|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 10 June 2003
doi: 10.1242/jcs.00528
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
nuclear localization sequence in intracellular function
Department of Microbiology and Cell Science, University of Florida, P.O. Box 110700, Gainesville, FL, 32611-0700, USA
* Author for correspondence (e-mail: ahmed1{at}ufl.edu)
Accepted 1 April 2003
| Summary |
|---|
|
|
|---|
(IFN
) has been reported
to possess biological activity similar to that of IFN
added to cells.
This study addresses the mechanisms for such similar biological effects.
Adenoviral vectors were used to express a non-secreted form of human
IFN
or a non-secreted mutant form in which a previously demonstrated
nuclear localization sequence (NLS), 128KTGKRKR134, was
replaced with alanines at K and R positions. With the vector expressing
non-secreted wild-type IFN
, biological responses normally associated
with extracellular IFN
, such as antiviral activity and MHC class I
upregulation, were observed, although the mutant IFN
did not possess
biological activity. Intracellular human IFN
possessed biological
activity in mouse L cells, which do not recognize extracellularly added human
IFN
. Thus, the biological activity was not due to leakage of IFN
to the surroundings and subsequent interaction with the receptor on the cell
surface. Biological function was associated with activation of STAT1
and nuclear translocation of IFN
, IFNGR1 and STAT1
.
Immunoprecipitation of cellular extracts with antibody to the nuclear
transporter NPI-1 showed the formation of a complex with
IFN
-IFNGR1-STAT1
. To provide the physiological basis for these
effects we show that extracellularly added IFN
possesses intracellular
signaling activity that is NLS dependent, as suggested by our previous
studies, and that this activity occurs via the receptor-mediated endocytosis
of IFN
. The data are consistent with previous observations that the NLS
of extracellularly added IFN
plays a role in IFN
signaling.
Key words: Inteferon
, Nuclear localization sequence (NLS), STAT1
, MHC
| Introduction |
|---|
|
|
|---|
(IFN
) activates cells
via interaction with the extracellular domain of the receptor complex
(reviewed in Stark et al.,
1998
, which dissociates
from the receptor cytoplasmic domain and undergoes nuclear translocation. This
current view ascribes no further role to IFN
or the receptor chains
IFNGR1 and IFNGR2 in IFN
signaling. The above scenario ignores several
events associated with IFN
signaling. First, both IFN
and one of
the receptor chains, IFNGR1, undergo internalization or endocytosis and
nuclear translocation (Larkin et al.,
2000
possessed biological activity that was qualitatively
not unlike that of extracellular IFN
. In one, microinjection of human
IFN
into mouse macrophage cells induced Ia expression
(Smith et al., 1990
did not have an effect, since it does
not recognize the extracellular domain of the mouse IFN
receptor
complex. Another study involved internalizing human IFN
into mouse
macrophages via a liposomal delivery system, resulting in induction of an
antiproliferative effect (Killion et al.,
1994
gene in mouse fibroblasts in a non-secretory form resulted in induction of
antiviral activity (Sanceau et al.,
1987
Recently, we have determined the structural basis for nuclear translocation
of murine IFN
by identification of a polycationic nuclear localization
sequence in its C-terminus (Subramaniam et
al., 1999
). Further, internalized IFN
binds to the
cytoplasmic domain of the IFNGR1 receptor chain
(Szente et al., 1994
).
Immunoprecipitation experiments showed that a cytoplasmic complex of
IFN
-IFNGR1-STAT1
complexed to the nuclear importin
protein, NPI-1, occurs in an NLS-dependent fashion
(Subramaniam et al., 2000
).
Thus, the internalization of IFN
and nuclear transport of IFN
and IFNGR1 appear to be a mechanism for nuclear import of the IFN
transcription factor STAT1
.
In the present study, we have expressed a non-secretable form of human
IFN
and found it to be biologically active. In order to demonstrate
that the NLS of IFN
was key to the intracellular events described
above, positively charged amino acids in the NLS were replaced with alanines,
such that the NLS sequence 128KTGKRKR134 was mutated to
128ATGAAAA134. Non-secreted forms of IFN
or its
NLS-mutated version were tested in murine and human cells for their ability to
induce IFN
activity, to activate STAT1
and to carry out nuclear
translocation of STAT1
. The data show that intracellularly expressed
IFN
, like extracellularly added IFN
, interacts with the
cytoplasmic domain of IFNGR1 via its C-terminal NLS and that the
IFN
-IFNGR1-STAT1
complex is in turn complexed to NPI-1 for
nuclear import of STAT1
.
| Materials and Methods |
|---|
|
|
|---|
AdEasy adenoviral vector system from Stratagene (La Jolla, CA) was used.
Construction and propagation of adenoviral vectors was carried out according
to the manufacturer's protocol. A plasmid containing human IFN
(ATCC)
was used to carry out PCR using the following primers:
CGGTCGACGAACGATGAAATATACAAGTTATATC (forward) and
GCAAGCTTCATTACTGGGATGCTCTTCGAC (reverse). To obtain the non-secreted
IFN
sequence, we used a forward primer that had the initiating
methionine and the remainder of the coding sequence from the first amino acid
in mature polypeptide, with the following sequence,
CGGTCGACGAACGATGTGTTACTGCCAGGACCCATA. The reverse primer was the same as above
for secreted IFN. NLS-modified IFN
sequence was obtained by using a
reverse primer in which the coding sequence was changed to replace lysine or
arginine with alanines, and the same forward primer as for the non-secreted
IFN. PCR products were digested with SalI (5' end) and
HindIII (3' end), and the resulting fragments were cloned in
the multiple cloning site in the plasmid, pShuttleCMV. For the control
plasmid, pShuttle MCS, which does not have a transgene, was used. Linearized
plasmids as above were cotransformed with pAdeasy plasmid in BJ5183 to obtain
recombinant adenovirus sequence. Recombinant plasmids were used to infect
human embryonic kidney 293 cells to obtain viruses. Purification of viruses
was carried out by using two CsCl gradients. These viruses were characterized
by restriction enzyme digestion and DNA sequencing across the coding sequence.
Cells that were about 50% confluent were infected with different recombinant
adenoviruses at a multiplicity of infection (m.o.i.) of 10 for 1 hour,
followed by growth in EMEM medium.
Western blot analysis and immunoprecipitation
Cells were washed with phosphate-buffered saline (PBS) and harvested in
lysis buffer [50 mM Tris-HCl, pH 7.5, 250 mM NaCl, 0.1% NP-40, 50 mM NaF, 5 mM
EDTA and protease inhibitor cocktail (Roche Biochemicals, Indianapolis, IN)].
Protein concentration was measured using a BCA kit from Pierce (Rockford, IL).
Protein (10 µg each) was electrophoresed on an acrylamide gel, transferred
to nylon membrane and probed with the antibodies indicated.
Horseradish-peroxidase-conjugated secondary antibodies were used, and
detection was carried out by chemiluminescence (Pierce). Immunoprecipitation
was carried out by incubating specific antibodies with cell extracts followed
by incubation with IgG-Sepharose (Sigma Chemicals, St. Louis, MO), followed by
centrifugation and washing. The phospho-STAT 1 antibody was from Cell
Signaling (Beverly, MA). The polyclonal antibody to STAT1
was from
R&D chemicals (Minneapolis MN). Antibodies to NPI-1 and IFNGR1 were
obtained from Santa Cruz Biotechnology (Santa Cruz, CA). The monoclonal
antibody to IFN
used to probe immunoprecipitate was obtained from PBL
Biomedical (New Brunswick, NJ). The ELISA kit for IFN
was obtained from
Biosource International (Camarillo, CA).
Antiviral assay
Antiviral assays were performed by using a cytopathic effect (CPE)
reduction assay using Vesicular Somatitis Virus (VSV)
(Familetti et al., 1981
). Mouse
L929 (4x103) cells were plated in a microtiter dish and
allowed to grow overnight. These cells were then infected with different
adenoviruses and incubated for various times followed by growth in EMEM medium
for 24 hours. VSV was then added to these cells and incubated for 24 hours.
Cells were stained with crystal violet. The dye retained was extracted in
methylcellusolve, and absorption at 550 nM was measured.
Expression of MHC class I
Cells were transfected with different recombinant adenoviruses for 1 hour,
followed by growth in EMEM medium for 48 hours. Cells were then washed and
incubated with a monoclonal antibody to human MHC class I molecules conjugated
with R-phycoerythrin (R-PE). Mouse IgG2a conjugated with R-PE was used as a
control. Both of these R-PE-conjugated antibodies were from Ancell (Bayport,
MN). Cells were analyzed for immunofluorescence (FL-2) in a FACScan flow
cytometer (Becton Dickinson Immunocytometry Systems, Mountain View, CA). Data
were collected in list-mode format and analyzed using CellQuest software
(Becton Dickinson Immunocytometry Systems).
Immunofluorescence analysis
WISH cells (3x105) were grown overnight on
tissue-culture-treated slides (Falcon, Becton Dickinson, Franklin Lakes, NJ)
before infecting with adenovirus vector for 1 hour. This was followed by
growth in EMEM medium for 7 hours. Cells were then fixed in methanol
(20°C) and dried. Cells were permeabilized using 0.5% Triton X-100
in 10 mM Tris-HCl, pH 8, 0.9% NaCl (TBS) for 10 minutes. Slides were washed in
TBS and non-specific sites were blocked with 5% non-fat milk in TBS. Slides
were then incubated for 1 hour in the same blocking buffer containing rabbit
polyclonal antisera against IFNGR1 (Santa Cruz Biotechnology, Santa Cruz, CA)
and goat polyclonal antisera to human STAT1
(R&D Systems). Cells
were washed four times with TBS containing 0.1% Triton. This was followed by
incubation with secondary antibodies, which were Cy-2-conjugated donkey
anti-rabbit (Jackson Immunochemicals) and Alexa-Fluor-594-conjugated donkey
anti-goat antisera (Molecular Probes, Eugene, OR) for 1 hour. After four
washings in TBS with 0.1% Triton, slides were mounted in Prolong antifade
solution (Molecular Probes), covered with a coverslip and sealed with nail
varnish. To view the nuclear translocation of IFN
, slides were
incubated with a monoclonal antibody to human IFN
(BD Pharmingen, San
Diego, CA) as the primary antibody and Alexa-Fluor-488-conjugated anti-mouse
antibody (Molecular Probes) as the secondary antibody. Images were recorded on
epifluorescence microscope attached to a Macintosh computer running IP Lab
software and deconvolution software (Scanylatics Corp). Images were recorded
and a portion of out-of-focus haze from each image removed using the MicroTome
software (Vaytek) to improve clarity. Quantitation of these images was done by
measuring mean pixel intensity in cytoplasmic (Fc) and nuclear (Fn) regions in
each cell using IP Lab software (Scanylatics Corp). The ratio Fn/Fc was
determined for each cell and the average of the ratio Fn/Fc across at least
seven different fields was measured and is presented as Fn/Fc for a given
treatment.
| Results |
|---|
|
|
|---|
and NLS-modified non-secreted IFN
were designated as rAdnI
and rAdnIm, respectively. These vectors were first characterized by
restriction enzyme digestion, followed by DNA sequencing across the
transgene.
To follow the synthesis of IFN
, WISH cells were transduced with
control or IFN
-expressing vectors. Proteins from cell extracts and
supernatants, obtained two days after infection, were electrophoresed and
probed with an antibody to IFN
(Fig.
1A). Vectors expressing both the non-secreted IFN
and
NLS-modified non-secreted IFN
showed the presence of IFN
in cell
extracts, and none was detected in the supernatants. There was no IFN
expression in cells transduced with the empty control vector, suggesting that
the infection with recombinant adenovirus in itself does not induce endogenous
IFN
expression. To test if murine L 929 cells were infectable with the
recombinant adenovirus vectors, cell extracts and supernatants after infection
with rAde, rAdnI and rAdnIm were assayed for IFN
by ELISA
(Fig. 1B). Synthesis of
IFN
was observed in cell extracts from cells treated with rAdnI and
rAdnIm, whereas the supernatants from the same cells did not have any
detectable IFN
. Similarly, cell extracts or supernatants from L 929
cells infected with empty vector did not have any detectable IFN
. In
addition, purified virus preparations were found to be free of IFN
.
Therefore, the effects observed below were not from free contaminating
IFN
acting extracellularly. Thus, IFN
produced from rAdnI or
rAdnIm was expressed intracellularly and not secreted.
|
Biological activity of non-secreted IFN
is dependent on the
presence of NLS
We next determined if intracellularly expressed IFN
possessed
biological activity. Murine L cells were chosen for this study because these
cells are not responsive to human IFN
added extracellularly, so the
effect observed would have to result from intracellular action of interferon.
Although the extracellular recognition by the receptor is species specific,
intracellular signaling events are not species specific because of extensive
homology in the cytoplasmic region of IFNGR1 for human and mouse sequences
that bind the C-terminus of both human and mouse IFN
(Szente and Johnson, 1994
). In
fact, there is greater than 90% homology in this region of the cytoplasmic
binding site of IFNGR1. Mouse L cells, untreated or transduced with an empty
vector control, non-secreted IFN
or NLS-modified non-secreted
IFN
expressing vector were allowed to grow for one day and then they
were challenged with VSV. A day later, these cells were compared to discover
their relative resistance to VSV-induced cytopathic effect
(Fig. 2). With intracellular
IFN
expression, a threefold increase in cell survival was observed
compared with untreated cells or cells treated with empty vector. With
expression of NLS-modified IFN
, cell survival was reduced to nearly the
same level as with the empty vector control. Intracellularly expressed
IFN
thus induced antiviral activity in cells, and this activity was
dependent on the presence of the NLS at its C-terminus. Given that mouse L
cells do not recognize human IFN
via the extracellular domain of the
receptor, the data further support an intracellular effect of human
IFN
.
|
Extracellularly added IFN
induce MHC class I molecule expression on
the cell surface. To test if non-secreted IFN
also had a similar
activity, WISH cells were transduced with an empty vector control,
non-secreted IFN
or NLS-modified non-secreted IFN
expression
vector. Two days later, these cells were stained with R-phycoerythrin
(R-PE)-conjugated monoclonal antibody to human MHC class I molecules, and the
cells were analyzed by flow cytometry. As an isotype control, murine IgG2a
antibodies conjugated with R-PE were used. Relative mean fluorescence profiles
are presented in Fig. 3. Cells
transduced with the empty vector control, non-secreted IFN
or
NLS-mutated IFN
expression vectors showed 417±9, 778±10
and 362±29 units of mean fluorescence, respectively. Therefore,
intracellular expression of IFN
induced an approximately twofold
increased expression of MHC I molecules. This induction was abolished with the
removal of the NLS. Intracellularly expressed IFN
therefore induces
antiviral activity and upregulation of MHC class I molecules only with an
intact NLS in its C-terminus.
|
Activation of STAT1
and its association with IFN
,
IFNGR1 and NPI-1
To determine if the biological activity observed with non-secreted
IFN
involved the activation of STAT1
, whole cell extracts from
WISH cells transduced with an empty vector control, non-secreted IFN
or
NLS-modified non-secreted IFN
expression vector were analyzed
(Fig. 4). Phosphorylation of
STAT1
was observed in response to intracellular expression of both
wild-type IFN
and its NLS mutant as seen by probing with
Tyr701phospho-STAT1-specific antibody. Cells transduced with empty
vector control did not show STAT1
Tyr701 phosphorylation.
Re-probing this filter to look for STAT1
showed similar amounts of
STAT1
in all cell extracts. Thus, the intracellular expression of
NLS-mutated IFN
induced STAT1
tyrosine phosphorylation similarly
to wild-type IFN
.
|
We have previously shown that IFN
addition to cells resulted in the
formation of a complex of IFN
-IFNGR1-STAT1
in the cytoplasm and
that the nuclear importin
homolog, NPI-1, binds to the complex via the
NLS in the C-terminus of IFN
(Larkin
et al., 2000
; Subramaniam et
al., 2000
). Further, we have previously provided evidence that the
NLS of IFN
is responsible for the nuclear transport of STAT1
(Subramaniam et al., 2000
),
which otherwise lacks an intrinsic NLS, which was demonstrated by the standard
digitonin-based nuclear import assay (P. S. Subramaniam and H. M. Johnson,
unpublished). Key to the chaperoning of STAT1
to the nucleus is the
ability of IFN
to bind to the cytoplasmic domain of IFNGR1 as well as
to NPI-1 via its C-terminal NLS
(Subramaniam et al., 2000
). We
therefore immunoprecipitated NPI-1 from extracts of cells expressing
IFN
intracellularly 18 hours after transduction with the empty vector
or the vectors expressing wild-type IFN
and NLS-mutated IFN
.
Immunoprecipitated proteins were then electrophoresed and probed individually
with antibodies specific for IFNGR1, IFN
, phosphorylated STAT1
(p-STAT1
) and NPI-1 (Fig.
5). Cells expressing wild-type IFN
intracellularly
contained IFNGR1, IFN
and p-STAT1 in the anti-NPI-1 immunoprecipitate
(Fig. 5, lane 3), whereas
anti-NPI-1 precipitate from untreated cells
(Fig. 5, lane1) and cells
transduced with NLS-mutated IFN
vector
(Fig. 5, lane 2) were negative
for IFNGR1, IFN
and p-STAT1
. Similar concentrations of NPI-1
were present in the immunoprecipitates from all cell extracts. Thus,
intracellular wild-type IFN
formed a complex of
IFN
-IFNGR1-STAT1
-NPI-1, but this complex was absent in cells
expressing the IFN
NLS mutant. Since, NLS mutant IFN
also
activated STAT1
phosphorylation similarly to wild-type IFN
,
these data suggest that the IFN
NLS is required for the binding of
phosphorylated STAT1
to NPI-1.
|
Nuclear translocation of STAT1
, IFNGR1 and IFN
Consistent with intracellular activation of STAT1
and the
association of IFNGR1 with nuclear import machinery, cells expressing
IFN
intracellularly also showed the movement of STAT1
and IFNGR1
to the nucleus by immunofluorescence analysis. Simultaneous staining of WISH
cells with antibodies to STAT1
and IFNGR1 showed the translocation of
these molecules into the nucleus with the intracellular expression of
IFN
, wheras the NLS-modified IFN
or the empty vector failed to
induce similar translocation of either of these
(Fig. 6A). Further, consistent
with our previous studies (Larkin et al.,
2000
), cells that were simultaneously stained with IFNGR2 and
STAT1
showed translocation of only STAT1
, whereas IFNGR2 was not
translocated with the expression of intracellular IFN
, and neither of
these was translocated with the NLS-modified IFN
or the control vector
(data not shown). Fluorescence images from at least seven different fields
were then used to quantitate the ratio of fluorescence in nuclei (Fn) to the
fluorescence in cytoplasmic (Fc) fractions. Thus, cells expressing
non-secreted IFN
showed translocation of both STAT1 and IFNGR1 into the
nucleus, whereas the cells treated with NLS-modified IFN
or the empty
vector did not show nuclear translocation
(Fig. 6B).
|
Since IFN
is also translocated into the nucleus, we determined the
effects of removal of the NLS on such translocation by using
immunofluorescence analysis (Fig.
7A). Intracellular expression of IFN
resulted in its
nuclear translocation, whereas removal of the NLS resulted in lack of nuclear
tanslocation of IFN
. With the empty vector control, no IFN
signal was seen (Fig. 7A). Mean
fluorescence intensities for the non-secreted and NLS-mutated forms of
IFN
were compared by measuring mean pixel intensity across several
lines drawn through the cells as shown in
Fig. 7B. The results show
approximately 40% more fluorescence in nuclei treated with non-secreted
IFN
compared with the NLS-mutated IFN
. Quantitation of the
images (Fn/Fc ratios) is shown in Fig.
7B. Association of IFN
together with IFNGR1 and
STAT1
points to a role for this ligand and one of its receptor subunits
in chaperoning STAT1
into the nucleus.
|
Evidence for intracellular function of extracellularly added
IFN
We have shown above that intracellularly expressed IFN
activates
STAT1
similarly to IFN
added extracellularly to cells. Our
previous studies have shown that the C-terminus of human and murine
IFN
, defined by peptides huIFN
(95-134) and muIFN
(95-133), bind to the cytoplasmic domain of soluble recombinant human and
murine receptor chain IFNGR-1 via the region IFNGR-1 (253-287)
(Szente et al., 1994
). One
would predict that if this domain of IFNGR-1 played an essential role in
IFN
signaling, an intracellular excess of the peptide IFNGR-1 (253-287)
should compete for intracellular binding of IFN
and thus interfere with
IFN
early signaling events. To test this we used the murine macrophage
cell line P388D1, which internalizes peptides by pinocytosis as demonstrated
previously in our earlier studies using peptides of the C-terminus of
IFN
(Szente and Johnson,
1994
). Pinocytosis by P388D1 is an active process that requires
cells to be incubated at 37°C. Firstly, in binding assays at 4°C (no
pinocytosis) we established that extracellularly added cytoplasmic IFNGR-1
(253-287) peptide does not interfere with binding of extracellular
125I-IFN
to the receptor at the concentrations to be used
for functional studies at 37°C (Fig.
8A). Extracellular addition of IFNGR-1 cytoplasmic domain peptide
did not inhibit the binding of 125I-IFN
to the receptor
extracellular domain on these cells.
|
To determine functional effects, the following experiment was performed.
Cells were preloaded with the peptide muIFNGR-1 (253-287) at 37°C, washed
to remove excess peptide and then challenged with extracellular
125I-labeled IFN
at 37°C, in the presence of 1 µM of
IFNGR-1 (253-287) that does not inhibit IFN
extracellular binding as
per Fig. 8A. After 5 minutes at
37°C, cells were washed at 4°C, and extracellularly bound
125I-IFN
was removed by acid washing at 4°C. Cell
lysates were immunoprecipitated with polyclonal antibodies to IFNGR-1, and
125I-IFN
was detected by autoradiography to follow
internalized IFN
bound to IFNGR-1. As seen in
Fig. 8B, cells that were not
preloaded with peptide (lane 4) showed detectable levels of
125I-IFN
associated with IFNGR-1. By contrast, where cells
were preloaded with 25 µM (lane 2) or 50 µM of IFNGR-1 (253-287) peptide
(lane 3), 125I-IFN
did not bind to the cytoplasmic domain of IFNGR-1.
Lane 1 shows that at 4°C, where internalization is blocked, even in the
absence of preloading of peptide no signal for 125I-IFN
was detectable.
Thus, the presence of free intracellular IFNGR-1 (253-287) peptide blocked the
binding of internalized 125I-IFN
to IFNGR-1. These data show that
extracellularly added IFN
that is internalized interacts with the
cytoplasmic domain of IFNGR-1 in intact cells and that this interaction is
blocked by IFNGR-1 cytoplasmic peptide IFNGR-1 (253-287), an IFNGR-1
cytoplasmic binding site for IFN
(Szente and Johnson, 1994
).
The peptide did not block binding of IFN
to the receptor extracellular
domain (Szente et al., 1994
)
(Fig. 8A).
To determine the effect of the cytoplasmic binding on signaling, we
performed the same experiment as above but this time followed STAT1
tyrosine phosphorylation (Fig.
8C). Binding of internalized IFN
to IFNGR-1 resulted in
STAT1
phosphorylation (lane 4). STAT1
tyrosine phosphorylation
was inhibited by preloading cells with IFNGR-1(253-287) (lanes 2 and 3). Thus,
the binding of internalized IFN
to the IFNGR-1 cytoplasmic domain is
linked to the activation and tyrosine phosphorylation of STAT1
. The
data from Fig. 8 demonstrate
that under normal physiological conditions there is an intracellular role in
signaling for extracellularly added IFN
. Our data presented earlier
with intracellularly expressed IFN
are also consistent with this
conclusion, and together these data highlight for the first time a mechanism
for the physiological function of intracellular IFN
.
Presumably following endocytosis of IFNGR-1 after interaction with
IFN
, the IFNGR-1 cytoplasmic domain would be present on the surface of
the endocytic vesicle. The data suggest that IFN
at some time during
internalization traverses the membrane of the endocytic vesicle to interact
with the cytoplasmic domain of IFNGR-1 at the site identified by peptide
IFNGR-1 (253-287). This would suggest that there is a membrane penetration
property associated with IFN
.
In keeping with the implications of the above data, we next determined
whether the C-terminal NLS domain itself was required for internalization of
human IFN
. We have previously characterized a C-terminal deletion
mutant of huIFN
, IFN
(1-123) and have shown that this mutant
binds to the extracellular domain of IFNGR on cells with the same affinity as
intact IFN
(Subramaniam et al.,
2000
). IFN
(1-123) is deleted in the NLS region. We
compared its internalization with that of intact IFN
using
125I-labeled IFNs. After binding of 125I-IFN
and
125I-IFN
(1-123) to WISH cells at 4°C, cells were washed
to remove unbound ligands and incubated at 37°C for various times followed
by acid washing to follow internalization of the bound
125I-IFN
and 125IFN
(1-123). As can be
seen in Fig. 9, intact
IFN
was rapidly internalized, whereas IFN
(1-123) did not
undergo significant internalization. The small negative values seen at later
times for IFN
(1-123) most probably represent the slow dissociation of
surface-bound ligand upon prolonged incubation at 37°C in the absence of
its internalization. Thus, these data suggest that the C-terminal region of
IFN
containing the NLS is required for its internalization and may play
a critical role in IFN
traversing the endocytic vesicle membrane to
bind to the cytoplasmic domain of IFNGR-1.
|
| Discussion |
|---|
|
|
|---|
is biologically active. The intracellular function of human
IFN
required the presence of a previously identified NLS,
128KTGKRKR134
(Subramaniam et al., 1999
antiviral activity in mouse cells
and upregulation of MHC class I antigens in human WISH cells and was
associated with loss of nuclear import of STAT1
function. We have also
shown that extracellularly added IFN
is endocytosed under conditions
that requires the IFN
NLS and that the internalized IFN
binds to
the cytoplasmic domain of receptor chain IFNGR-1. This binding is associated
with STAT1
activation. Our data establish for the first time that
intracellular IFN
interactions are also physiologically necessary for
the biological effects of extracellular IFN
and provide a mechanism for
how this occurs.
The data with intracellularly expressed IFN
suggest that
intracellular IFN
can generate biological activity without the
recognition of the extracellular domain of the receptor. The following
cytokines and growth factors, when expressed with modifications that
restricted their localization to the cytoplasm, were also found to be
biologically active: human IFN
2b, IFN
2
1
(Ahmed et al., 2001
), IFN
consensus (Rutherford et al.,
1996
), murine IFN
(Will
et al., 1996
), IL-3 (Dunbar et
al., 1989
) and v-sis
(Bejcek et al., 1989
). It is
possible that these ligands interact with a motif on the cytoplasmic side of
their receptor(s) that initiates a cascade of events required for the nuclear
import of STATs, as has been demonstrated for IFN
(Szente et al., 1994
;
Szente et al., 1995
). A
feature common to these ligands and/or their receptors is the presence of an
NLS or an NLS-like motif, which may have a role in directing the respective
STATs to the nucleus (reviewed in
Subramaniam et al.,
2001b
).
The IFN
receptor consists of two subunits that are denoted as IFNGR1
and IFNGR2 (reviewed in Pestka et al.,
1997
). IFNGR1 contains the sites for binding of the ligand on the
extracellular surface and the sites for Jak1 and STAT1 binding on the
intracellular surface. We have shown earlier that a polypeptide from the
C-terminus of murine or human IFN
containing a nuclear localization
signal (NLS) was capable of binding to a region of IFNGR1 sequence located on
the cytoplasmic side of the plasma membrane
(Szente et al., 1994
;
Szente et al., 1995
).
Internalization of this polypeptide was shown to be sufficient to induce an
antiviral state and to cause upregulation of MHC class II molecules.
Microinjection of antibodies raised against the murine NLS containing peptide
resulted in loss of STAT1
nuclear translocation in cells treated
extracellularly with IFN
(Subramaniam et al., 1999
).
Replacement of the NLS in the C-terminus of IFN
with the NLS from SV40
T antigen resulted in restoration of biological activity of IFN
(Subramaniam et al., 2001a
).
This suggests a requirement for an interaction between the NLS-containing
region of IFN
and IFNGR1, which is supported by the observations that
IFNGR1/ cells do not respond to murine intracellular IFN
(Will et al., 1996
) or an
agonist peptide (Thiam et al.,
1998
). An additional aspect of IFN
and IFN
receptor
interaction is the nuclear translocation of IFNGR1, but not IFNGR2, in cells
treated with IFN
(Larkin et al.,
2000
). Nuclear translocation of a receptor subunit has been
reported for a number of cytokines and growth factors (reviewed in
Subramaniam et al., 2001b
;
Jans and Hassan, 1998
).
Demonstration of a transcription-factor-like activity in the EGF receptor
subunit after nuclear uptake (Lin et al.,
2001
) suggests an important role for this translocation, since its
association with STATs may allow the use of promoters specific to the ligand
and/or receptor.
The NLS of human IFN
was identified by the digitonin-permeabilizion
assay, which results in selective permeabilization of the plasma membrane of
the cell (Subramaniam et al.,
1999
). Nuclear import of IFN
was monitored via its coupling
to the fluorescent protein allophycocyanin in the presence of reticulocyte
lysate and ATP/GTP. Consistent with the above, we have recently shown that
extracellularly added 125I-IFN
undergoes nuclear
translocation (Subramaniam and Johnson,
2002
). We have recently used the digitonin assay to test
STAT1
for intrinsic NLS activity (P. S. Subramaniam and H. M. Johnson,
unpublished). Fluorescently labeled STAT1
and IFNGR1 were tyrosine
phosphorylated in vitro by recombinant Jak2. The phosphorylated STAT1
bound to its DNA response element, as shown by the electrophoretic mobility
shift assay. Activated STAT1
failed to undergo nuclear translocation.
However, in association with IFNGR1, it did undergo nuclear translocation in
the presence of human IFN
, as the IFN
C-terminal peptide
contains an NLS. The results are consistent with our demonstration here of the
requirement of intracellular IFN
with intact NLS for STAT1
activation and nuclear translocation in association with IFNGR1.
Nuclear translocation of STAT1
is carried out by the nuclear
importer NPI-1 in a ran/importin-dependent pathway
(Sekimoto et al., 1996
).
Mutational analysis of STAT1 did not reveal a clear nuclear localization
sequence in this molecule (Sekimoto et
al., 1997
). Several recent studies have reported the nuclear
translocation of STAT1
under conditions of overexpression of
STAT1
fusion proteins in cells
(Melen et al., 2001
;
McBride et al., 2002
). Through
the use of mutations it has been concluded that STAT1
contains a novel
NLS that differs from the classical NLS such as that of SV40 T antigen and
IFN
(Melen et al.,
2001
; McBride et al.,
2002
). None of these studies tested STAT1
nuclear
translocation via the digitonin assay, so it is not possible to directly
compare our negative results above with STAT1
with those produced using
overexpression.
That the phosphorylation of STAT1 in itself is not sufficient for its
translocation into the nucleus has also been shown for angiotensin II receptor
(Sayeski et al., 2001
) and,
more recently, with the use of a chimeric receptor, which had an extracellular
domain of PDGF and an intracellular domain of gp130, the signaling subunit of
Oncostatin M receptor. Addition of PDGF to cells expressing this chimeric
receptor produced phosphorylated STAT1
, but no genes responsive to
IFN
were activated (Mahboubi and
Pober, 2002
). The following arguments suggest the requirement of
additional factor(s) for the migration of STATs into the nucleus. The same
STATs are utilized by different cytokines but give rise to different
physiological responses (reviewed in
Subramaniam et al., 2001b
).
IFN
has a molecular mass that should allow its entry into the nucleus
by simple diffusion, yet this molecule has a strong NLS. Association of
IFN
, IFNGR1 and STAT1
together with the nuclear importer NPI-1
strongly suggests that STAT1
may require a chaperoning function, which
is provided by the ligand and its receptor subunit. In conclusion, nuclear
translocation of STAT1
may not be unassisted, as the previous models
have suggested. Association of IFN
(containing a strong NLS), IFNGR1
and STAT1
with the nuclear importer, NPI-1, suggests a chaperoning role
for IFN
and IFNGR1 in nuclear translocation of STAT1
and may
have a role in imparting specificity to STAT1
activity.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Ahmed, C. M. I., Wills, K. N., Sugarman, B. J., Johnson, D. E., Ramachandra, M., Nagabhushan, T. L. and Howe, J. A. (2001). Selective expression of nonsecreted interferon by adenoviral vector confers antiproliferative and and antiviral properties and causes reduction of tumor growth in nude mice. J. Interferon Cytokine Res. 21,399 -408.[CrossRef][Medline]
Bejcek, B. E., Li, D. Y. and Deuel, T. F.
(1989). Transformation by v-sis occurs by an internal
autoactivation mechanism. Science
245,1496
-1499.
Dunbar, C. E., Browder, T. M., Abrams, J. S. and Nienhuis, A.
W. (1989). COOH-terminal modified interleukin-3 is retained
intracellularly and stimulates autocrine growth.
Science 245,1493
-1496.
Familetti, P. C., Rubinstein, S. and Pestka, S. (1981). A conventional and rapid cytopathic effect inhibition assay for interferon. Methods Enzymol. 78,387 -394.[Medline]
Farrar, M. A., Fernandez-Luna, J. and Schreiber, R. D.
(1991). Identification of two regions within the cytoplasmic
domain of the human interferon-gamma receptor required for function.
J. Biol. Chem. 266,19626
-19635.
Jans, D. A. and Hassan, G. (1998). Nuclear targeting by growth factors, cytokines and their receptors: a role in signaling? BioEssays 20,400 -411.[CrossRef][Medline]
Killion, J. J., Fishbeck, R., Bar-Eli, M. and Chernajovsky, Y. (1994). Delivery of interferon to intracellular pathways by encapsulation of interferon into multilamellar liposomes is independent of the status if interferon receptors. Cytokine 6, 443-449.[CrossRef][Medline]
Larkin, J., Johnson, H. M. and Subramaniam, P. S. (2000). Differential nuclear localization of IFNGR1 and IFNGR2 subunits of the IFN-gamma receptor complex following activation by IFN-gamma. J. Interferon Cytokine Res. 20,565 -576.[CrossRef][Medline]
Lin, S. Y., Makino, K., Xia, W., Matin, A., Wen, Y., Kwong, K.Y., Bourguignon, L. and Hung, M. C. (2001). Nuclear localization of EGF receptor and its potential new role as a transcription factor. Nat. Cell Biol. 3, 802-808.[CrossRef][Medline]
Mahboubi, K. and Pober, J. S. (2002). Activation of signal transducer and activator of transcription 1 (STAT1) is not sufficient for the induction of STAT1-dependent genes in endothelial cells. Comparison of interferon-gamma and oncostatin M. J. Biol. Chem. 277,801 -821.
McBride, K. M., Banninger, G., McDonald, C. and Reich, N. C. (2002). Regulated nuclear import of the STAT1 transcription factor by direct binding of importin-alpha. EMBO J. 21,1754 -1763.[CrossRef][Medline]
Melen, K., Kinnunen, L. and Julkunen, I.
(2001). Arginine/lysine-rich structural element is involved in
interferon-induced nuclear import of STATs. J. Biol.
Chem. 276,16447
-16455.
Pestka, S., Kotenko, S. V., Muthukumaran, G., Izotova, L. S., Cook, J. R. and Garotta, G. (1997). The interferon gamma (IFN-gamma) receptor: a paradigm for the multichain cytokine receptor. Cytokine Growth Factor Rev. 3, 189-206.
Rutherford, M. N., Kumar, A., Coulombe, B., Skup, D., Carver, D. H. and Williams, B. R. (1996). Expression of intracellular interferon constitutively activates ISGF3 and confers resistance to EMC viral infection. J. Interferon Cytokine Res. 16,507 -510.[Medline]
Sanceau, J., Sondermeyer, P., Beranger, F., Falcoff, R. and
Vaquero, C. (1987). Intracellular human gamma-interferon
triggers an antiviral state in transformed murine L cells. Proc.
Natl. Acad. Sci. USA 84,2906
-2910.
Sayeski, P. P., Ali, M. S., Frank, S. J. and Bernstein, K.
E. (2001). The angiotensin II-dependent nuclear translocation
of STAT1 is mediated by the Jak2 protein motif 231 YRFRR. J. Biol.
Chem. 276,10556
-10563.
Sekimoto, T., Nakajima, K., Tachibana, T., Hirano, T. and
Yoneda, Y. (1996). Interferon-gamma-dependent nuclear import
of STAT1 is mediated by the GTPase activity of Ran/TC4. J. Biol.
Chem. 271,31017
-31020.
Sekimoto, T., Imamoto, N., Nakajima, K. Hirano, T. and Yoneda, Y. (1997). Extracellular signal-dependent nuclear import of STAT1 is mediated by nuclear pore-targeting complex formation with NPI-1, but not Rch1. EMBO J. 16,7067 -7077.[CrossRef][Medline]
Smith, M. R., Muegge, K., Keller, J. R., Kung, H. F., Young, H. A. and Durum, S. K. (1990). Direct evidence of an intracellular role for IFN-gamma. Microinjection of human IFN-gamma induces Ia expression on murine macrophages. J. Immunol. 144,1777 -1782.[Abstract]
Stark, G. R., Kerr, I. M., Williams, B. R., Silverman, R. H. and Schreiber, R. D. (1998). How cells respond to interferons. Annu. Rev. Biochem. 67,227 -264.[CrossRef][Medline]
Subramaniam, P. S. and Johnson, H. M. (2002).
Lipid microdomains are required sites for the selective endocytosis and
nuclear translocation of IFN
, its receptor chain IFN
receptor-1,
and the phosphorylation and nuclear translocation of STAT1
.
J. Immunol. 169,1959
-1969.
Subramaniam, P. S., Mujtaba, M. G., Paddy, M. R. and Johnson, H.
M. (1999). The carboxyl terminal of interferon-gamma contains
a functional polybasic nuclear localization sequence. J. Biol.
Chem. 274,403
-407.
Subramaniam, P. S., Larkin, J., Mujtaba, M. G., Walter, M. R. and Johnson, H. M. (2000). The COOH-terminal nuclear localization sequence of interferon gamma regulates STAT1 alpha nuclear translocation at an intracellular site. J. Cell Sci. 113,2771 -2781.[Abstract]
Subramaniam, P. S., Green, M. M., Larkin, J., Torres, B. A. and Johnson, H. M. (2001a). Nuclear translocation of IFN-gamma is an intrinsic requirement for its biologic activity and can be driven by a heterologous nuclear localization sequence. J. Interferon Cytokine Res. 21,951 -959.[CrossRef][Medline]
Subramaniam, P. S., Torres, B. A. and Johnson, H. M. (2001b). So many ligands, so few transcription factors: a new paradigm for signaling through the STAT transcription factors. Cytokine 15,175 -187.[CrossRef][Medline]
Szente, B. E. and Johnson, H. M. (1994). Binding of IFN gamma and its C-terminal peptide to a cytoplasmic domain of its receptor that is essential for its function. Biochem. Biophys. Res. Commun. 201,215 -221.[CrossRef][Medline]
Szente, B. E., Soos, J. M. and Johnson, H. M. (1994). The C-terminus of IFN gamma is sufficient for its intracellular function. Biochem. Biophys. Res. Commun. 203,1645 -1654.[CrossRef][Medline]
Szente, B., Subramaniam, P. S. and Johnson, H. M. (1995). Identification of IFN-gamma receptor binding sites for JAK2 and enhancement of binding by IFN-gamma and its C-terminal peptide IFN-gamma (95-133). J. Immunol. 155,5617 -5622.[Abstract]
Thiam, K., Loing, E., Delanoye, A., Diesis, E., Gras-Masse, H., Auriault, C. and Verwaerde, C. (1998). Unrestricted agonist activity on murine and human cells of a lipopeptide derived from IFN-gamma. Biochem. Biophys. Res. Commun. 253,639 -647.[CrossRef][Medline]
Will, A., Hemmann, U., Horn, F., Rollinghoff, M. and Gessner, A. (1996). Intracellular murine IFN-gamma mediates virus resistance, expression of oligoadenylate synthetase, and activation of STAT transcription factors. J. Immunol. 157,4576 -4583.[Abstract]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
Related articles in JCS:
This article has been cited by other articles:
![]() |
E. Beurel and R. S. Jope Differential Regulation of STAT Family Members by Glycogen Synthase Kinase-3 J. Biol. Chem., August 8, 2008; 283(32): 21934 - 21944. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Wang, J. W. Holland, A. Carrington, J. Zou, and C. J. Secombes Molecular and Functional Characterization of IL-15 in Rainbow Trout Oncorhynchus mykiss: A Potent Inducer of IFN-{gamma} Expression in Spleen Leukocytes J. Immunol., August 1, 2007; 179(3): 1475 - 1488. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Ahmed, J. P. Martin, and H. M. Johnson IFN Mimetic as a Therapeutic for Lethal Vaccinia Virus Infection: Possible Effects on Innate and Adaptive Immune Responses J. Immunol., April 1, 2007; 178(7): 4576 - 4583. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Mujtaba, C. B. Patel, R. A. Patel, L. O. Flowers, M. A. Burkhart, L. W. Waiboci, J. Martin, M. I. Haider, C. M. Ahmed, and H. M. Johnson The Gamma Interferon (IFN-{gamma}) Mimetic Peptide IFN-{gamma}(95-133) Prevents Encephalomyocarditis Virus Infection both in Tissue Culture and in Mice. Clin. Vaccine Immunol., August 1, 2006; 13(8): 944 - 952. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. I. Ahmed and H. M. Johnson IFN-{gamma} and Its Receptor Subunit IFNGR1 Are Recruited to the IFN-{gamma}-Activated Sequence Element at the Promoter Site of IFN-{gamma}-Activated Genes: Evidence of Transactivational Activity in IFNGR1 J. Immunol., July 1, 2006; 177(1): 315 - 321. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. I. Ahmed, M. A. Burkhart, P. S. Subramaniam, M. G. Mujtaba, and H. M. Johnson Peptide Mimetics of Gamma Interferon Possess Antiviral Properties against Vaccinia Virus and Other Viruses in the Presence of Poxvirus B8R Protein J. Virol., May 1, 2005; 79(9): 5632 - 5639. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||