|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 26 June 2003
doi: 10.1242/jcs.00519
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
1 Department of Chemistry, University of Western Ontario, London, N6A1B7,
Canada
2 School of Dentistry, Faculty of Medicine and Dentistry, University of Western
Ontario, London, N6A1B7, Canada
3 Department of Physiological Chemistry, University of Würzburg, 97074
Würzburg, Germany
* Author for correspondence (e-mail: petersen{at}uwo.ca)
Accepted 28 March 2003
| Summary |
|---|
|
|
|---|
Key words: Image correlation spectroscopy, Fluorescence, BMP receptors, Receptor clusters, Smad pathway
| Introduction |
|---|
|
|
|---|
BMP receptors are expressed on the cell surface either as hetero-oligomeric
preformed complexes (PFCs) or as homo-oligomeric complexes, which upon BMP-2
stimulation form hetero-oligomeric BMP-induced signalling complexes (BISCs)
(Gilboa et al., 2000
;
Nohe et al., 2002
). Binding of
BMP-2 to PFCs activates the Smad signalling pathway, whereas BMP-2 induced
recruitment of receptors into BISCs activates a different Smad-independent
pathway resulting in the induction of alkaline phosphatase activity via p38
MAP kinase. These observations imply that the specific structural organisation
of the BMP receptors prior to BMP-2 binding is a key prerequisite for
activation of distinct signalling pathways at the cell surface. In order to
understand the details of this process we need to study the quantitative
distribution of the BMP receptors and the changes in their distribution
following BMP-2 stimulation. Image correlation spectroscopy (ICS) provides a
convenient and quantitative tool to measure the density of receptor clusters
on cell surfaces (Brown and Petersen
1998
; Brown et al.,
1999
; Srivastava and Petersen
1998
; Wiseman and Petersen
1999
; Wiseman et al.,
1997
).
To investigate BMP receptor clustering, COS7 cells were transfected with plasmids encoding various combinations of BMP receptors. After fixation we labelled the BMP receptors using fluorescent antibodies and collected high magnification images of the distribution of the BMP receptors on the cell membrane. Applying ICS we calculated the average number of receptor clusters per unit area (cluster density, CD). Our data indicate that the co-expression of the BMP-type-II receptor (BRII) disperses aggregates of the BMP-type-I receptor a (BRIa). Stimulation with BMP-2 leads again to a rearrangement of the receptors on the cell surface. Using the method described above we also observed a similar redistribution of the endogenous receptors in A431 cells. Upon serum starvation of these cells, BRII is upregulated and BRIa clusters are rearranged. To investigate whether the activation status of BRIa affects the clustering, we transfected COS7 cells with a constitutively active mutant BRIa-ca. We observed that BRIa-ca clusters are rearranged by BRII in the same manner as BRIa in the presence of BRII and BMP-2 stimulation. Importantly co-transfection of a kinase-inactive BRII (BRII-KR) with BRIa or BRIa-ca did not result in a change in BRIa distribution. We further performed reporter gene assays in A431 cells or primary limb mesenchymal cells either using a Col2-luc reporter construct or using pSBE, a construct specific for the activation of the Smad pathway. Co-transfection of BRIa-ca and BRII in these cells leads to an increase in luciferase activity, compared with cells transfected with BRIa-ca only. Further co-transfection of BRIa-ca and BRII-KR did not lead to an increase in luciferase activity. Our data suggest that the rearrangement of the BRIa by BRII on the cell surface is dependent on the kinase activity of BRII and important for the activation of the signalling pathways.
| Materials and Methods |
|---|
|
|
|---|
RNA isolation and cDNA preparation
RNA was prepared from 1x107 epidermal carcinoma A431 cells
using the Qiagen (Mississauga, Canada) RNeasy MidiKit. Reverse transcription
was performed using 1.5 µg total RNA and Superscript II RNase-H reverse
transcriptase (GibcoBRL, Burlington, Canada) according to the manufacturer's
protocol. Random hexamers were purchased from Boehringer (Mannheim, Germany)
and dNTPs from Pharmacia (Mississauga, Canada). The following cDNA
amplification reactions were done by PCR using PFU-Polymerase (Stratagene,
LaJolla, CA) and specific oligonucleotides for BRIa: BRIa-9
5'CAGAATCTGGATAGTATGC3' and BRIa-15
5'TGAGTCCAGGAACCTGTACCTTTA3' and specific oligonucleotides for
BRII: BRII-15 5'ACATAATAGGCGTGTGCCA3' and BRII-25
5'CTTGATCTTTTCACCTG3'. The PCR products were separated on an
agarose gel and visualised by UV.
Transfection of COS7 and A431 cells
COS7 and A431 cells were grown in Dulbecco's modified Eagle's medium
supplemented with 10% FBS (Gibco BRL, Burlington, Canada) and transfected by
the DEAE-dextran method (Aruffo and Seed,
1987
) using 5 µg of DNA/plasmid. In case of the reporter gene 1
µg of the pSBE or Col2-luc was used.
Immunofluorescence labelling of cell surface receptors
To measure the distribution of the BMP receptors on the cell surface, we
employed confocal fluorescence imaging measurements. Co-transfected COS7 cells
as well as normal or serum starved A431 cells were grown on 22 mm cover slips.
A full 48 hours after transfecting COS7 cells or 72 hours after
serum-starvation of A431 cells, cells were stimulated or mock stimulated with
BMP-2 for 2.5 hours and fixed using acetone/methanol fixation
(Brown et al., 1999
). After
blocking for 30 minutes with 5% BSA, cells were incubated with biotin or FITC
conjugated monoclonal mouse antibodies against the epitope tags of the
receptors or with polyclonal goat antisera recognising either BRII or BRIa
according to the manufacturer's protocol. Cells were washed three times with
PBS for 5 minutes. Afterwards, cells were incubated with the corresponding
secondary monoclonal mouse anti-biotin or donkey anti-goat antibody at a
concentration of 3.2 µg/ml anti-biotin antibody or 20 µg/ml in the case
of donkey anti-goat IgG. Cells were washed again three times for 5 minutes
with PBS and the cover slips were mounted in airvol and dried overnight. When
monoclonal mouse antibodies against the epitope tags were used, cells were
incubated with goat IgG (200 µg/ml) for 30 minutes prior to addition of the
primary antibody. The specificity of the polyclonal antisera was tested by
transfecting COS7 cells with HA-BRI and HA-BRII. Cells were then fluorescently
labelled using the HA-FITC antibody or the polyclonal antisera followed by a
secondary donkey anti-goat antibody. The collected images showed a 100%
co-localisation with the receptors as well as background fluorescence both on
and off the cells.
Preparation of cultures from limb mesenchyme
Cultures were prepared from murine fore and hind limb buds of E11.5 embryos
as previously described (Weston et al.,
2000
) with the following modifications. After dispase digestion,
cells were filtered through a Cell Strainer (40 µm; Falcon) to obtain a
single cell suspension. Culture media (40% Dulbecco's modified Eagle's medium
and 60% F12 supplemented with fetal bovine serum to 10%; Gibco BRL) was
changed daily.
Luciferase reporter assay
Limb mesenchymal cells (isolated from E11.5 mouse embryos) were transfected
with pSBE (Jonk et al., 1998
)
or a Col2-luc reporter expression vector containing either of the two
receptors and pRLSV40 (for normalisation of transfection efficiency) using
Fugene6 (Boehringer) as previously described
(Weston et al., 2002
). Cells
were plated at high density in the wells of a 24-well tissue culture dish, 48
hours after transfection the cells were lysed and luciferase activity was
measured using a dual luciferase assay system (Promega, Madison, WI).
A431 cells, grown in 60 mm dishes, were transfected with the pSBE and the BMP receptor constructs using the DEAE dextran method and stimulated or mock stimulated with BMP-2. After transfection, cells were stimulated or not stimulated for 12 hours with 20 nM BMP-2. then the cells were lysed and luciferase activity was measured using a dual luciferase assay system (Promega).
Confocal microscopy
Labelled cells were visualised using a Biorad MRC 600 confocal microscope
equipped with an Ar/Kr mixed gas laser and using the appropriate filter sets
for dual fluorophore imaging. Cells expressing the receptors were selected
under mercury lamp illumination using a 60x (1.4 NA) objective and an
inverted Nikon microscope. An area on the cell, removed from the nucleus, was
enlarged and visualised. For measuring FITC fluorescence the filter wheel was
set for 488 nm laser excitation, and neutral density filters were used to
attenuate the laser to 1% laser power. Fifteen scans were accumulated on
photomultiplier tube 2 (PMT2) in photon counting mode (to ensure linear
scaling of the intensity). For measuring RRX fluorescence the filter wheel was
then shifted to allow excitation with the 568 nm laser line, and 20 scans were
accumulated on PMT1. The two photomultiplier tubes were set with the black
level at 6.0 on the vernier scale, and the gain set at 10. After collection of
each set of 20 images, images were collected using identical settings but with
the shutter to the sample closed to obtain a measure of the dark current for
each PMT.
Image correlation spectroscopy
Image correlation spectroscopy (ICS) is the technique used to study the
distribution and localisation of the BMP receptors. ICS involves
autocorrelation analysis of the intensity fluctuations within confocal images
collected in this case from transfected cells that contain immunoflourescent
labelled proteins (Petersen,
2001
).
Let the fluorescent intensity in a pixel located at position x, y in the
image be i(x,y), then the corresponding normalised fluorescence intensity
fluctuation,
i(x,y), is given by:
![]() |
The normalised spatial autocorrelation function, g(
,
), is then
given by:
![]() |
and
are position lag coordinates for the x and y axis. It is
known that the limit of the autocorrelation function as
and
approach zero, g(0,0), is equal to the variance of the normalised intensity
fluctuations (Berne et al., 1976).
It is also known that for homogenous, non-interacting species, where the
intensity is a true representation of the concentration, the variance of the
normalised intensity fluctuations is equal to the variance of the
concentration fluctuations, which in turn is equal to the inverse of the
number of particles in the
![]() |
![]() |
The average CD values were normalised to the average CD value for transfected cells solely with HA-BRIa or myc-BRII. In case of the A431 cells the average CD values were normalised to BRIa in normal A431 cells and BRII in serum starved A431 cells. Standard error of the mean (s.e.m.) values were calculated from the raw data at the 95% confidence level.
| Results |
|---|
|
|
|---|
|
It should be noted that the average CD values are independent of the transfection level of the receptors since there is no correlation between the average intensity of the labelled receptors and the CD (data not shown). Thus the total density of receptors does not affect the average number of receptor clusters but rather the average number of receptors per cluster. The expression level of BRII can affect the distribution and therefore the CD of BRIa, as can be seen in the range of four to six fold increase of BRIa by co-transfection of myc- or HA-tagged BRII.
Redistribution of BRIa and BRII by stimulation with BMP-2 in COS7
cells
Fig. 1E,G shows that BMP-2
stimulation of cells co-transfected with both receptors decreases the average
CD value by a factor of two, suggesting that BMP-2 directly affects the
clustering of both myc-BRII and HA-BRIa on the cell surface. Stimulation for
2.5 hours with 20 nM BMP-2 causes both HA-BRIa and myc-BRII to redistribute
into fewer but larger aggregates, since the average receptor density as
estimated from the intensity is the same (data not shown).
BRIa-ca shows the same CD as BRIa in COS7 cells
Fig. 1E also shows that the
average CD of a constitutive active form of BRIa, BRIa-ca, is comparable to
the native form. Interestingly co-transfection with BRII yields average CD
values for BRIa-ca and BRII comparable to the average CD values obtained in
co-transfected cells with BRIa and BRII after stimulation with BMP-2. The
implication is that the state of aggregation of BRIa-BRII complexes depends on
the phosphorylation state of BRIa, with the non-phosphorylated state being in
fewer but larger clusters.
The redistribution of BRIa by BRII is dependent on the kinase
activity of BRII
Fig. 1E,F indicates that
co-transfection of kinase-inactive BRII-KR does not lead to a redistribution
of BRIa or BRIa-ca. This indicates that the kinase activity of BRII is
important for the reorganisation of BRIa on the cell surface. Also the
co-transfection of another serine threonine type-II receptor, TGFßR-II,
which is involved in TGF-ß signalling, shows no effect on the CD of BRIa
(Fig. 1F). This suggests that
the dispersion of BRIa by BRII is regulated through the kinase activity of
BRII and that it is specific for BRII.
Effect of BRII expression on the activation of downstream signalling
pathways in limb mesenchymal cells
Limb mesenchymal cells were transfected with plasmids encoding HA-BRIa-ca
and myc-BRII together with a Col2-luc reporter and pRLSV40. The Col2-luc
reporter is derived from the promotor and enhancer region of the type 2
collagen gene, and provides a readout for the status of chondroblast
differentiation (Lefebvre et al.,
1997
; Weston et al.,
2002
). Fig. 2 shows
that luciferase activity is increased by about a factor of two when BRIa-ca is
induced in the system, irrespective of whether BRII is present or not.
Myc-BRII causes some increase in the luciferase activity but co-transfection
of myc-BRII and HA-BRIa-ca clearly leads to a strong increase in luciferase
activity. Importantly, co-transfection of the kinase-inactive BRII-KR and
BRIa-ca does not lead to an increase in luciferase activity beyond that
observed for BRIa alone.
|
To investigate the effect of myc-BRII expression on the activation of the
Smad signalling pathway, we co-transfected the limb mesenchymal cells with
plasmids encoding HA-BRIa-ca, myc-BRII, BRII-KR and the pSBE-luc reporter. The
pSBE-luc provides a readout specific for the activation of the Smad signalling
pathway (Jonk et al., 1998
;
Nohe et al., 2002
). As shown
in Fig. 3, HA-BRIa-ca alone
fails to activate the pSBE-luc. Only co-transfection of BRIa-ca with myc-BRII
leads to an increase in pSBE-luc reporter activity, suggesting that BRII is
needed with BRIa-ca to activate the Smad signalling pathway. Co-transfection
of BRII-KR and BRIa-ca fails to increase the luciferase activity suggesting
again that the kinase activity of BRII is needed for activation of BMP
receptor signalling beyond its activation of BRIa via the Smad signalling
pathway.
|
BRII mRNA is upregulated upon serum starvation of A431 cells
The distribution and aggregation studies described so far were performed by
transfecting COS7 cells. We wanted to compare the results obtained from cells
overexpressing the receptors of interest with a cell line that endogeneously
expresses these receptors. A431 cells were used as a model system to study the
redistribution of the BMP receptors on the cell surface in untransfected
cells. Normal A431 cells are known to overexpress the EGF receptor. Using
RT-PCR and primers specific for BRIa and BRII, we examined the BMP receptor
expression in this cell line. As shown in
Fig. 4A, serum starvation of
A431 cells for 72 hours leads to upregulation of BRII mRNA. We also labelled
serum starved and normal A431 cells using a polyclonal antiserum against BRII
and a fluorescently labelled secondary antibody. Serum starvation of A431
cells for 72 hours leads to increased BRII expression on the cell surface
(Fig. 4B,C). BRIa is expressed
in A431 cells cultured in 10% FBS and in A431 cells serum starved for 72 hours
as shown by RT-PCR (Fig. 4A)
and appears on the cells surface as seen by immunofluorescence using a
polyclonal antiserum against BRIa and a secondary fluorescent antibody
(Fig. 4D,E). Clearly, serum
starvation of A431 cells provides a means of studying the effect of BRII
upregulation and expression on the distribution of BRIa without the need of
transfections.
|
Effect of BRII expression on the activation of the Smad signalling
pathway in A431 cells
Normal A431 cells were transfected with the pSBE-Luc, pRLSV40 and various
combinations of BRIa, BRII and BRIa-ca. As shown in
Fig. 5, neither the
transfection of BRIa-ca nor BRIa and BRII affected reporter gene activity.
Only co-transfection of BRIa-ca with BRII or co-transfection of BRIa and BRII
with addition of BMP-2 leads to activation of the reporter. These results are
comparable to those seen for primary mesenchymal cells
(Fig. 3). Clearly an activated
assembly of BRIa and BRII is required to activate the Smad signalling pathway
in either system.
|
Redistribution of BRIa by BRII in A431 cells
A431 cells were cultured for 72 hours in DMEM containing 10% FBS or in DMEM
containing no FBS. The cells were either stimulated or not stimulated with
BMP-2, fixed and the endogenous receptors BRIa and BRII were fluorescently
labelled using appropriate polyclonal antisera and a secondary fluorescently
labelled antibody. Confocal images were collected and ICS analysis applied.
Because the polyclonal antisera showed some background fluorescence,
corresponding images from the glass coverslip were collected and were used to
correct the calculation of the CD of BRIa and BRII for the cells (Wiseman et
al., 1999). The average CD values were then normalised to the average CD value
for normal A431 cells for BRIa and serum starved A431 cells for BRII. As
indicated in Fig. 6A,
upregulation of BRII by starvation of A431 cells leads to a two fold higher CD
value of BRIa, even though the expression level of BRIa in normal and serum
starved cells is unchanged [the average intensity (I) stays the same]. This
indicates that BRIa clusters are dispersed, because of upregulation of BRII
expression, into twice as many clusters with half the number of receptors in
each.
|
Redistribution of BRIa and BRII upon BMP-2 stimulation in A431
cells
To investigate whether BMP-2 stimulation affects the distribution of BRIa
and BRII in cells expressing the BMP receptors, we grew A431 cells for 72
hours in DMEM without FBS and stimulated them with 20 nM BMP-2 for 2.5 hours
or left them untreated. Stimulation with BMP-2 leads to a two fold decrease in
the CD value of BRIa (Fig. 6A)
and a three fold decrease in the CD value of BRII
(Fig. 6B), suggesting an
aggregation of both BRIa and BRII. As Fig.
6 shows, the total expression level of neither BRIa nor BRII
changes significantly by stimulation with BMP-2, since the average intensity
(I) of the collected images is nearly constant.
| Discussion |
|---|
|
|
|---|
The aggregation of BRII is not influenced by BRIa. It is only influenced by
the stimulation of cells with BMP-2, which also leads of a change in the
distribution pattern of BRIa. As described previously the BMP-2 ligand has two
options to initiate signalling: the first needs the formation of PFCs, and the
second is mediated by the binding of the BMP-2 to the high affinity binding
BRIa receptor, then recruitment of BRII into the ligand-mediated signalling
complex (BISC) (Gilboa et al.,
2000
; Nohe et al.,
2002
). The ICS studies performed here indicate a very dynamic
receptor-ligand relationship. They also suggest that the receptors are
rearranged on the cell surface into different domains and that this
reshuffling is necessary for signalling. The data also indicate that the
redistribution of the receptors is not solely due to the formation of PFCs or
BISCs.
The reporter gene assay in A431 cells and in primary mesenchymal limb
cells, suggests that the activity of BRIa-ca, which is able to stimulate
chondrogenesis on its own as indicated by its ability to increase Col2-luc
reporter activity, can be increased by co-expression with BRII. In contrast
BRII-KR co-transfected with BRIa-ca fails to increase the luciferase activity.
Here we show that the role of BRII in BMP signalling is not only to
phosphorylate and activate BRIa, but also to enhance BMP signalling, as
demonstrated in primary cells. The kinase activity of BRII is needed for this
reshuffling and is crucial for signalling despite the phosphorylation of BRIa.
The pSBE-Luc is activated by Smads (Jonk
et al., 1998
; Nohe et al.,
2002
). Here we give evidence that PFCs, which may be formed as a
result of the recruitment of BRIa by BRII into special regions at the cell
surface, are necessary for activation. But our data further suggest that the
kinase activity of BRII is still needed for the reshuffling and is one
critical step in activating the BMP-Smad pathway. A431 cells overexpress the
EGFR, which leads to continuous activation of the EGFR pathway. It is known
that activation of ERK by the EGFR pathway can lead to a phosphorylation of
Smad1 at the linker region, resulting in the inhibition of the BMP signalling
pathway (Kretschmar et al., 1997). Because of this negative feedback
mechanism, the BMP signalling in these cells still needs careful
exploration.
In conclusion we show that the BMP receptor distribution on the cell surface is very flexible and dynamic during activation of signalling pathways. We provide strong evidence to support an additional role of BRII in recruiting BRIa into special regions of the cell surface. We further showed that the kinase activity of BRII is required for this reshuffling of BRIa. We demonstrate that ICS is a powerful tool to determine the CD value of receptors at the cell surface and is sensitive to subtle changes in the receptor distribution patterns.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Aruffo, A. and Seed, B. (1987). Molecular cloning of two CD7 (T-cell leukemia antigen) cDNAs by a COS cell expression system. EMBO J. 6,3313 -3316.[Medline]
Attisano, L. and Wrana, J. L. (2000). Smads as transcriptional co-modulators. Curr. Opin. Cell Biol. 12,235 -243.[CrossRef][Medline]
Berne, B. J. and Pecora, R. (1976). Dynamic Light Scattering with Applications to Chemistry, Biology and Physics. Wiley, New York.
Bhatia, M., Bonnet, D., Wu, D., Murdoch, B., Wrana, J.,
Gallacher, L. and Dick, J. E. (1999). Bone
morphogenetic proteins regulate the developmental program of human
hematopoietic stem cells. J. Exp. Med.
189,1139
-1148.
Brown, C. M. and Petersen, N. O. (1998). An image correlation analysis of the distribution of clathrin associated adaptor protein (AP-2) at the plasma membrane. J. Cell Sci. 111,271 -281.[Abstract]
Brown, C. M., Roth, M. G., Henis, Y. I. and Petersen, N. O. (1999). An internalization-competent influenza hemagglutinin mutant causes the redistribution of AP-2 to existing coated pits and is colocalized with AP-2 inclathrin free clusters.Biochemistry 38,15166 -15173.[CrossRef][Medline]
Celeste, A. J., Iannazzi, J. A., Taylor, R. C., Hewick, R. M.,
Rosen, V., Wang, E. A. and Wozney, J. M. (1990).
Identification of transforming growth factors present in bone.
Proc. Natl. Acad. Sci. USA.
87,9843
-9847.
Cunningham, N. S., Jenkins, N. A., Gilbert, D. J., Copeland, N. G., Reddi, A. H. and Lee, S. J. (1995). Growth differentiation factor 10: A new member of transforming growth factor-ß superfamily related to bone morphogenetic protein-3. Growth Factors 12,99 -109.[Medline]
Dunn, N. R., Winnier, G. E., Hargett, L. K., Schrick, J. J., Fogo, A. B. and Hogan, B. L. (1997). Haploinsufficient phenotypes in Bmp4 heterozygous null mice and modification by mutations in Gli3 and Alx4. Dev. Biol. 188,235 -247.[CrossRef][Medline]
Evan, G. L., Lewis, G. K., Ramsey, G. and Bishop, J. M.
(1985). Isolation of monoclonal antibodies specific for human
c-myc proto-oncogene product. Mol. Cell. Biol.
5,3610
-3616.
Gilboa, L., Nohe, A., Geissendorfer, T., Sebald, W., Henis, Y. I. and Knaus, P. (2000). Bone morphogenetic protein receptor complexes on the surface of live cells: a new oligomerization mode for serine/threonine kinase receptors. Mol. Biol. Cell 3,1023 -1035.
Hoodless, P. A., Haerry, T., Abdollah, S., Stapleton, M., O'Connor, M. B., Attisano, L. and Wrana, J. L. (1996). MADR1, a MAD-related protein that functions in BMP2 signaling pathways. Cell 85,489 -500.[CrossRef][Medline]
Hogan B. L. (1996). Bone morphogenetic
proteins: multifunctional regulators of vertebrate development.
Genes Dev. 10,1580
-1594.
Jonk, L. J. C., Itoh, S., Heldin, C.-H., ten Dijke, P. and
Kruijer, W. (1998). Identification and functional
characterization of a Smad binding element (SBE) in the JunB promoter that
acts as a transforming growth factor-ß, activin, and bone morphogenetic
protein-inducible enhancer. J. Biol. Chem.
273,21145
21152.
Kawabata, M., Chytil, A. and Moses, H. L.
(1995). Cloning of a novel type II serine/threonine kinase
receptor through interaction with the type I transforming growth factor-beta
receptor. J. Biol. Chem.
270,5625
-5630.
Kimura, N., Matsuo, R., Shibuya, H., Nakashima, K. and Taga, T. (2000). BMP2-induced apoptosis is mediated by activation of the TAK1-p38 kinase pathway that is negatively regulated by Smad6. J. Biol. Chem. 23,17647 -17652.
Kretzschmar, M., Doody, J. and Massague, J. (1997). Opposing BMP and EGF signaling pathways converge on the TGF-beta family mediator Smad1. Nature 389,618 -622.[CrossRef][Medline]
Lefebvre, V., Huang, W., Harley, V. R., Goodfellow, P. N. and de Crombrugghe, B. (1997). SOX9 is a potent activator of the chondrocyte-specific enhancer of the pro alpha1(II) collagen gene. Mol. Cell Biol. 17,2336 -2346.[Abstract]
Liu, F., Ventura, F., Doody, J. and Massague, J. (1995). Human type II receptor for bone morphogenic proteins (BMPs): extension of the two-kinase receptor model to the BMPs. Mol. Cell. Biol. 15,3479 -3486.[Abstract]
Massague, J. (1998) TGF-beta signal transduction. Annu. Rev. Biochem. 67,753 -791.[CrossRef][Medline]
Nakamura, K., Shirai, T., Morishita, S., Uchida, S., Saeki-Miura, K. and Makishima, F. (1999). p38 mitogen-activated protein kinase functionally contributes to chondrogenesis induced growth/differentiation factor-5 in ATDC5 cells. Exp. Cell Res. 250,351 -363.[CrossRef][Medline]
Nohe, A., Hassel, S., Ehrlich, M., Neubauer, F., Sebald, W.,
Henis, Y. and Knaus, P. (2002). The mode of bone
morphogenetic protein (BMP) receptor oligomerization determines different
BMP-2 signaling pathways. J. Biol. Chem.
277,5330
-5338.
Nohno, T., Ishikawa, T., Saito, T., Hosokawa, K., Noji, S.,
Wolsing, D. H. and Rosenbaum, J. S. (1995). Identification of
a human type II receptor for bone morphogenetic protein-4 that forms
differential heteromeric complexes with bone morphogenetic protein type I
receptors. J. Biol. Chem.
270,22522
-22526.
Padgett, R. W., St. Johnson, R. D. and Gelbert, W. M. (1987). A transcript from a Drosophila pattern gene predict a protein homologous to the transforming growth factor-ß family. Nature 325,81 -84.[CrossRef][Medline]
Petersen, N. O. (2001). FCS and spatial correlations on biological surfaces, in Fluorescence Correlation Spectroscopy (ed. R. Rigler and E. L. Elson), pp.162 -184. Springer Verlag.
Rosenzweig, B. L., Imamura, T., Okadome, T., Cox, G. N.,
Yamashita, H., ten Dijke, P., Heldin, C. H. and Miyazono, K.
(1995). Cloning and characterization of a human type II receptor
for bone morphogenetic proteins. Proc. Natl. Acad. Sci.
USA 92,7632
-7636.
Shirakabe, K., Yamaguchi, K., Shibuya, H., Irie, K., Moriguchi,
T., Gotoh, Y., Matsumo, K. and Nishoda, E. (1997).
TAK1 mediates the ceramide signaling to stress-activated protein kinase/c-Jun
N-terminal kinase. J. Biol. Chem.
272,8141
-8144.
Srivastava, M. and Petersen, N. O. (1998). Diffusion of transferrin receptor clusters. Biophys. Chem. 75,201 -211.[CrossRef][Medline]
Storm, E. E., Huynh, T. V., Copeland, N. G., Jenkins, N. A., Kingsley, D. M. and Lee, S. J. (1994). Limb alterations in brachypodism mice due to mutations in a new member of the TGF beta-superfamily. Nature 368,639 -643.[CrossRef][Medline]
Weston, A. D., Rosen, V., Chandraratna, R. A. and Underhill, T.
M. (2000). Regulation of skeletal progenitor differentiation
by the BMP and retinoid signaling pathways. J. Cell
Biol. 148,679
-690.
Weston, A. D., Chandraratna, R. A., Torchia, J. and Underhill,
T. M. (2002). Requirement for RAR-mediated gene repression in
skeletal progenitor differentiation. J. Cell Biol.
158, 39-51.
Wilson, I. A., Niman, H. L., Houghten, R. A., Cherenson, A. R., Connolly, M. L. and Lerner, R. A. (1984). The structure of an antigenic determinant in a protein. Cell 37,767 -778.[CrossRef][Medline]
Wiseman, P. W., Hoddelius, P., Petersen, N. O. and Magnusson, K. E. (1997). Aggregation of PDGF-beta receptors in human skin fibroblasts: characterization by image correlation spectroscopy (ICS). FEBS Lett. 401,43 -48.[CrossRef][Medline]
Wiseman, P. W. and Petersen, N. O. (1999). Image correlation spectroscopy. II. Optimization for ultrasensitive detection of preexisting platelet-derived growth factor-beta receptor oligomers on intact cells. Biophys. J. 76,963 -977.[Medline]
This article has been cited by other articles:
![]() |
A. Nohe and N. O. Petersen Image Correlation Spectroscopy Sci. Signal., December 18, 2007; 2007(417): pl7 - pl7. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. WU, W. SHI, and X. CAO Multiplicity of BMP Signaling in Skeletal Development Ann. N.Y. Acad. Sci., November 1, 2007; 1116(1): 29 - 49. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. B Lee, V. Khivansara, M. M Santos, P. Lamba, T. Yuen, S. C Sealfon, and D. J Bernard Bone morphogenetic protein 2 and activin A synergistically stimulate follicle-stimulating hormone {beta} subunit transcription J. Mol. Endocrinol., February 1, 2007; 38(2): 315 - 330. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Deregowski, E. Gazzerro, L. Priest, S. Rydziel, and E. Canalis Notch 1 Overexpression Inhibits Osteoblastogenesis by Suppressing Wnt/beta-Catenin but Not Bone Morphogenetic Protein Signaling J. Biol. Chem., March 10, 2006; 281(10): 6203 - 6210. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Gazzerro, V. Deregowski, S. Vaira, and E. Canalis Overexpression of Twisted Gastrulation Inhibits Bone Morphogenetic Protein Action and Prevents Osteoblast Cell Differentiation in Vitro Endocrinology, September 1, 2005; 146(9): 3875 - 3882. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Nohe, E. Keating, T. M. Underhill, P. Knaus, and N. O. Petersen Dynamics and interaction of caveolin-1 isoforms with BMP-receptors J. Cell Sci., February 1, 2005; 118(3): 643 - 650. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||