels in culture could
be the consequence of increased levels of ER
expression in every cell
or an increase in the fraction of cells expressing ER
. To distinguish
between these possibilities, we determined by immunofluorescence the
percentage of Scp2 cells expressing ER
as well as the level of
expression per cell, in the presence or absence of rBM. We found that dripping
rBM on the cells increased the percentage of ER
-expressing cells from
21% (on plastic) (Fig. 2Ca,b)
to 53% (drip rBM) (Fig.
2Cc,d,e). However, the intensity of fluorescence per cell
(ER
level/cell) was not significantly affected by rBM
(Fig. 2Ce). These data suggest
that rBM can both protect against ER
loss as seen in primary cultures
and also induce endogenous expression of ER
in previously silent cells
as seen in Scp2 cultures.
BM regulates ER-mediated transcriptional activity in a
ligand-independent manner
The function of estrogen involves the binding of ER dimers to target gene
promoters that contain a palindromic estrogen-response element (ERE). To
determine whether the regulation of ER
levels by rBM is reflected in an
increase in the activity of the receptor, we transfected Scp2 cells with an
ERE-response element attached to a reporter gene
(Klein-Hitpass et al., 1986
),
generating the Scp2 ERE-TK-CAT cell line. These cells underwent the
characteristic morphological differentiation when cultured on top of rBM
(Fig. 3Aa,b), analogous to the
nontransfected Scp2 cells (Fig.
2Aa,b), and in the presence of lactogenic hormones they
functionally differentiated and produced ß-casein (data not shown). When
exposed to rBM, the ERE-TK-CAT cells exhibited higher reporter activity than
cells cultured on plastic (Fig.
3B). This increase in the ER-mediated response reflected the
increment in the level of ER expression when the cells were cultured in the
presence of rBM (Fig. 2B).
However, the effect of rBM on CAT activity was independent of the presence of
17ß-estradiol. When estradiol was added to the medium, the proportional
increase in reporter activity was similar between plastic and rBM
(Fig. 3B). The addition of the
ER antagonist ICI 182,780 blocked the increase in CAT activity induced by
estradiol but only partially blocked the increase induced by rBM. These
results suggest that rBM signals can partially replace the downstream function
of estrogen, and stimulate ER transcriptional activity in mouse mammary
epithelial cells.
|
BM upregulates ER
mRNA levels
To determine whether BM regulates ER
expression at the mRNA or
protein levels, we measured ER
mRNA level by quantitative
RT-PCR. ER
mRNA in cultured primary mammary organoids
decreased during the initial 24 hour culture period (data not shown). The
decrease was less pronounced when the cells were cultured in the presence of
rBM and was similar to the decrease of ER
protein levels
(Fig. 1Bc). After the first 24
hours, however, ER
mRNA levels remained significantly higher
when cells were cultured in the presence of rBM
(Fig. 4A). Similarly, when
ER
mRNA levels were evaluated in Scp2 cells, we found a
significant increase in cells grown for 3 days in the presence of rBM compared
with cells grown on plastic (Fig.
4B). These results indicate that the regulatory effect of rBM on
ER
expression in mammary epithelial cells is exerted, at least in part,
at the mRNA level.
|
The rBM-induced increase in ER
levels is due neither to
reduced proliferation nor to changes in cell shape
Shoker et al. have shown mutual exclusion between ER and Ki67 antigen in
luminal epithelial cells in normal breast
(Shoker et al., 1999
). We had
shown previously that rBM inhibits the growth of cultured mammary epithelial
cells (Petersen et al., 1992
;
Weaver et al., 1997
).
Therefore, the increase in ER
elicited by rBM could be due to a reduced
growth rate. To test this hypothesis, we cultured Scp2 cells for 3 days in the
presence of different levels of insulin to modulate cellular proliferation
(Srebrow et al., 1998
). Growth
of Scp2 cells was stimulated by insulin and attenuated by rBM as shown by BrdU
incorporation (Fig. 5A). There
was no correlation between ER
expression in the cell population
(Fig. 5Ba,b) and the
proliferation status of the cells (Fig.
5A), regardless of the presence or absence of rBM. Whether the
proliferating cells can express ER
while dividing in culture remains to
be seen. In any case, our results show that the upregulatory effect of rBM on
ER
expression is not due to a differential proliferation rate.
|
Another effect of adding rBM to epithelial cells is the change from 'flat'
to 'rounded' cell morphology (Fig.
1A, Fig. 2A), and
this change itself has been shown to induce alterations in gene expression
(Roskelley et al., 1994
;
Close et al., 1997
). To
determine whether cell rounding per se was responsible for the regulation of
ER
by rBM, we cultured primary mammary epithelial cells and Scp2 cells
on polyHEMA-coated dishes, which prevents cell attachment and forces cells to
remain in suspension as rounded-aggregates
(Fig. 6Aa-d). This type of
culture reproduces some aspects of the morphological changes induced by rBM,
including cell rounding (Roskelley et al.,
1994
; Muschler et al.,
1999
). Culture on polyHEMA did not alter ER
protein levels
either in primary organoids (Fig.
6Ba) or in Scp2 cells (Fig.
6Bb). Adding rBM to these cultures increased ER
expression
(Fig. 6Ba,b) without affecting
the level of cellular aggregation further
(Fig. 6Ae,f). These
observations indicate that, unlike the expression of milk protein genes
(Roskelley et al., 1994
;
Close et al., 1997
),
morphological changes per se are not required for regulation of ER
levels by BM.
|
Collagen-IV and laminin-1 are the BM components responsible for the
regulation of ER
levels
To establish which components of the rBM regulated ER
, we treated
primary mammary epithelial and Scp2 cells with purified ECM components at a
final concentration equivalent to that in 2% rBM (see Materials and Methods).
The presence of ECM components did not affect the attachment and spreading of
isolated mammary epithelial organoids (Fig.
7Aa-e). Collagen-I was ineffective in maintaining ER
levels, but collagen-IV and laminin-1 attenuated the reduction of ER
levels (Fig. 7Af). However,
laminin-1 and collagen-IV in combination did not synergize, suggesting that
the intracellular signals elicited by these molecules may converge on the same
downstream targets.
|
The same ECM components were tested also on Scp2 cells. Collagen-I or -IV
had no obvious effect on cell shape (Fig.
7Ba,b) but as expected, laminin-1
(Fig. 7Bc) or rBM
(Fig. 2Ac,d,e) induced cell
rounding. As in primary cultures, collagen-IV was the most effective BM
component tested in increasing ER
protein levels in Scp2 cells;
laminin-1 was effective to a lesser degree, and collagen-I or fibronectin had
no effect (Fig. 7Bd; data not
shown). The fact that collagen-IV increased ER
levels without involving
discernable cell rounding, together with the previous observations that
culture on polyHEMA had no effect on the regulation of ER
, further
indicate that, unlike many other changes in gene expression induced by rBM,
ER
regulation is most probably independent of mechanochemical changes
in the cytoskeleton. Because the effect of collagen-IV and laminin-1 on
ER
levels were comparable to the increase observed after dripping rBM
in Scp2 cells (Fig. 2Ba), we
conclude that the major components responsible in the BM are collagen-IV and
laminin-1.
The BM-induced regulation of ER
expression can be abrogated by
integrin-blocking antibodies
The specificity of two individual BM components to reproduce the regulatory
effect of rBM on ER
expression and lack of response by other components
indicated the involvement of specific ECM receptors. We therefore used
blocking antibodies to identify which ECM receptors transduce the signals to
the cell nucleus. Cells in the mammary gland express
1ß1,
2ß1,
3ß1,
6ß1 and
6ß4
heterodimers, all of which may potentially bind to laminin (for reviews, see
Alford and Taylor-Papadimitriou,
1996
; Mercurio et al.,
2001
), although
1ß1 and
2ß1 mainly serve
as collagen receptors (Zutter and Santoro,
1990
). We analyzed the effect of blocking antibodies directed
specifically against -
1, -
2, -
6, or -ß1 integrin
subunits. These antibodies did not affect cell viability during the assay
period as determined by the Alamar blue assay
[(Lochter et al., 1999
); data
not shown]. Primary mammary cells cultured on plastic, or in the presence of
collagen-IV or laminin-1 (Fig.
8A) and Scp2 cells cultured on plastic, or in the presence of
collagen-IV or rBM (Fig. 8B)
were treated with the specific integrin-blocking antibodies. In both cell
types,
2,
6, and ß1 antibodies partially blocked the effect
of rBM on ER
protein levels, whereas
1 blocking antibody had no
effect. Specifically,
2 and ß1 antibodies blocked the regulatory
effect of collagen-IV on ER
levels, whereas
2,
6 and
ß1 antibodies effectively abolished the regulatory effect of laminin-1.
These results indicate that integrin-mediated cell adhesion to BM components
and the subsequent activation of integrin signaling pathways are involved in
the regulation of ER
levels in mammary epithelial cells.
|
| Discussion |
|---|
|
|
|---|
expression and function in non-malignant mammary epithelial cells. We found
that a reconstituted BM exerts this regulatory effect on ER
through
signaling induced by two of the individual matrix components, collagen-IV and
laminin-1. These signals were due neither to changes in cell shape nor
inhibition of cell proliferation. When cell-BM interactions were disrupted by
function-blocking antibodies against
2,
6 or ß1 integrin
subunits, the regulatory effect of rBM was abolished. Furthermore, our data
suggest that the increase in the level of ER
in normal mammary
epithelial cells in response to rBM is due, at least in part, to the induction
of ER
expression in previously nonexpressing cells within the
population.
BM is a regulator of ER
expression in primary cultures and in
a mammary epithelial cell line
The action of rBM on ER
expression in both primary mammary
epithelial cells and Scp2 could be largely replaced by BM components
collagen-IV and laminin-1. The regulatory effect on ER
expression is
not coupled to the cytoskeletal reorganization induced by rBM because
collagen-IV reproduced the ER
-enhancing effect without inducing
morphological alterations, and mammary epithelial cells maintained in
suspension as rounded-aggregates on polyHema-coated dishes did not alter
ER
levels or function.
Differences between our results and previous investigations on the role of
specific ECM components on ER
regulation are informative. The study by
Woodward et al. on MCF-7 and T47-D human breast tumor cell lines showed
downregulation of the ER-mediated response without affecting ER
levels
when cultured on laminin gels (Woodward et
al., 2000
), whereas our results showed an upregulation of
ER
levels and of an ER-mediated response in non-malignant mouse mammary
epithelial cells under similar conditions. These differences suggest that
tumor cells, which often have a higher level of ER
in culture, may have
become independent of the ECM response. Our preliminary data with a mouse
tumor cell line are consistent with this hypothesis (data not shown). Edery et
al. reported that the expression of ER
was maintained by embedding
mammary epithelial cells within collagen-I gels
(Edery et al., 1985
), whereas
we found that ER
levels remained low when collagen-I was added to the
medium. Primary cultures are a mixed population of epithelial, myoepithelial
and stromal fibroblasts. The latter two cell types are known to contribute to
BM production. We have shown previously
(Streuli and Bissell, 1990
)
that when primary cells were cultured in collagen-I gels and allowed to
contract and form three-dimensional structures, they could synthesize and
deposit their own BM. It is therefore most likely that the effect of
collagen-I reported by Edery et al. is due to the newly synthesized BM, rather
than signaling by collagen-I per se (Edery
et al., 1985
). This conclusion is supported by the fact that in
the clonal cell line Scp2, which is unable to produce and organize its own BM,
collagen-IV and laminin-1 were able to up-modulate ER
, whereas
collagen-I was ineffective. However, the initial drop in ER
expression
that occurs even in the presence of rBM after isolating mammary epithelial
cells from their surrounding myoepithelial, adipocyte and fibroblast cells,
suggests that other aspects of the stromal-epithelial interaction could also
participate in the regulation of ER
expression.
Ligand-independent regulation of ER activity by BM
Several groups have reported ligand-independent activation mechanisms for
ER and other steroid hormone receptors in a number of cell types
(Kato et al., 1998
;
Weigel and Zhang, 1998
). One
such mechanism involves the association of ER with the steroid receptor
coactivator (SRC) family. The binding of estrogen to ER induces a
conformational change that leads to exposure of the activation function (AF) 2
domain of ER
, which contains a binding site for SRC-1. In the absence
of hormone, the activation of the ER could occur through a third protein that
recruits the coactivators to ER (Bernards,
1999
). Cyclin D1 might be one of these 'bridges', as it is capable
of binding ER and SRC-1 simultaneously and its overexpression induces an
ER-mediated response in the absence of estrogen in several cell lines,
including Scp2 (Neuman et al.,
1997
; Zwijsen et al.,
1997
; Zwijsen et al.,
1998
). Furthermore, D-type cyclins have previously been implicated
as downstream targets of ECM signaling pathways
(Buckley et al., 1997
;
Yu et al., 2001
), and Neuman
et al. have shown that ECM increases cyclin D1 levels
(Neuman et al., 1997
). Other
evidence supporting the notion that the cellular microenvironment modulates ER
function through cyclin D1 in mammary epithelial cells comes from Lamb et al.,
who showed in MCF-7 cells that the association between ER and cyclin D1 is
enhanced when cells are cultured in the presence of lactogenic hormones and
pre-adipocytes (Lamb et al.,
2000
). Our results showing that a portion of the BM-induced
upregulation of ER-mediated transcriptional response was independent of the
presence of estradiol and that it was not completely blocked by the antagonist
ICI 182,780 support the above data. However, we cannot rule out other
signaling events that also lead to a ligand-independent transcriptional
activity of the ER; for example, the binding to different coactivators that
have intrinsic histone acetylase activity, or the phosphorylation of the
receptor by the Ras-MAPK (mitogen-activated protein kinase) or the PI3k/Akt
pathways in response to growth factors (for reviews, see
McDonnell and Norris, 2002
;
Ali and Coombes, 2002
). The
study of these pathways is crucial for the understanding of the mechanisms
that result in anti-estrogen resistance of ER-positive breast tumors, which
constitutes a significant clinical problem. However, until now, none of these
mechanisms had been studied in the presence of rBM. It is clear from our data
that BM regulates ER function at multiple levels, and the overall increase in
ER
levels may be a cumulative response.
Hormonal status and ER
expression
We observed that the presence of lactogenic hormones, insulin,
hydrocortisone and prolactin, is required for the regulatory effect of rBM on
ER
levels, as primary mammary epithelial cells could not maintain
ER
expression in media lacking these hormones, even when rBM was added.
Using medium lacking lactogenic hormones, Xie et al. reported that ER
levels were not maintained in nulliparous mouse-derived cells cultured on
laminin, fibronectin, collagen-I, collagen-IV or tenasin (Xie et al., 1997).
However, ER
levels were maintained when cultures were prepared from
pregnant animals. Taken together with our data, these results suggest that a
pretreatment of mammary epithelial cells with high prolactin levels, such as
those found in pregnant animals, is necessary for the cells to be responsive
to BM-induced ER
expression. Interestingly, certain properties of ER
(acidity, molecular weight, DNA binding capacity, responsiveness to estrogen)
are different in the lactating vs. non-lactating (nulliparous) mammary gland
(Gaubert et al., 1986
;
Shyamala et al., 1992
) (for a
review, see Shyamala et al.,
2002
), providing further support for the idea that the hormonal
status of the animal during pregnancy and lactation alters ER function and
level. The fact that ER regulation by BM is different under different hormonal
conditions suggests that ER expression is part of the broader process of the
mammary gland differentiation. This process has been shown to require
interactions between prolactin and ECM involving STAT5 (signal transducer and
activator of transcription factor 5)
(Streuli et al., 1995a
;
Myers et al., 1998
). However,
we observed that collagen-IV could induce ER
expression without
inducing ß-casein production (data not shown), indicating that regulation
of ER
and ß-casein are independent processes, despite being
prolactin- and BM-dependent.
The regulation of ER
by BM is mediated by integrins: relevance
to tumorigenesis
We have found that integrin-activated signal transduction pathways are
responsible for the regulation of ER
levels by BM and its components.
However, the involvement of other nonintegrin receptors, such as dystroglycan,
cannot be ruled out (Muschler et al.,
2002
). The role of integrins in the regulation of mammary gland
development and gene expression is crucial for understanding tumor
progression. Alterations in the microenvironment or altered signaling through
the receptors that sense the microenvironment can cause normal cells to
display tumorigenic behaviour, and vice versa (for a review, see
Bissell and Radisky, 2001
). We
had previously shown that cultivation of human breast cancer cell lines within
either a rBM or a collagen-I gel led to differences in the levels of specific
integrins (Howlett et al.,
1995
). Furthermore, altered expression of
2-,
3-,
6-, ß1- and ß4-integrins has been reported in breast cancer
cell lines and in mammary tumor tissue sections
(Natali et al., 1992
;
Gui et al., 1995
;
Zutter et al., 1995
). These
changes in integrin expression may result in altered cell surface ratios of
individual integrins, which could, in turn, affect tissue organization and
lead to tumor progression via altered intracellular signaling. We showed in
this report that laminin-1 exerts its effect via
2,
6 and
ß1 integrins, whereas collagen-IV induces ER
expression via
2 and ß1 integrins. Taking the previous literature and our present
report, it is possible that changes in the composition of the ECM leads to
changes in the ECM receptor profiles of these cells, which, in turn, could
alter the ER
levels.
The
2 gene promoter contains estrogen-response elements (EREs)
(Zutter et al., 1994
),
suggesting that estrogen may play a role in the regulation of integrin
expression, and therefore in tumor cell invasion. It is possible that collagen
type IV signaling and ER are connected by a positive feedback loop in mammary
epithelial cells: collagen type IV, through its receptor
2ß1,
increases ER
levels, and in turn, ER
stimulates the expression
of
2 integrin subunit. In this regard, ER gene expression has been
positively correlated with
2ß1 integrin and collagen-IV expression
in breast carcinomas. Ductal carcinomas that lack ER also lack
2ß1
expression and are more invasive (Maemura
et al., 1995
; Lanzafame et
al., 1996
).
In conclusion, we have determined that adhesion to particular components of
the BM upregulates ER
both in primary cultures of normal mammary
epithelial cells and in an established mammary epithelial cell line, but not
in mammary fibroblasts. Thus, context-dependent regulation of ER
activity appears to be a fundamental and specific property of mammary
epithelial cells. These data may provide a possible explanation for the loss
of ER expression that occurs during breast tumor progression. We have shown
previously that malignant mammary epithelial cells are irresponsive to
adhesive clues from the BM (Petersen et
al., 1992
) (for reviews, see
Werb et al., 1996
;
Bissell and Radisky, 2001
). The
presence of significant amounts of ER
in breast tumors is an indication
of hormone responsiveness and it is a critical determinant of the prognosis
and therapeutic management of breast cancer patients
(Lapidus et al., 1998
;
Sommer and Fuqua, 2001
).
Breast tumors that acquire hormone independence usually display a less
differentiated and more aggressive phenotype. The concepts developed in this
paper may be applicable to the study of breast cancer cells to decipher why
some breast cancers remain hormone-sensitive and ER-positive, whereas others
develop into hormone-resistant ER-negative tumors.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Alford, D. and Taylor-Papadimitriou, J. (1996). Cell adhesion molecules in the normal and cancerous mammary gland. J. Mammary Gland Biol. Neoplasia 1, 207-218.[CrossRef][Medline]
Ali, S. and Coombes, R. C. (2002). Endocrine-responsive breast cancer and strategies for combating resistance. Nat. Rev. Cancer 2,101 -112.[CrossRef][Medline]
Anderson, E., Clarke, R. B. and Howell, A. (1998). Estrogen responsiveness and control of normal human breast proliferation. J. Mammary Gland Biol. Neoplasia 3, 23-35.[CrossRef][Medline]
Aumailley, M. and Gayraud, B. (1998). Structure and biological activity of the extracellular matrix. J. Mol. Med. 76,253 -265.[CrossRef][Medline]
Barcellos-Hoff, M. H., Aggeler, J., Ram, T. G. and Bissell, M. J. (1989). Functional differentiation and alveolar morphogenesis of primary mammary cultures on reconstituted basement membrane. Development 105,223 -235.[Abstract]
Bernards, R. (1999). CDK-independent activities of D type cyclins. Biochim. Biophys. Acta 1424,M17 -M22.[Medline]
Bissell, M. J. and Radisky, D. (2001). Putting tumours in context. Nat. Rev. Cancer 1, 46-54.[CrossRef][Medline]
Bissell, M. J., Weaver, V. M., Lelievre, S. A., Wang, F., Petersen, O. W. and Schmeichel, K. L. (1999). Tissue structure, nuclear organization, and gene expression in normal and malignant breast. Cancer Res. 59,1757 -1763s.
Boudreau, N., Sympson, C. J., Werb, Z. and Bissell, M. J.
(1995). Suppression of ICE and apoptosis in mammary epithelial
cells by extracellular matrix. Science
267,891
-893.
Buckley, S., Driscoll, B., Anderson, K. D. and Warburton, D. (1997). Cell cycle in alveolar epithelial type II cells: integration of Matrigel and KGF. Am. J. Physiol. 273,L572 -L580.
Close, M. J., Howlett, A. R., Roskelley, C. D., Desprez, P. Y., Bailey, N., Rowning, B., Teng, C. T., Stampfer, M. R. and Yaswen, P. (1997). Lactoferrin expression in mammary epithelial cells is mediated by changes in cell shape and actin cytoskeleton. J. Cell Sci. 110,2861 -2871.[Abstract]
Cunha, G. R., Wiesen, J. F., Werb, Z., Young, P., Hom, Y. K., Cooke, P. S. and Lubahn, D. B. (2000). Paracrine mechanisms of mouse mammary ductal growth. Adv. Exp. Med. Biol. 480, 93-97.[Medline]
Desprez, P. Y., Roskelley, C. D., Campisi, J. and Bissell, M. J. (1993). Isolation of functional cell lines from a mouse mammary epithelial cell strain: the importance of basement membrane and cell-cell interaction. Mol. Cell. Differ. 1, 99-110.
Edery, M., Imagawa, W., Larson, L. and Nandi, S.
(1985). Regulation of estrogen and progesterone receptor levels
in mouse mammary epithelial cells grown in serum-free collagen gel cultures.
Endocrinology 116,105
-112.
Gaubert, C. M., Carriero, R. and Shyamala, G.
(1986). Relationships between mammary estrogen receptor and
estrogenic sensitivity. Molecular properties of cytoplasmic receptor and its
binding to deoxyribonucleic acid. Endocrinology
118,1504
-1512.
Gui, G. P., Wells, C. A., Browne, P. D., Yeomans, P., Jordan, S., Puddefoot, J. R., Vinson, G. P. and Carpenter, R. (1995). Integrin expression in primary breast cancer and its relation to axillary nodal status. Surgery 117,102 -108.[CrossRef][Medline]
Gustafsson, J. A. and Warner, M. (2000). Estrogen receptor beta in the breast: role in estrogen responsiveness and development of breast cancer. J. Steroid Biochem. Mol. Biol. 74,245 -248.[CrossRef][Medline]
Haslam, S. Z. and Woodward, T. L. (2001). Reciprocal regulation of extracellular matrix proteins and ovarian steroid activity in the mammary gland. Breast Cancer Res. 3, 365-372.[CrossRef][Medline]
Howlett, A. R., Bailey, N., Damsky, C., Petersen, O. W. and Bissell, M. J. (1995). Cellular growth and survival are mediated by beta 1 integrins in normal human breast epithelium but not in breast carcinoma. J. Cell Sci. 108,1945 -1957.[Abstract]
Kato, S., Kitamoto, T., Masuhiro, Y. and Yanagisawa, J. (1998). Molecular mechanism of a cross-talk between estrogen and growth-factor signaling pathways. Oncology 55 Suppl. 1,5 -10.
Kittrell, F. S., Oborn, C. J. and Medina, D.
(1992). Development of mammary preneoplasias in vivo from mouse
mammary epithelial cell lines in vitro. Cancer Res.
52,1924
-1932.
Klein-Hitpass, L., Schorpp, M., Wagner, U. and Ryffel, G. U. (1986). An estrogen-responsive element derived from the 5' flanking region of the Xenopus vitellogenin A2 gene functions in transfected human cells. Cell 46,1053 -1061.[CrossRef][Medline]
Lamb, J., Ladha, M. H., McMahon, C., Sutherland, R. L. and Ewen,
M. E. (2000). Regulation of the functional interaction
between cyclin D1 and the estrogen receptor. Mol. Cell.
Biol. 20,8667
-8675.
Lanzafame, S., Emmanuele, C. and Torrisi, A. (1996). Correlation of alpha 2 beta 1 integrin expression with histological type and hormonal receptor status in breast carcinomas. Pathol. Res. Pract. 192,1031 -1038.[Medline]
Lapidus, R. G., Nass, S. J. and Davidson, N. E. (1998). The loss of estrogen and progesterone receptor gene expression in human breast cancer. J. Mammary Gland Biol. Neoplasia 3,85 -94.[CrossRef][Medline]
Lochter, A., Navre, M., Werb, Z. and Bissell, M. J.
(1999). alpha1 and alpha2 integrins mediate invasive activity of
mouse mammary carcinoma cells through regulation of stromelysin-1 expression.
Mol. Biol. Cell 10,271
-282.
Maemura, M., Akiyama, S. K., Woods, V. L., Jr and Dickson, R. B. (1995). Expression and ligand binding of alpha 2 beta 1 integrin on breast carcinoma cells. Clin. Exp. Metastasis 13,223 -235.[CrossRef][Medline]
McDonnell, D. P. and Norris, J. D. (2002).
Connections and regulation of the human estrogen receptor.
Science 296,1642
-1644.
Mercurio, A. M., Bachelder, R. E., Chung, J., O'Connor, K. L., Rabinovitz, I., Shaw, L. M. and Tani, T. (2001). Integrin laminin receptors and breast carcinoma progression. J. Mammary Gland. Biol. Neoplasia 6,299 -309.[CrossRef][Medline]
Muschler, J., Lochter, A., Roskelley, C. D., Yurchenco, P. and
Bissell, M. J. (1999). Division of labor among the
alpha6beta4 integrin, beta1 integrins, and an E3 laminin receptor to signal
morphogenesis and beta-casein expression in mammary epithelial cells.
Mol. Biol. Cell 10,2817
-2828.
Muschler, J., Levy, D., Boudreau, R., Henry, M., Campbell, K.
and Bissell, M. J. (2002). A role for dystroglycan in
epithelial polarization: loss of function in breast tumor cells.
Cancer Res. 62,7102
-7109.
Myers, C. A., Schmidhauser, C., Mellentin-Michelotti, J.,
Fragoso, G., Roskelley, C. D., Casperson, G., Mossi, R., Pujuguet, P., Hager,
G. and Bissell, M. J. (1998). Characterization of BCE-1, a
transcriptional enhancer regulated by prolactin and extracellular matrix and
modulated by the state of histone acetylation. Mol. Cell.
Biol. 18,2184
-2195.
Natali, P. G., Nicotra, M. R., Botti, C., Mottolese, M., Bigotti, A. and Segatto, O. (1992). Changes in expression of alpha 6/beta 4 integrin heterodimer in primary and metastatic breast cancer. Br. J. Cancer 66,318 -322.[Medline]
Neuman, E., Ladha, M. H., Lin, N., Upton, T. M., Miller, S. J., DiRenzo, J., Pestell, R. G., Hinds, P. W., Dowdy, S. F., Brown, M. and Ewen, M. E. (1997). Cyclin D1 stimulation of estrogen receptor transcriptional activity independent of cdk4. Mol. Cell. Biol. 17,5338 -5347.[Abstract]
Petersen, O. W., Ronnov-Jessen, L., Howlett, A. R. and Bissell,
M. J. (1992). Interaction with basement membrane serves to
rapidly distinguish growth and differentiation pattern of normal and malignant
human breast epithelial cells. Proc. Natl. Acad. Sci.
USA 89,9064
-9068.
Ronnov-Jessen, L., Petersen, O. W. and Bissell, M. J.
(1996). Cellular changes involved in conversion of normal to
malignant breast: importance of the stromal reaction. Physiol.
Rev. 76,69
-125.
Roskelley, C. D., Desprez, P. Y. and Bissell, M. J.
(1994). Extracellular matrix-dependent tissue-specific gene
expression in mammary epithelial cells requires both physical and biochemical
signal transduction. Proc. Natl. Acad. Sci. USA
91,12378
-12382.
Shoker, B. S., Jarvis, C., Clarke, R. B., Anderson, E., Hewlett,
J., Davies, M. P., Sibson, D. R. and Sloane, J. P. (1999).
Estrogen receptor-positive proliferating cells in the normal and precancerous
breast. Am. J. Pathol.
155,1811
-1815.
Shyamala, G., Schneider, W. and Guiot, M. C. (1992). Estrogen dependent regulation of estrogen receptor gene expression in normal mammary gland and its relationship to estrogenic sensitivity. Receptor 2,121 -128.[Medline]
Shyamala, G., Chou, Y. C., Louie, S. G., Guzman, R. C., Smith, G. H. and Nandi, S. (2002). Cellular expression of estrogen and progesterone receptors in mammary glands: regulation by hormones, development and aging. J. Steroid Biochem. Mol. Biol. 80,137 -148.[CrossRef][Medline]
Sommer, S. and Fuqua, S. A. (2001). Estrogen receptor and breast cancer. Semin. Cancer Biol. 11,339 -352.[CrossRef][Medline]
Srebrow, A., Friedmann, Y., Ravanpay, A., Daniel, C. W. and Bissell, M. J. (1998). Expression of Hoxa-1 and Hoxb-7 is regulated by extracellular matrix-dependent signals in mammary epithelial cells. J. Cell Biochem. 69,377 -391.[CrossRef][Medline]
Streuli, C. H. and Bissell, M. J. (1990).
Expression of extracellular matrix components is regulated by substratum.
J. Cell Biol. 110,1405
-1415.
Streuli, C. H., Bailey, N. and Bissell, M. J.
(1991). Control of mammary epithelial differentiation: basement
membrane induces tissue-specific gene expression in the absence of cell-cell
interaction and morphological polarity. J. Cell Biol.
115,1383
-1395.
Streuli, C. H., Edwards, G. M., Delcommenne, M., Whitelaw, C.
B., Burdon, T. G., Schindler, C. and Watson, C. J. (1995a).
Stat5 as a target for regulation by extracellular matrix. J. Biol.
Chem. 270,21639
-21644.
Streuli, C. H., Schmidhauser, C., Bailey, N., Yurchenco, P.,
Skubitz, A. P., Roskelley, C. D. and Bissell, M. J. (1995b).
Laminin mediates tissue-specific gene expression in mammary epithelia.
J. Cell Biol. 129,591
-603.
Weaver, V. M., Petersen, O. W., Wang, F., Larabell, C. A.,
Briand, P., Damsky, C. and Bissell, M. J. (1997). Reversion
of the malignant phenotype of human breast cells in three-dimensional culture
and in vivo by integrin blocking antibodies. J. Cell
Biol. 137,231
-245.
Weaver, V. M., Lelievre, S., Lakins, J. N., Chrenek, M. A., Jones, J. C., Giancotti, F., Werb, Z. and Bissell, M. J. (2002). beta4 integrin-dependent formation of polarized three-dimensional architecture confers resistance to apoptosis in normal and malignant mammary epithelium. Cancer Cell 2, 205-216.[CrossRef][Medline]
Weigel, N. L. and Zhang, Y. (1998). Ligand-independent activation of steroid hormone receptors. J. Mol. Med. 76,469 -479.[CrossRef][Medline]
Werb, Z., Sympson, C. J., Alexander, C. M., Thomasset, N., Lund, L. R., MacAuley, A., Ashkenas, J. and Bissell, M. J. (1996). Extracellular matrix remodeling and the regulation of epithelial-stromal interactions during differentiation and involution. Kidney Int. 54,S68 -S74.
Woodward, T. L., Lu, H. and Haslam, S. Z.
(2000). Laminin inhibits estrogen action in human breast cancer
cells. Endocrinology
141,2814
-2821.
Xie, J. and Haslam, S. Z. (1997). Extracellular
matrix regulates ovarian hormone-dependent proliferation of mouse mammary
epithelial cells. Endocrinology
138,2466
-2473.
Yang, J., Liu, A., Dougherty, C., Chen, X., Guzman, R. and Nandi, S. (2000). Estrogen and progesterone receptors can be maintained in normal human breast epithelial cells in primary culture and after transplantation into nude mice. Oncol. Rep. 7, 17-21.[Medline]
Yu, J. T., Foster, R. G. and Dean, D. C.
(2001). Transcriptional repression by RB-E2F and regulation of
anchorage-independent survival. Mol. Cell. Biol.
21,3325
-3335.
Zutter, M. M. and Santoro, S. A. (1990). Widespread histologic distribution of the alpha 2 beta 1 integrin cell-surface collagen receptor. Am. J. Pathol. 137,113 -120.[Abstract]
Zutter, M. M., Santoro, S. A., Painter, A. S., Tsung, Y. L. and
Gafford, A. (1994). The human alpha 2 integrin gene promoter.
Identification of positive and negative regulatory elements important for
cell-type and developmentally restricted gene expression. J. Biol.
Chem. 269,463
-469.
Zutter, M. M., Santoro, S. A., Staatz, W. D. and Tsung, Y.
L. (1995). Re-expression of the alpha 2 beta 1 integrin
abrogates the malignant phenotype of breast carcinoma cells. Proc.
Natl. Acad. Sci. USA 92,7411
-7415.
Zwijsen, R. M., Wientjens, E., Klompmaker, R., van der, S. J., Bernards, R. and Michalides, R. J. (1997). CDK-independent activation of estrogen receptor by cyclin D1. Cell 88,405 -415.[CrossRef][Medline]
Zwijsen, R. M., Buckle, R. S., Hijmans, E. M., Loomans, C. J.
and Bernards, R. (1998). Ligand-independent recruitment of
steroid receptor coactivators to estrogen receptor by cyclin D1.
Genes Dev. 12,3488
-3498.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
Related articles in JCS:
This article has been cited by other articles:
![]() |
L. M Arendt, L. C Evans, D. E Rugowski, M. J. Garcia-Barchino, H. Rui, and L. A Schuler Ovarian hormones are not required for PRL-induced mammary tumorigenesis, but estrogen enhances neoplastic processes J. Endocrinol., October 1, 2009; 203(1): 99 - 110. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Lydon and D. P. Edwards Finally! A Model for Progesterone Receptor Action in Normal Human Breast Endocrinology, July 1, 2009; 150(7): 2988 - 2990. [Full Text] [PDF] |
||||
![]() |
R. Fernandez-Valdivia, A. Mukherjee, C. J. Creighton, A. C. Buser, F. J. DeMayo, D. P. Edwards, and J. P. Lydon Transcriptional Response of the Murine Mammary Gland to Acute Progesterone Exposure Endocrinology, December 1, 2008; 149(12): 6236 - 6250. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Brendle, H. Lei, A. Brandt, R. Johansson, K. Enquist, R. Henriksson, K. Hemminki, P. Lenner, and A. Forsti Polymorphisms in predicted microRNA-binding sites in integrin genes and breast cancer: ITGB4 as prognostic marker Carcinogenesis, July 1, 2008; 29(7): 1394 - 1399. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Xu, V. A. Spencer, and M. J. Bissell Extracellular Matrix-regulated Gene Expression Requires Cooperation of SWI/SNF and Transcription Factors J. Biol. Chem., May 18, 2007; 282(20): 14992 - 14999. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hoshii, T. Takeo, N. Nakagata, M. Takeya, K. Araki, and K.-i. Yamamura LGR4 Regulates the Postnatal Development and Integrity of Male Reproductive Tracts in Mice Biol Reprod, February 1, 2007; 76(2): 303 - 313. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Acconcia, B. Manavathi, J. Mascarenhas, A. H. Talukder, G. Mills, and R. Kumar An Inherent Role of Integrin-Linked Kinase-Estrogen Receptor {alpha} Interaction in Cell Migration. Cancer Res., November 15, 2006; 66(22): 11030 - 11038. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Larsen, P. B. Brake, R. S. Pollenz, and C. R. Jefcoate Linked Expression of Ah Receptor, ARNT, CYP1A1, and CYP1B1 in Rat Mammary Epithelia, in Vitro, Is Each Substantially Elevated by Specific Extracellular Matrix Interactions that Precede Branching Morphogenesis Toxicol. Sci., November 1, 2004; 82(1): 46 - 61. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. B. Eckert, G. A. Repasky, A. S. Ulku, A. McFall, H. Zhou, C. I. Sartor, and C. J. Der Involvement of Ras Activation in Human Breast Cancer Cell Signaling, Invasion, and Anoikis Cancer Res., July 1, 2004; 64(13): 4585 - 4592. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||