spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 10 June 2003
doi: 10.1242/jcs.00528


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jcs.00528v1
116/15/3089    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in JCS
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ahmed, C. M. I.
Right arrow Articles by Johnson, H. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ahmed, C. M. I.
Right arrow Articles by Johnson, H. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Journal of Cell Science 116, 3089-3098 (2003)
Copyright © 2003 The Company of Biologists Limited
doi: 10.1242/jcs.00528


Research Article

The role of IFN{gamma} nuclear localization sequence in intracellular function

C. M. Iqbal Ahmed*, Marjorie A. Burkhart, Mustafa G. Mujtaba, Prem S. Subramaniam and Howard M. Johnson

Department of Microbiology and Cell Science, University of Florida, P.O. Box 110700, Gainesville, FL, 32611-0700, USA

* Author for correspondence (e-mail: ahmed1{at}ufl.edu)

Accepted 1 April 2003


    Summary
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Intracellularly expressed interferon {gamma} (IFN{gamma}) has been reported to possess biological activity similar to that of IFN{gamma} added to cells. This study addresses the mechanisms for such similar biological effects. Adenoviral vectors were used to express a non-secreted form of human IFN{gamma} or a non-secreted mutant form in which a previously demonstrated nuclear localization sequence (NLS), 128KTGKRKR134, was replaced with alanines at K and R positions. With the vector expressing non-secreted wild-type IFN{gamma}, biological responses normally associated with extracellular IFN{gamma}, such as antiviral activity and MHC class I upregulation, were observed, although the mutant IFN{gamma} did not possess biological activity. Intracellular human IFN{gamma} possessed biological activity in mouse L cells, which do not recognize extracellularly added human IFN{gamma}. Thus, the biological activity was not due to leakage of IFN{gamma} to the surroundings and subsequent interaction with the receptor on the cell surface. Biological function was associated with activation of STAT1{alpha} and nuclear translocation of IFN{gamma}, IFNGR1 and STAT1{alpha}. Immunoprecipitation of cellular extracts with antibody to the nuclear transporter NPI-1 showed the formation of a complex with IFN{gamma}-IFNGR1-STAT1{alpha}. To provide the physiological basis for these effects we show that extracellularly added IFN{gamma} possesses intracellular signaling activity that is NLS dependent, as suggested by our previous studies, and that this activity occurs via the receptor-mediated endocytosis of IFN{gamma}. The data are consistent with previous observations that the NLS of extracellularly added IFN{gamma} plays a role in IFN{gamma} signaling.

Key words: Inteferon {gamma}, Nuclear localization sequence (NLS), STAT1{alpha}, MHC


    Introduction
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The current view is that interferon {gamma} (IFN{gamma}) activates cells via interaction with the extracellular domain of the receptor complex (reviewed in Stark et al., 1998Go). This in turn results in the activation of the receptor-associated tyrosine kinases JAK1 and JAK2, leading to phosphorylation and dimerization of the transcription factor STAT1{alpha}, which dissociates from the receptor cytoplasmic domain and undergoes nuclear translocation. This current view ascribes no further role to IFN{gamma} or the receptor chains IFNGR1 and IFNGR2 in IFN{gamma} signaling. The above scenario ignores several events associated with IFN{gamma} signaling. First, both IFN{gamma} and one of the receptor chains, IFNGR1, undergo internalization or endocytosis and nuclear translocation (Larkin et al., 2000Go; Subramaniam et al., 2000Go). Second, at least three separate studies showed that intracellular IFN{gamma} possessed biological activity that was qualitatively not unlike that of extracellular IFN{gamma}. In one, microinjection of human IFN{gamma} into mouse macrophage cells induced Ia expression (Smith et al., 1990Go). Extracellularly added human IFN{gamma} did not have an effect, since it does not recognize the extracellular domain of the mouse IFN{gamma} receptor complex. Another study involved internalizing human IFN{gamma} into mouse macrophages via a liposomal delivery system, resulting in induction of an antiproliferative effect (Killion et al., 1994Go). Finally, intracellular expression of the human IFN{gamma} gene in mouse fibroblasts in a non-secretory form resulted in induction of antiviral activity (Sanceau et al., 1987Go).

Recently, we have determined the structural basis for nuclear translocation of murine IFN{gamma} by identification of a polycationic nuclear localization sequence in its C-terminus (Subramaniam et al., 1999Go). Further, internalized IFN{gamma} binds to the cytoplasmic domain of the IFNGR1 receptor chain (Szente et al., 1994Go). Immunoprecipitation experiments showed that a cytoplasmic complex of IFN{gamma}-IFNGR1-STAT1{alpha} complexed to the nuclear importin {alpha} protein, NPI-1, occurs in an NLS-dependent fashion (Subramaniam et al., 2000Go). Thus, the internalization of IFN{gamma} and nuclear transport of IFN{gamma} and IFNGR1 appear to be a mechanism for nuclear import of the IFN{gamma} transcription factor STAT1{alpha}.

In the present study, we have expressed a non-secretable form of human IFN{gamma} and found it to be biologically active. In order to demonstrate that the NLS of IFN{gamma} was key to the intracellular events described above, positively charged amino acids in the NLS were replaced with alanines, such that the NLS sequence 128KTGKRKR134 was mutated to 128ATGAAAA134. Non-secreted forms of IFN{gamma} or its NLS-mutated version were tested in murine and human cells for their ability to induce IFN{gamma} activity, to activate STAT1{alpha} and to carry out nuclear translocation of STAT1{alpha}. The data show that intracellularly expressed IFN{gamma}, like extracellularly added IFN{gamma}, interacts with the cytoplasmic domain of IFNGR1 via its C-terminal NLS and that the IFN{gamma}-IFNGR1-STAT1{alpha} complex is in turn complexed to NPI-1 for nuclear import of STAT1{alpha}.


    Materials and Methods
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines and recombinant adenoviruses
Human embryonic kidney cell line 293 (ATCC, Gaithersburg, MD) used for the propagation of recombinant adenoviruses was grown in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum. Human WISH and mouse L929 cells (ATCC) were grown in Eagle's minimal essential medium (EMEM) containing 10% fetal bovine serum. P388D1 cells were grown in RPMI 1640 medium containing 10% fetal bovine serum.

AdEasy adenoviral vector system from Stratagene (La Jolla, CA) was used. Construction and propagation of adenoviral vectors was carried out according to the manufacturer's protocol. A plasmid containing human IFN{gamma} (ATCC) was used to carry out PCR using the following primers: CGGTCGACGAACGATGAAATATACAAGTTATATC (forward) and GCAAGCTTCATTACTGGGATGCTCTTCGAC (reverse). To obtain the non-secreted IFN{gamma} sequence, we used a forward primer that had the initiating methionine and the remainder of the coding sequence from the first amino acid in mature polypeptide, with the following sequence, CGGTCGACGAACGATGTGTTACTGCCAGGACCCATA. The reverse primer was the same as above for secreted IFN. NLS-modified IFN{gamma} sequence was obtained by using a reverse primer in which the coding sequence was changed to replace lysine or arginine with alanines, and the same forward primer as for the non-secreted IFN. PCR products were digested with SalI (5' end) and HindIII (3' end), and the resulting fragments were cloned in the multiple cloning site in the plasmid, pShuttleCMV. For the control plasmid, pShuttle MCS, which does not have a transgene, was used. Linearized plasmids as above were cotransformed with pAdeasy plasmid in BJ5183 to obtain recombinant adenovirus sequence. Recombinant plasmids were used to infect human embryonic kidney 293 cells to obtain viruses. Purification of viruses was carried out by using two CsCl gradients. These viruses were characterized by restriction enzyme digestion and DNA sequencing across the coding sequence. Cells that were about 50% confluent were infected with different recombinant adenoviruses at a multiplicity of infection (m.o.i.) of 10 for 1 hour, followed by growth in EMEM medium.

Western blot analysis and immunoprecipitation
Cells were washed with phosphate-buffered saline (PBS) and harvested in lysis buffer [50 mM Tris-HCl, pH 7.5, 250 mM NaCl, 0.1% NP-40, 50 mM NaF, 5 mM EDTA and protease inhibitor cocktail (Roche Biochemicals, Indianapolis, IN)]. Protein concentration was measured using a BCA kit from Pierce (Rockford, IL). Protein (10 µg each) was electrophoresed on an acrylamide gel, transferred to nylon membrane and probed with the antibodies indicated. Horseradish-peroxidase-conjugated secondary antibodies were used, and detection was carried out by chemiluminescence (Pierce). Immunoprecipitation was carried out by incubating specific antibodies with cell extracts followed by incubation with IgG-Sepharose (Sigma Chemicals, St. Louis, MO), followed by centrifugation and washing. The phospho-STAT 1 antibody was from Cell Signaling (Beverly, MA). The polyclonal antibody to STAT1{alpha} was from R&D chemicals (Minneapolis MN). Antibodies to NPI-1 and IFNGR1 were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). The monoclonal antibody to IFN{gamma} used to probe immunoprecipitate was obtained from PBL Biomedical (New Brunswick, NJ). The ELISA kit for IFN{gamma} was obtained from Biosource International (Camarillo, CA).

Antiviral assay
Antiviral assays were performed by using a cytopathic effect (CPE) reduction assay using Vesicular Somatitis Virus (VSV) (Familetti et al., 1981Go). Mouse L929 (4x103) cells were plated in a microtiter dish and allowed to grow overnight. These cells were then infected with different adenoviruses and incubated for various times followed by growth in EMEM medium for 24 hours. VSV was then added to these cells and incubated for 24 hours. Cells were stained with crystal violet. The dye retained was extracted in methylcellusolve, and absorption at 550 nM was measured.

Expression of MHC class I
Cells were transfected with different recombinant adenoviruses for 1 hour, followed by growth in EMEM medium for 48 hours. Cells were then washed and incubated with a monoclonal antibody to human MHC class I molecules conjugated with R-phycoerythrin (R-PE). Mouse IgG2a conjugated with R-PE was used as a control. Both of these R-PE-conjugated antibodies were from Ancell (Bayport, MN). Cells were analyzed for immunofluorescence (FL-2) in a FACScan flow cytometer (Becton Dickinson Immunocytometry Systems, Mountain View, CA). Data were collected in list-mode format and analyzed using CellQuest software (Becton Dickinson Immunocytometry Systems).

Immunofluorescence analysis
WISH cells (3x105) were grown overnight on tissue-culture-treated slides (Falcon, Becton Dickinson, Franklin Lakes, NJ) before infecting with adenovirus vector for 1 hour. This was followed by growth in EMEM medium for 7 hours. Cells were then fixed in methanol (–20°C) and dried. Cells were permeabilized using 0.5% Triton X-100 in 10 mM Tris-HCl, pH 8, 0.9% NaCl (TBS) for 10 minutes. Slides were washed in TBS and non-specific sites were blocked with 5% non-fat milk in TBS. Slides were then incubated for 1 hour in the same blocking buffer containing rabbit polyclonal antisera against IFNGR1 (Santa Cruz Biotechnology, Santa Cruz, CA) and goat polyclonal antisera to human STAT1{alpha} (R&D Systems). Cells were washed four times with TBS containing 0.1% Triton. This was followed by incubation with secondary antibodies, which were Cy-2-conjugated donkey anti-rabbit (Jackson Immunochemicals) and Alexa-Fluor-594-conjugated donkey anti-goat antisera (Molecular Probes, Eugene, OR) for 1 hour. After four washings in TBS with 0.1% Triton, slides were mounted in Prolong antifade solution (Molecular Probes), covered with a coverslip and sealed with nail varnish. To view the nuclear translocation of IFN{gamma}, slides were incubated with a monoclonal antibody to human IFN{gamma} (BD Pharmingen, San Diego, CA) as the primary antibody and Alexa-Fluor-488-conjugated anti-mouse antibody (Molecular Probes) as the secondary antibody. Images were recorded on epifluorescence microscope attached to a Macintosh computer running IP Lab software and deconvolution software (Scanylatics Corp). Images were recorded and a portion of out-of-focus haze from each image removed using the MicroTome software (Vaytek) to improve clarity. Quantitation of these images was done by measuring mean pixel intensity in cytoplasmic (Fc) and nuclear (Fn) regions in each cell using IP Lab software (Scanylatics Corp). The ratio Fn/Fc was determined for each cell and the average of the ratio Fn/Fc across at least seven different fields was measured and is presented as Fn/Fc for a given treatment.


    Results
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression vectors
The adenovirus vector used in these studies, pAdEasy, is a derivative of ad5, which is deleted in early regions I and III. A cassette of the CMV-promoter-driven transgene replaces early region I. These vectors are replication deficient, owing to the deletion of early region I. The vector without the transgene is denoted as rAde. CMV-promoter-driven non-secreted IFN{gamma} and NLS-modified non-secreted IFN{gamma} were designated as rAdnI and rAdnIm, respectively. These vectors were first characterized by restriction enzyme digestion, followed by DNA sequencing across the transgene.

To follow the synthesis of IFN{gamma}, WISH cells were transduced with control or IFN{gamma}-expressing vectors. Proteins from cell extracts and supernatants, obtained two days after infection, were electrophoresed and probed with an antibody to IFN{gamma} (Fig. 1A). Vectors expressing both the non-secreted IFN{gamma} and NLS-modified non-secreted IFN{gamma} showed the presence of IFN{gamma} in cell extracts, and none was detected in the supernatants. There was no IFN{gamma} expression in cells transduced with the empty control vector, suggesting that the infection with recombinant adenovirus in itself does not induce endogenous IFN{gamma} expression. To test if murine L 929 cells were infectable with the recombinant adenovirus vectors, cell extracts and supernatants after infection with rAde, rAdnI and rAdnIm were assayed for IFN{gamma} by ELISA (Fig. 1B). Synthesis of IFN{gamma} was observed in cell extracts from cells treated with rAdnI and rAdnIm, whereas the supernatants from the same cells did not have any detectable IFN{gamma}. Similarly, cell extracts or supernatants from L 929 cells infected with empty vector did not have any detectable IFN{gamma}. In addition, purified virus preparations were found to be free of IFN{gamma}. Therefore, the effects observed below were not from free contaminating IFN{gamma} acting extracellularly. Thus, IFN{gamma} produced from rAdnI or rAdnIm was expressed intracellularly and not secreted.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 1. Synthesis and intracellular retention of IFN{gamma}. (A) WISH cells, untreated (lanes 1 and 2) or those transduced for two days with an empty vector control (lanes 3 and 4) or a vector expressing non-secreted IFN{gamma} (lanes 5 and 6) or a vector expressing non-secreted IFN{gamma} mutated in the NLS (lanes 7 and 8) were used. Proteins from cell extracts (odd-numbered lanes) or supernatants (even-numbered lanes) were separated by SDS-PAGE and probed with an antibody to IFN{gamma}. Detection was carried out by using chemiluminescence. (B) Quantitation of IFN{gamma} produced in L929 cells by ELISA. Cell extracts (odd numbers) and supernatants (even numbers) from L929 cells, transduced for two days with the empty adenoviral vector (column 1 and 2) or vector expressing non-secreted IFN{gamma} (column 3 and 4) or vector expressing non-secreted IFN{gamma} mutated in the NLS (column 5 and 6) were assayed for IFN{gamma} by ELISA.

 

Biological activity of non-secreted IFN{gamma} is dependent on the presence of NLS
We next determined if intracellularly expressed IFN{gamma} possessed biological activity. Murine L cells were chosen for this study because these cells are not responsive to human IFN{gamma} added extracellularly, so the effect observed would have to result from intracellular action of interferon. Although the extracellular recognition by the receptor is species specific, intracellular signaling events are not species specific because of extensive homology in the cytoplasmic region of IFNGR1 for human and mouse sequences that bind the C-terminus of both human and mouse IFN{gamma} (Szente and Johnson, 1994Go). In fact, there is greater than 90% homology in this region of the cytoplasmic binding site of IFNGR1. Mouse L cells, untreated or transduced with an empty vector control, non-secreted IFN{gamma} or NLS-modified non-secreted IFN{gamma} expressing vector were allowed to grow for one day and then they were challenged with VSV. A day later, these cells were compared to discover their relative resistance to VSV-induced cytopathic effect (Fig. 2). With intracellular IFN{gamma} expression, a threefold increase in cell survival was observed compared with untreated cells or cells treated with empty vector. With expression of NLS-modified IFN{gamma}, cell survival was reduced to nearly the same level as with the empty vector control. Intracellularly expressed IFN{gamma} thus induced antiviral activity in cells, and this activity was dependent on the presence of the NLS at its C-terminus. Given that mouse L cells do not recognize human IFN{gamma} via the extracellular domain of the receptor, the data further support an intracellular effect of human IFN{gamma}.



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 2. Resistance to viral infection by intracellular human IFN{gamma} is dependent on the presence of the NLS. Mouse L929 cells, untreated (column 1) or those transduced for 1 hour with an empty vector control (column 2), a vector expressing non-secreted human IFN{gamma} (column 3) or a vector expressing non-secreted IFN{gamma} with a mutation in the NLS (column 4) were allowed to grow for 24 hours, followed by infection with VSV for 24 hours. Cells were then stained with crystal violet, extracted with methylcellusolve, and the absorbance was measured, as described in Materials and Methods. Absorbance in cells that were not exposed to any virus was taken as 100%, and the percentage of cells surviving other treatments is presented. Results represent the mean of three independent determinations.

 

Extracellularly added IFN{gamma} induce MHC class I molecule expression on the cell surface. To test if non-secreted IFN{gamma} also had a similar activity, WISH cells were transduced with an empty vector control, non-secreted IFN{gamma} or NLS-modified non-secreted IFN{gamma} expression vector. Two days later, these cells were stained with R-phycoerythrin (R-PE)-conjugated monoclonal antibody to human MHC class I molecules, and the cells were analyzed by flow cytometry. As an isotype control, murine IgG2a antibodies conjugated with R-PE were used. Relative mean fluorescence profiles are presented in Fig. 3. Cells transduced with the empty vector control, non-secreted IFN{gamma} or NLS-mutated IFN{gamma} expression vectors showed 417±9, 778±10 and 362±29 units of mean fluorescence, respectively. Therefore, intracellular expression of IFN{gamma} induced an approximately twofold increased expression of MHC I molecules. This induction was abolished with the removal of the NLS. Intracellularly expressed IFN{gamma} therefore induces antiviral activity and upregulation of MHC class I molecules only with an intact NLS in its C-terminus.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3. Induction of MHC class I by intracellular expression of IFN{gamma} is abolished by removal of the NLS. WISH cells were transduced for 1 hour with an empty vector control (dotted line), a vector expressing non-secreted IFN{gamma} (dark grey) or a vector expressing non-secreted IFN{gamma} mutated in NLS (light grey). Cells were then allowed to grow for 48 hours in regular medium followed by staining with R-PE-conjugated monoclonal antibody to human MHC class I and analysis by flow cytometry. R-PE-conjugated murine IgG2a was used as a control. A similar profile was noted in three independent experiments.

 

Activation of STAT1{alpha} and its association with IFN{gamma}, IFNGR1 and NPI-1
To determine if the biological activity observed with non-secreted IFN{gamma} involved the activation of STAT1{alpha}, whole cell extracts from WISH cells transduced with an empty vector control, non-secreted IFN{gamma} or NLS-modified non-secreted IFN{gamma} expression vector were analyzed (Fig. 4). Phosphorylation of STAT1{alpha} was observed in response to intracellular expression of both wild-type IFN{gamma} and its NLS mutant as seen by probing with Tyr701phospho-STAT1-specific antibody. Cells transduced with empty vector control did not show STAT1{alpha} Tyr701 phosphorylation. Re-probing this filter to look for STAT1{alpha} showed similar amounts of STAT1{alpha} in all cell extracts. Thus, the intracellular expression of NLS-mutated IFN{gamma} induced STAT1{alpha} tyrosine phosphorylation similarly to wild-type IFN{gamma}.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 4. Phosphorylation of STAT1{alpha} by intracellular IFN{gamma} is independent of the IFN{gamma} C-terminal NLS. WISH cells, untreated (lane 1) or treated with an empty vector control (lanes 2), a vector expressing non-secreted IFN{gamma} (lanes 3) or a vector expressing non-secreted IFN{gamma} with a mutated NLS (lanes 4) were allowed to grow for 8 hours. Proteins from whole cell extracts were electrophoresed and probed with an antibody to phospho-STAT1 (upper panel). Filter was stripped and re-probed with an antibody to STAT1{alpha} (lower panel). Detection was by chemiluminescence.

 

We have previously shown that IFN{gamma} addition to cells resulted in the formation of a complex of IFN{gamma}-IFNGR1-STAT1{alpha} in the cytoplasm and that the nuclear importin {alpha} homolog, NPI-1, binds to the complex via the NLS in the C-terminus of IFN{gamma} (Larkin et al., 2000Go; Subramaniam et al., 2000Go). Further, we have previously provided evidence that the NLS of IFN{gamma} is responsible for the nuclear transport of STAT1{alpha} (Subramaniam et al., 2000Go), which otherwise lacks an intrinsic NLS, which was demonstrated by the standard digitonin-based nuclear import assay (P. S. Subramaniam and H. M. Johnson, unpublished). Key to the chaperoning of STAT1{alpha} to the nucleus is the ability of IFN{gamma} to bind to the cytoplasmic domain of IFNGR1 as well as to NPI-1 via its C-terminal NLS (Subramaniam et al., 2000Go). We therefore immunoprecipitated NPI-1 from extracts of cells expressing IFN{gamma} intracellularly 18 hours after transduction with the empty vector or the vectors expressing wild-type IFN{gamma} and NLS-mutated IFN{gamma}. Immunoprecipitated proteins were then electrophoresed and probed individually with antibodies specific for IFNGR1, IFN{gamma}, phosphorylated STAT1{alpha} (p-STAT1{alpha}) and NPI-1 (Fig. 5). Cells expressing wild-type IFN{gamma} intracellularly contained IFNGR1, IFN{gamma} and p-STAT1 in the anti-NPI-1 immunoprecipitate (Fig. 5, lane 3), whereas anti-NPI-1 precipitate from untreated cells (Fig. 5, lane1) and cells transduced with NLS-mutated IFN{gamma} vector (Fig. 5, lane 2) were negative for IFNGR1, IFN{gamma} and p-STAT1{alpha}. Similar concentrations of NPI-1 were present in the immunoprecipitates from all cell extracts. Thus, intracellular wild-type IFN{gamma} formed a complex of IFN{gamma}-IFNGR1-STAT1{alpha}-NPI-1, but this complex was absent in cells expressing the IFN{gamma} NLS mutant. Since, NLS mutant IFN{gamma} also activated STAT1{alpha} phosphorylation similarly to wild-type IFN{gamma}, these data suggest that the IFN{gamma} NLS is required for the binding of phosphorylated STAT1{alpha} to NPI-1.



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 5. Association of activated STAT1, IFN{gamma} and IFNGR1 with nuclear importer, NPI-1. Cell extracts from WISH cells transduced for 8 hours with an empty vector (lane 1), NLS-mutated IFN{gamma} expression vector (lane 2) or non-secreted IFN{gamma} expression vector (lane 3) were used for immunoprecipitation with an antibody to NPI-1. Equal amounts of immunoprecipitates were electrophoresed and probed individually with antibodies to IFNGR1 (first row), IFN{gamma} (second row), phospho-STAT1 (third row) or NPI-1 (fourth row).

 

Nuclear translocation of STAT1{alpha}, IFNGR1 and IFN{gamma}
Consistent with intracellular activation of STAT1{alpha} and the association of IFNGR1 with nuclear import machinery, cells expressing IFN{gamma} intracellularly also showed the movement of STAT1{alpha} and IFNGR1 to the nucleus by immunofluorescence analysis. Simultaneous staining of WISH cells with antibodies to STAT1{alpha} and IFNGR1 showed the translocation of these molecules into the nucleus with the intracellular expression of IFN{gamma}, wheras the NLS-modified IFN{gamma} or the empty vector failed to induce similar translocation of either of these (Fig. 6A). Further, consistent with our previous studies (Larkin et al., 2000Go), cells that were simultaneously stained with IFNGR2 and STAT1{alpha} showed translocation of only STAT1{alpha}, whereas IFNGR2 was not translocated with the expression of intracellular IFN{gamma}, and neither of these was translocated with the NLS-modified IFN{gamma} or the control vector (data not shown). Fluorescence images from at least seven different fields were then used to quantitate the ratio of fluorescence in nuclei (Fn) to the fluorescence in cytoplasmic (Fc) fractions. Thus, cells expressing non-secreted IFN{gamma} showed translocation of both STAT1 and IFNGR1 into the nucleus, whereas the cells treated with NLS-modified IFN{gamma} or the empty vector did not show nuclear translocation (Fig. 6B).



View larger version (97K):
[in this window]
[in a new window]
 
Fig. 6. Nuclear translocation of STAT1{alpha} and IFNGR1 by intracellular IFN{gamma} requires the NLS of IFN{gamma}. (A) WISH cells were transfected for 8 hours with an empty vector (column 1), a vector expressing non-secreted IFN{gamma} (column 2) or a vector expressing NLS-modified IFN{gamma} (column 3) and stained simultaneously with antibodies to STAT1{alpha} and IFNGR1. Secondary antibodies to STAT1{alpha} conjugated to Alexa 594 (top row) or to IFNGR1 conjugated to Cy-2 (bottom row) were used and analyzed by fluorescence microscopy. (B) Quantitation of images. Images of cells transduced with an empty vector control (left lanes), a vector expressing non-secreted IFN{gamma} (middle lanes) or a vector expressing NLS-mutated IFN{gamma} (right lanes) were viewed in seven different fields to a obtain mean ratio of nuclear pixel intensity (Fn) to cytoplasmic pixel intensity (Fc). STAT1{alpha} and IFNGR1 Fn/Fc for nsIFN{gamma} versus mutant were both significant at P<0.002 by t-test. Calculations for fluorescence in the nucleus (N) versus cytoplasm (C) were also done by using N/N+C. Four independent measurements showed a P<0.03 by t-test for the nuclear translocation of STAT1{alpha} and IFNGR1 for the wild-type IFN{gamma} versus the NLS-mutated IFN{gamma}.

 

Since IFN{gamma} is also translocated into the nucleus, we determined the effects of removal of the NLS on such translocation by using immunofluorescence analysis (Fig. 7A). Intracellular expression of IFN{gamma} resulted in its nuclear translocation, whereas removal of the NLS resulted in lack of nuclear tanslocation of IFN{gamma}. With the empty vector control, no IFN{gamma} signal was seen (Fig. 7A). Mean fluorescence intensities for the non-secreted and NLS-mutated forms of IFN{gamma} were compared by measuring mean pixel intensity across several lines drawn through the cells as shown in Fig. 7B. The results show approximately 40% more fluorescence in nuclei treated with non-secreted IFN{gamma} compared with the NLS-mutated IFN{gamma}. Quantitation of the images (Fn/Fc ratios) is shown in Fig. 7B. Association of IFN{gamma} together with IFNGR1 and STAT1{alpha} points to a role for this ligand and one of its receptor subunits in chaperoning STAT1{alpha} into the nucleus.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 7. Nuclear translocation of IFN{gamma} requires the presence of the C-terminus NLS. (A) WISH cells, transduced for 8 hours with an empty vector control (top) or a vector expressing non-secreted IFN{gamma} (middle left) or NLS-modified IFN{gamma} (middle right) were probed with a monoclonal antibody to IFN{gamma} and stained with a Alexa-Fluor-488-conjugated secondary antibody and analyzed by confocal microscopy. The lower graphs show mean fluorescence intensity comparisons for non-secreted IFN{gamma} and NLS-mutated IFN{gamma}. Measurements of fluorescence intensities were done with IP Lab (Scanalytics) using the MP-line measure tool. Mean pixel intensity was measured across a line drawn through the cells in the plane of the images shown. A representative measurement line is shown in white. The resultant graphs were generated by the software averaging the intensities of a total of 100 pixels on either side of the line at each point along the line. Triplicate determinations showed a significance of P<0.25 (t-test) for nuclear presence of IFN{gamma} versus NLS mutant. (B) Quantitation of images. Images of cells transduced with non-secreted IFN{gamma} or NLS-mutated nonsecreted IFN{gamma} were used to determine Fn/Fc values, which are shown in columns 1 and 2, respectively. Seven fields were examined and the results were averaged±s.d. The significance was P<0.02 by the t-test. Calculations for fluorescence in the nucleus (N) versus cytoplasm (C) were also done by using N/N+C. Four independent measurements showed a P<0.025 for the nuclear translocation of IFN{gamma} for the wild-type IFN{gamma} versus the NLS-mutated IFN{gamma}.

 

Evidence for intracellular function of extracellularly added IFN{gamma}
We have shown above that intracellularly expressed IFN{gamma} activates STAT1{alpha} similarly to IFN{gamma} added extracellularly to cells. Our previous studies have shown that the C-terminus of human and murine IFN{gamma}, defined by peptides huIFN{gamma} (95-134) and muIFN{gamma} (95-133), bind to the cytoplasmic domain of soluble recombinant human and murine receptor chain IFNGR-1 via the region IFNGR-1 (253-287) (Szente et al., 1994Go). One would predict that if this domain of IFNGR-1 played an essential role in IFN{gamma} signaling, an intracellular excess of the peptide IFNGR-1 (253-287) should compete for intracellular binding of IFN{gamma} and thus interfere with IFN{gamma} early signaling events. To test this we used the murine macrophage cell line P388D1, which internalizes peptides by pinocytosis as demonstrated previously in our earlier studies using peptides of the C-terminus of IFN{gamma} (Szente and Johnson, 1994Go). Pinocytosis by P388D1 is an active process that requires cells to be incubated at 37°C. Firstly, in binding assays at 4°C (no pinocytosis) we established that extracellularly added cytoplasmic IFNGR-1 (253-287) peptide does not interfere with binding of extracellular 125I-IFN{gamma} to the receptor at the concentrations to be used for functional studies at 37°C (Fig. 8A). Extracellular addition of IFNGR-1 cytoplasmic domain peptide did not inhibit the binding of 125I-IFN{gamma} to the receptor extracellular domain on these cells.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 8. Intracellular presence of peptide IFNGR-1(253-287) inhibits binding to IFNGR of extracellular IFN{gamma} and subsequent activation of STAT1{alpha}. (A) Presence of extracellular peptide IFNGR-1(253-287) did not inhibit binding of 125I-IFN{gamma} to P388D1 cells at the concentrations to be used in subsequent experiments. Unlabeled murine IFN{gamma} or peptide IFNGR-1(253-287), as indicated, was added at a final concentration of 1 µM to P388D1 cells at 4°C along with 10 nM of 125I-IFN{gamma}, and cells were incubated at 4°C for 30 minutes. Control cells were incubated with 125I-IFN{gamma} in the absence of any competitor. Cells were then washed and bound IFN{gamma} determined. Samples were run in triplicate and values plotted as mean±s.d. (B) Intracellular accumulation of peptide IFNGR-1(253-287) in P388D1 cells by pinocytosis was accomplished by incubating cells with either 25 µM (lane 2) or 50 µM (lane 3) of peptide at 37°C for 1 hour. Cells used in lanes 1 and 4 did not receive any peptide. Cells were then washed at room temperature to remove extracellular peptide and then incubated with 125I-IFN{gamma} (10 nM) along with 1 µM of IFNGR-1 peptide for 5 minutes at 37°C. Control cells (lane 1) were washed in ice-cold medium and then incubated with 125I-IFN{gamma} at 4°C without peptide. After 125I-IFN{gamma} incubation, all cells were washed at 4°C and then acid-washed at 4°C to remove surface-bound 125I-IFN{gamma}. Cells were then lysed and immunoprecipitated with antibodies to IFNGR-1. After western transfer of immunoprecipitates to nitrocellulose membranes, 125I-IFN{gamma} associated with IFNGR-1 was detected by autoradiography. Total IFNGR-1 immunoprecipitated was followed by immunodetection with IFNGR-1 antibodies (lower panel). (C) Conditions are the same as in (B), except that lysates were immunoprecipitated with STAT1{alpha} antibodies and tyrosine phosphorylation of immunoprecipitated STAT1{alpha} was followed by immunodetection with antibodies specific for Tyr701-phosphorylated STAT1{alpha}. Total immunoprecipitated STAT1{alpha} was followed by reprobing blots with antibodies to STAT1{alpha} (lower panel).

 

To determine functional effects, the following experiment was performed. Cells were preloaded with the peptide muIFNGR-1 (253-287) at 37°C, washed to remove excess peptide and then challenged with extracellular 125I-labeled IFN{gamma} at 37°C, in the presence of 1 µM of IFNGR-1 (253-287) that does not inhibit IFN{gamma} extracellular binding as per Fig. 8A. After 5 minutes at 37°C, cells were washed at 4°C, and extracellularly bound 125I-IFN{gamma} was removed by acid washing at 4°C. Cell lysates were immunoprecipitated with polyclonal antibodies to IFNGR-1, and 125I-IFN{gamma} was detected by autoradiography to follow internalized IFN{gamma} bound to IFNGR-1. As seen in Fig. 8B, cells that were not preloaded with peptide (lane 4) showed detectable levels of 125I-IFN{gamma} associated with IFNGR-1. By contrast, where cells were preloaded with 25 µM (lane 2) or 50 µM of IFNGR-1 (253-287) peptide (lane 3), 125I-IFN{gamma} did not bind to the cytoplasmic domain of IFNGR-1. Lane 1 shows that at 4°C, where internalization is blocked, even in the absence of preloading of peptide no signal for 125I-IFN{gamma} was detectable. Thus, the presence of free intracellular IFNGR-1 (253-287) peptide blocked the binding of internalized 125I-IFN{gamma} to IFNGR-1. These data show that extracellularly added IFN{gamma} that is internalized interacts with the cytoplasmic domain of IFNGR-1 in intact cells and that this interaction is blocked by IFNGR-1 cytoplasmic peptide IFNGR-1 (253-287), an IFNGR-1 cytoplasmic binding site for IFN{gamma} (Szente and Johnson, 1994Go). The peptide did not block binding of IFN{gamma} to the receptor extracellular domain (Szente et al., 1994Go) (Fig. 8A).

To determine the effect of the cytoplasmic binding on signaling, we performed the same experiment as above but this time followed STAT1{alpha} tyrosine phosphorylation (Fig. 8C). Binding of internalized IFN{gamma} to IFNGR-1 resulted in STAT1{alpha} phosphorylation (lane 4). STAT1{alpha} tyrosine phosphorylation was inhibited by preloading cells with IFNGR-1(253-287) (lanes 2 and 3). Thus, the binding of internalized IFN{gamma} to the IFNGR-1 cytoplasmic domain is linked to the activation and tyrosine phosphorylation of STAT1{alpha}. The data from Fig. 8 demonstrate that under normal physiological conditions there is an intracellular role in signaling for extracellularly added IFN{gamma}. Our data presented earlier with intracellularly expressed IFN{gamma} are also consistent with this conclusion, and together these data highlight for the first time a mechanism for the physiological function of intracellular IFN{gamma}.

Presumably following endocytosis of IFNGR-1 after interaction with IFN{gamma}, the IFNGR-1 cytoplasmic domain would be present on the surface of the endocytic vesicle. The data suggest that IFN{gamma} at some time during internalization traverses the membrane of the endocytic vesicle to interact with the cytoplasmic domain of IFNGR-1 at the site identified by peptide IFNGR-1 (253-287). This would suggest that there is a membrane penetration property associated with IFN{gamma}.

In keeping with the implications of the above data, we next determined whether the C-terminal NLS domain itself was required for internalization of human IFN{gamma}. We have previously characterized a C-terminal deletion mutant of huIFN{gamma}, IFN{gamma} (1-123) and have shown that this mutant binds to the extracellular domain of IFNGR on cells with the same affinity as intact IFN{gamma} (Subramaniam et al., 2000Go). IFN{gamma} (1-123) is deleted in the NLS region. We compared its internalization with that of intact IFN{gamma} using 125I-labeled IFNs. After binding of 125I-IFN{gamma} and 125I-IFN{gamma} (1-123) to WISH cells at 4°C, cells were washed to remove unbound ligands and incubated at 37°C for various times followed by acid washing to follow internalization of the bound 125I-IFN{gamma} and 125IFN{gamma} (1-123). As can be seen in Fig. 9, intact IFN{gamma} was rapidly internalized, whereas IFN{gamma} (1-123) did not undergo significant internalization. The small negative values seen at later times for IFN{gamma} (1-123) most probably represent the slow dissociation of surface-bound ligand upon prolonged incubation at 37°C in the absence of its internalization. Thus, these data suggest that the C-terminal region of IFN{gamma} containing the NLS is required for its internalization and may play a critical role in IFN{gamma} traversing the endocytic vesicle membrane to bind to the cytoplasmic domain of IFNGR-1.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 9. The deletion mutant IFN{gamma}(1-123) is not internalized compared to wild-type IFN{gamma}. Internalization assays were run as described previously (Farrar et al., 1991Go). Briefly, 125I-labeled wild-type and mutant IFN{gamma} (80-85 µCi/µg) were added to WISH cells at 5 nM. Cells were incubated at 4°C for 90 minutes, washed at 4°C and then incubated at 37°C for the indicated times. At the indicated times internalized cpm was counted from acid-washed cells lysed in 1% SDS. Data are plotted as a percentage of the total ligand bound that was internalized. Samples were run in triplicate and data are plotted as mean±s.d.

 


    Discussion
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have shown in this report that intracellularly expressed human IFN{gamma} is biologically active. The intracellular function of human IFN{gamma} required the presence of a previously identified NLS, 128KTGKRKR134 (Subramaniam et al., 1999Go). Modification of this sequence to 128ATGAAAA134 resulted in loss of intracellular human IFN{gamma} antiviral activity in mouse cells and upregulation of MHC class I antigens in human WISH cells and was associated with loss of nuclear import of STAT1{alpha} function. We have also shown that extracellularly added IFN{gamma} is endocytosed under conditions that requires the IFN{gamma} NLS and that the internalized IFN{gamma} binds to the cytoplasmic domain of receptor chain IFNGR-1. This binding is associated with STAT1{alpha} activation. Our data establish for the first time that intracellular IFN{gamma} interactions are also physiologically necessary for the biological effects of extracellular IFN{gamma} and provide a mechanism for how this occurs.

The data with intracellularly expressed IFN{gamma} suggest that intracellular IFN{gamma} can generate biological activity without the recognition of the extracellular domain of the receptor. The following cytokines and growth factors, when expressed with modifications that restricted their localization to the cytoplasm, were also found to be biologically active: human IFN {alpha}2b, IFN {alpha}2{alpha}1 (Ahmed et al., 2001Go), IFN {alpha} consensus (Rutherford et al., 1996Go), murine IFN{gamma} (Will et al., 1996Go), IL-3 (Dunbar et al., 1989Go) and v-sis (Bejcek et al., 1989Go). It is possible that these ligands interact with a motif on the cytoplasmic side of their receptor(s) that initiates a cascade of events required for the nuclear import of STATs, as has been demonstrated for IFN{gamma} (Szente et al., 1994Go; Szente et al., 1995Go). A feature common to these ligands and/or their receptors is the presence of an NLS or an NLS-like motif, which may have a role in directing the respective STATs to the nucleus (reviewed in Subramaniam et al., 2001bGo).

The IFN{gamma} receptor consists of two subunits that are denoted as IFNGR1 and IFNGR2 (reviewed in Pestka et al., 1997Go). IFNGR1 contains the sites for binding of the ligand on the extracellular surface and the sites for Jak1 and STAT1 binding on the intracellular surface. We have shown earlier that a polypeptide from the C-terminus of murine or human IFN{gamma} containing a nuclear localization signal (NLS) was capable of binding to a region of IFNGR1 sequence located on the cytoplasmic side of the plasma membrane (Szente et al., 1994Go; Szente et al., 1995Go). Internalization of this polypeptide was shown to be sufficient to induce an antiviral state and to cause upregulation of MHC class II molecules. Microinjection of antibodies raised against the murine NLS containing peptide resulted in loss of STAT1{alpha} nuclear translocation in cells treated extracellularly with IFN{gamma} (Subramaniam et al., 1999Go). Replacement of the NLS in the C-terminus of IFN{gamma} with the NLS from SV40 T antigen resulted in restoration of biological activity of IFN{gamma} (Subramaniam et al., 2001aGo). This suggests a requirement for an interaction between the NLS-containing region of IFN{gamma} and IFNGR1, which is supported by the observations that IFNGR1–/– cells do not respond to murine intracellular IFN{gamma} (Will et al., 1996Go) or an agonist peptide (Thiam et al., 1998Go). An additional aspect of IFN{gamma} and IFN{gamma} receptor interaction is the nuclear translocation of IFNGR1, but not IFNGR2, in cells treated with IFN{gamma} (Larkin et al., 2000Go). Nuclear translocation of a receptor subunit has been reported for a number of cytokines and growth factors (reviewed in Subramaniam et al., 2001bGo; Jans and Hassan, 1998Go). Demonstration of a transcription-factor-like activity in the EGF receptor subunit after nuclear uptake (Lin et al., 2001Go) suggests an important role for this translocation, since its association with STATs may allow the use of promoters specific to the ligand and/or receptor.

The NLS of human IFN{gamma} was identified by the digitonin-permeabilizion assay, which results in selective permeabilization of the plasma membrane of the cell (Subramaniam et al., 1999Go). Nuclear import of IFN{gamma} was monitored via its coupling to the fluorescent protein allophycocyanin in the presence of reticulocyte lysate and ATP/GTP. Consistent with the above, we have recently shown that extracellularly added 125I-IFN{gamma} undergoes nuclear translocation (Subramaniam and Johnson, 2002Go). We have recently used the digitonin assay to test STAT1{alpha} for intrinsic NLS activity (P. S. Subramaniam and H. M. Johnson, unpublished). Fluorescently labeled STAT1{alpha} and IFNGR1 were tyrosine phosphorylated in vitro by recombinant Jak2. The phosphorylated STAT1{alpha} bound to its DNA response element, as shown by the electrophoretic mobility shift assay. Activated STAT1{alpha} failed to undergo nuclear translocation. However, in association with IFNGR1, it did undergo nuclear translocation in the presence of human IFN{gamma}, as the IFN{gamma} C-terminal peptide contains an NLS. The results are consistent with our demonstration here of the requirement of intracellular IFN{gamma} with intact NLS for STAT1{alpha} activation and nuclear translocation in association with IFNGR1.

Nuclear translocation of STAT1{alpha} is carried out by the nuclear importer NPI-1 in a ran/importin-dependent pathway (Sekimoto et al., 1996Go). Mutational analysis of STAT1 did not reveal a clear nuclear localization sequence in this molecule (Sekimoto et al., 1997Go). Several recent studies have reported the nuclear translocation of STAT1{alpha} under conditions of overexpression of STAT1{alpha} fusion proteins in cells (Melen et al., 2001Go; McBride et al., 2002Go). Through the use of mutations it has been concluded that STAT1{alpha} contains a novel NLS that differs from the classical NLS such as that of SV40 T antigen and IFN{gamma} (Melen et al., 2001Go; McBride et al., 2002Go). None of these studies tested STAT1{alpha} nuclear translocation via the digitonin assay, so it is not possible to directly compare our negative results above with STAT1{alpha} with those produced using overexpression.

That the phosphorylation of STAT1 in itself is not sufficient for its translocation into the nucleus has also been shown for angiotensin II receptor (Sayeski et al., 2001Go) and, more recently, with the use of a chimeric receptor, which had an extracellular domain of PDGF and an intracellular domain of gp130, the signaling subunit of Oncostatin M receptor. Addition of PDGF to cells expressing this chimeric receptor produced phosphorylated STAT1{alpha}, but no genes responsive to IFN{gamma} were activated (Mahboubi and Pober, 2002Go). The following arguments suggest the requirement of additional factor(s) for the migration of STATs into the nucleus. The same STATs are utilized by different cytokines but give rise to different physiological responses (reviewed in Subramaniam et al., 2001bGo). IFN{gamma} has a molecular mass that should allow its entry into the nucleus by simple diffusion, yet this molecule has a strong NLS. Association of IFN{gamma}, IFNGR1 and STAT1{alpha} together with the nuclear importer NPI-1 strongly suggests that STAT1{alpha} may require a chaperoning function, which is provided by the ligand and its receptor subunit. In conclusion, nuclear translocation of STAT1{alpha} may not be unassisted, as the previous models have suggested. Association of IFN{gamma} (containing a strong NLS), IFNGR1 and STAT1{alpha} with the nuclear importer, NPI-1, suggests a chaperoning role for IFN{gamma} and IFNGR1 in nuclear translocation of STAT1{alpha} and may have a role in imparting specificity to STAT1{alpha} activity.


    Acknowledgments
 
We gratefully acknowledge Melissa Chen at the Flow Cytometry Core Facility, University of Florida, for assistance with flow cytometry. This work was supported by NIH grant CA38587 to H.M.J. This manuscript is Florida Experimental Station Journal Series no. R-09524.


    References
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

Ahmed, C. M. I., Wills, K. N., Sugarman, B. J., Johnson, D. E., Ramachandra, M., Nagabhushan, T. L. and Howe, J. A. (2001). Selective expression of nonsecreted interferon by adenoviral vector confers antiproliferative and and antiviral properties and causes reduction of tumor growth in nude mice. J. Interferon Cytokine Res. 21,399 -408.[CrossRef][Medline]

Bejcek, B. E., Li, D. Y. and Deuel, T. F. (1989). Transformation by v-sis occurs by an internal autoactivation mechanism. Science 245,1496 -1499.[Abstract/Free Full Text]

Dunbar, C. E., Browder, T. M., Abrams, J. S. and Nienhuis, A. W. (1989). COOH-terminal modified interleukin-3 is retained intracellularly and stimulates autocrine growth. Science 245,1493 -1496.[Abstract/Free Full Text]

Familetti, P. C., Rubinstein, S. and Pestka, S. (1981). A conventional and rapid cytopathic effect inhibition assay for interferon. Methods Enzymol. 78,387 -394.[Medline]

Farrar, M. A., Fernandez-Luna, J. and Schreiber, R. D. (1991). Identification of two regions within the cytoplasmic domain of the human interferon-gamma receptor required for function. J. Biol. Chem. 266,19626 -19635.[Abstract/Free Full Text]

Jans, D. A. and Hassan, G. (1998). Nuclear targeting by growth factors, cytokines and their receptors: a role in signaling? BioEssays 20,400 -411.[CrossRef][Medline]

Killion, J. J., Fishbeck, R., Bar-Eli, M. and Chernajovsky, Y. (1994). Delivery of interferon to intracellular pathways by encapsulation of interferon into multilamellar liposomes is independent of the status if interferon receptors. Cytokine 6, 443-449.[CrossRef][Medline]

Larkin, J., Johnson, H. M. and Subramaniam, P. S. (2000). Differential nuclear localization of IFNGR1 and IFNGR2 subunits of the IFN-gamma receptor complex following activation by IFN-gamma. J. Interferon Cytokine Res. 20,565 -576.[CrossRef][Medline]

Lin, S. Y., Makino, K., Xia, W., Matin, A., Wen, Y., Kwong, K.Y., Bourguignon, L. and Hung, M. C. (2001). Nuclear localization of EGF receptor and its potential new role as a transcription factor. Nat. Cell Biol. 3, 802-808.[CrossRef][Medline]

Mahboubi, K. and Pober, J. S. (2002). Activation of signal transducer and activator of transcription 1 (STAT1) is not sufficient for the induction of STAT1-dependent genes in endothelial cells. Comparison of interferon-gamma and oncostatin M. J. Biol. Chem. 277,801 -821.

McBride, K. M., Banninger, G., McDonald, C. and Reich, N. C. (2002). Regulated nuclear import of the STAT1 transcription factor by direct binding of importin-alpha. EMBO J. 21,1754 -1763.[CrossRef][Medline]

Melen, K., Kinnunen, L. and Julkunen, I. (2001). Arginine/lysine-rich structural element is involved in interferon-induced nuclear import of STATs. J. Biol. Chem. 276,16447 -16455.[Abstract/Free Full Text]

Pestka, S., Kotenko, S. V., Muthukumaran, G., Izotova, L. S., Cook, J. R. and Garotta, G. (1997). The interferon gamma (IFN-gamma) receptor: a paradigm for the multichain cytokine receptor. Cytokine Growth Factor Rev. 3, 189-206.

Rutherford, M. N., Kumar, A., Coulombe, B., Skup, D., Carver, D. H. and Williams, B. R. (1996). Expression of intracellular interferon constitutively activates ISGF3 and confers resistance to EMC viral infection. J. Interferon Cytokine Res. 16,507 -510.[Medline]

Sanceau, J., Sondermeyer, P., Beranger, F., Falcoff, R. and Vaquero, C. (1987). Intracellular human gamma-interferon triggers an antiviral state in transformed murine L cells. Proc. Natl. Acad. Sci. USA 84,2906 -2910.[Abstract/Free Full Text]

Sayeski, P. P., Ali, M. S., Frank, S. J. and Bernstein, K. E. (2001). The angiotensin II-dependent nuclear translocation of STAT1 is mediated by the Jak2 protein motif 231 YRFRR. J. Biol. Chem. 276,10556 -10563.[Abstract/Free Full Text]

Sekimoto, T., Nakajima, K., Tachibana, T., Hirano, T. and Yoneda, Y. (1996). Interferon-gamma-dependent nuclear import of STAT1 is mediated by the GTPase activity of Ran/TC4. J. Biol. Chem. 271,31017 -31020.[Abstract/Free Full Text]

Sekimoto, T., Imamoto, N., Nakajima, K. Hirano, T. and Yoneda, Y. (1997). Extracellular signal-dependent nuclear import of STAT1 is mediated by nuclear pore-targeting complex formation with NPI-1, but not Rch1. EMBO J. 16,7067 -7077.[CrossRef][Medline]

Smith, M. R., Muegge, K., Keller, J. R., Kung, H. F., Young, H. A. and Durum, S. K. (1990). Direct evidence of an intracellular role for IFN-gamma. Microinjection of human IFN-gamma induces Ia expression on murine macrophages. J. Immunol. 144,1777 -1782.[Abstract]

Stark, G. R., Kerr, I. M., Williams, B. R., Silverman, R. H. and Schreiber, R. D. (1998). How cells respond to interferons. Annu. Rev. Biochem. 67,227 -264.[CrossRef][Medline]

Subramaniam, P. S. and Johnson, H. M. (2002). Lipid microdomains are required sites for the selective endocytosis and nuclear translocation of IFN{gamma}, its receptor chain IFN{gamma} receptor-1, and the phosphorylation and nuclear translocation of STAT1{alpha}. J. Immunol. 169,1959 -1969.[Abstract/Free Full Text]

Subramaniam, P. S., Mujtaba, M. G., Paddy, M. R. and Johnson, H. M. (1999). The carboxyl terminal of interferon-gamma contains a functional polybasic nuclear localization sequence. J. Biol. Chem. 274,403 -407.[Abstract/Free Full Text]

Subramaniam, P. S., Larkin, J., Mujtaba, M. G., Walter, M. R. and Johnson, H. M. (2000). The COOH-terminal nuclear localization sequence of interferon gamma regulates STAT1 alpha nuclear translocation at an intracellular site. J. Cell Sci. 113,2771 -2781.[Abstract]

Subramaniam, P. S., Green, M. M., Larkin, J., Torres, B. A. and Johnson, H. M. (2001a). Nuclear translocation of IFN-gamma is an intrinsic requirement for its biologic activity and can be driven by a heterologous nuclear localization sequence. J. Interferon Cytokine Res. 21,951 -959.[CrossRef][Medline]

Subramaniam, P. S., Torres, B. A. and Johnson, H. M. (2001b). So many ligands, so few transcription factors: a new paradigm for signaling through the STAT transcription factors. Cytokine 15,175 -187.[CrossRef][Medline]

Szente, B. E. and Johnson, H. M. (1994). Binding of IFN gamma and its C-terminal peptide to a cytoplasmic domain of its receptor that is essential for its function. Biochem. Biophys. Res. Commun. 201,215 -221.[CrossRef][Medline]

Szente, B. E., Soos, J. M. and Johnson, H. M. (1994). The C-terminus of IFN gamma is sufficient for its intracellular function. Biochem. Biophys. Res. Commun. 203,1645 -1654.[CrossRef][Medline]

Szente, B., Subramaniam, P. S. and Johnson, H. M. (1995). Identification of IFN-gamma receptor binding sites for JAK2 and enhancement of binding by IFN-gamma and its C-terminal peptide IFN-gamma (95-133). J. Immunol. 155,5617 -5622.[Abstract]

Thiam, K., Loing, E., Delanoye, A., Diesis, E., Gras-Masse, H., Auriault, C. and Verwaerde, C. (1998). Unrestricted agonist activity on murine and human cells of a lipopeptide derived from IFN-gamma. Biochem. Biophys. Res. Commun. 253,639 -647.[CrossRef][Medline]

Will, A., Hemmann, U., Horn, F., Rollinghoff, M. and Gessner, A. (1996). Intracellular murine IFN-gamma mediates virus resistance, expression of oligoadenylate synthetase, and activation of STAT transcription factors. J. Immunol. 157,4576 -4583.[Abstract]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?

Related articles in JCS:

Interferon goes nuclear

JCS 2003 116: 1503. [Full Text]  



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
E. Beurel and R. S. Jope
Differential Regulation of STAT Family Members by Glycogen Synthase Kinase-3
J. Biol. Chem., August 8, 2008; 283(32): 21934 - 21944.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Wang, J. W. Holland, A. Carrington, J. Zou, and C. J. Secombes
Molecular and Functional Characterization of IL-15 in Rainbow Trout Oncorhynchus mykiss: A Potent Inducer of IFN-{gamma} Expression in Spleen Leukocytes
J. Immunol., August 1, 2007; 179(3): 1475 - 1488.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. M. Ahmed, J. P. Martin, and H. M. Johnson
IFN Mimetic as a Therapeutic for Lethal Vaccinia Virus Infection: Possible Effects on Innate and Adaptive Immune Responses
J. Immunol., April 1, 2007; 178(7): 4576 - 4583.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
M. G. Mujtaba, C. B. Patel, R. A. Patel, L. O. Flowers, M. A. Burkhart, L. W. Waiboci, J. Martin, M. I. Haider, C. M. Ahmed, and H. M. Johnson
The Gamma Interferon (IFN-{gamma}) Mimetic Peptide IFN-{gamma}(95-133) Prevents Encephalomyocarditis Virus Infection both in Tissue Culture and in Mice.
Clin. Vaccine Immunol., August 1, 2006; 13(8): 944 - 952.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. M. I. Ahmed and H. M. Johnson
IFN-{gamma} and Its Receptor Subunit IFNGR1 Are Recruited to the IFN-{gamma}-Activated Sequence Element at the Promoter Site of IFN-{gamma}-Activated Genes: Evidence of Transactivational Activity in IFNGR1
J. Immunol., July 1, 2006; 177(1): 315 - 321.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. M. I. Ahmed, M. A. Burkhart, P. S. Subramaniam, M. G. Mujtaba, and H. M. Johnson
Peptide Mimetics of Gamma Interferon Possess Antiviral Properties against Vaccinia Virus and Other Viruses in the Presence of Poxvirus B8R Protein
J. Virol., May 1, 2005; 79(9): 5632 - 5639.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jcs.00528v1
116/15/3089    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in JCS
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ahmed, C. M. I.
Right arrow Articles by Johnson, H. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ahmed, C. M. I.
Right arrow Articles by Johnson, H. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?