|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online July 10, 2003
doi: 10.1242/10.1242/jcs.00650
Research Article |
Dipartimento di Sanita' Pubblica e Biologia Cellulare, Sezione di Anatomia, Universita' di Roma Tor Vergata, Rome, Italy
* Author for correspondence (e-mail: dolci{at}uniroma2.it)
Accepted 6 May 2003
| Summary |
|---|
|
|
|---|
Key words: BMP4, Alk3, Smad5, Kit, Spermatogonia
| Introduction |
|---|
|
|
|---|
The factors controlling spermatogonia differentiation to the Kit expressing
stage are not known; however, some clues in addressing this topic can be
gathered by analogies between spermatogonia and their fetal precursors, the
primordial germ cells (PGCs). In fact, proliferation and differentiation of
PGCs, as for spermatogonia, depend on a functional Kitl/Kit system
(Dolci et al., 1991
), as
demonstrated by their absence or severe reduction in W and
Sl mutations, in which the c-kit or Kitl genes are
inactivated. A further analogy between spermatogonia and PGCs is observed in
the responsiveness to BMP8b, a growth factor belonging to the TGFß-BMP
superfamily. BMP8b/ mice show impairment of PGC
commitment (Ying et al.,
2000
), defects of spermatogonia proliferation, and spermatocyte
apoptosis (Zhao et al., 1996
).
The incomplete abolishment of proliferation both in PGCs and spermatogonia
from BMP8b null mice might be explained by the redundant action of other
members of the BMP family within the embryo and the prepuberal testis. Indeed,
a member of this family, BMP4, has been shown to induce PGC formation, to act
as a PGC survival and localization factor within the allantois
(Lawson et al., 1999
) and as a
mitogen in in vitro cultured PGCs
(Pesce et al., 2002
).
Furthermore, two genes, encoding for proteins Smad1 and Smad5, known to be the
substrates of the signaling cascade induced by BMPs
(Hoodless et al., 1996
), have
been shown to control PGC differentiation and survival
(Tremblay et al., 2001
;
Chang and Matzuk, 2001
). An
eventual effect of BMP4, Smad1 or Smad5 deficiencies in postnatal
spermatogenesis cannot be ruled out, due to the lethal phenotype of their
knockouts during the embryonic stages of development.
To address these points we undertook an in vitro study to investigate the possibility that BMP4 and its transduction pathway might be involved in the initiation of spermatogenesis. We show that BMP4 is expressed and developmentally regulated in Sertoli cells, and that its receptors Alk3 and BMPIIR are specifically expressed in mitotic spermatogonia during the first week postnatum. Furthermore, we demonstrate that BMP4 is able to induce DNA synthesis in spermatogonia both from 4 and 7 days postnatum. BMP4 action is mediated by a rapid nuclear translocation of Smad4, which associates with Smad5. Upon nuclear translocation, the Smad4/Smad5 complexes are able to recruit the transactivating factor CBP and to bind Smad-responsive DNA sequences. We also found that Alk3 and Smad5 are exclusively expressed in the germline compartment of the postnatal testis and in proliferating PGCs. Finally, we show that BMP4 is able to induce c-kit expression in Kit-negative spermatogonia, thus conferring Kitl sensitivity in these cells. The present data indicate that the BMP4/Alk3/Smad5 pathway is expressed and operates in the postnatal testis and is involved in the regulation of spermatogonia differentiation.
| Materials and Methods |
|---|
|
|
|---|
At different times of culture an equal number of surviving cells, judged as
Trypan Blue negative, were fixed or frozen for immunofluorescence, western and
northern blotting, and electrophoretic mobility shift assay (EMSA).
Immunoprecipitation DNA synthesis was studied by [3H]thymidine
incorporation followed by autoradiography as previously described
(Rossi et al., 1993
). In these
experiments, incubation with [3H]thymidine was performed during the
last 4 hours of the 24 or 48 hour culture periods. The Student t-test
was used to assess the significance of [3H]thymidine incorporation.
Sertoli cells from different developmental ages, spermatocytes and spermatids
were prepared as previously reported
(Grimaldi et al., 1993
;
Sorrentino et al., 1991
).
Embryos were staged considering 0.5 the day of the vaginal plug.
Western-blot analysis, immunoprecipitation and antibodies
Cells were harvested, washed in cold PBS and homogenized at 4°C in
lysis buffer containing 10 mM Hepes pH 7.9, 10 mM KCl, 1.5 mM
MgCl2, 0.1 mM EGTA, 0.5 mM DTT, 10 mM ß-glycerophosphate, 0.1
mM sodium vanadate and a protease inhibitor cocktail (P8340; Sigma). Total
cellular proteins were transferred to polyvinylidene difluoride membranes
after SDS/PAGE. Membranes were blocked with PBS buffer containing 5% BSA and
0.1% Tween 20 for 1 hour at room temperature and then hybridized overnight at
4°C with primary antibodies. After hybridization with secondary antibodies
conjugated to horseradish peroxidase, the immunocomplexes were detected with
Supersignal West Pico detection reagent (Pierce, NJ).
Primary antibodies anti-Smad4 goat polyclonal (sc-1909), anti-Smad5 goat polyclonal (sc-7443), anti-Smad8 goat polyclonal (sc-7442), anti-BMPR-IA goat polyclonal (sc-5676), anti-CBP rabbit polyclonal (sc-1211 X), anti-c-Kit rabbit polyclonal (sc-6283) and anti-actin rabbit polyclonal (sc-7210) were from Santa Cruz Biotechnology (CA), and anti-histone H3 (06-755) was from Upstate Biotechnology (Milton Keynes, UK). All primary antibodies were used at a 1:1000 dilution.
For immunoprecipitation, 70 µg of total protein from control or treated samples was incubated in the presence of 2 µg anti-Smad4 antibody for 2 hours. The immunocomplexes were recovered with protein G-Sepharose presaturated with PBS containing 0.05% BSA (Sigma, Milan, Italy). After three washes in PBS at 4°C, under constant shaking, immunocomplexes were eluted from beads with SDS-samples buffer. Proteins were separated by SDS/PAGE, blotted and probed with anti-Smad5 antibody or with anti-CBP antibody.
Northern-blot analysis
BMP4, Alk3, BMPIIR, c-kit and ß actin probes were obtained by
RT-PCR amplification of total testis RNA using the following primer pairs:
BMP4 forward 5'TTTGGCCATGATGGCCGGGGCCATACCTT and reverse
5'TCAGCGGCATCCACACCCCTCTACCACCAT; Alk3 forward
5'ACTTTAGCACCAGAGGATACC and reverse 5'TTTTCACCACGCCATTTACCC;
BMP-IIR forward 5'TGCGGCTATAAGTGAGGTTGG and reverse
5'AGCAGTTGACATTGGGTTGAC; ß-actin forward
5'GGTTCCGATGCCCTGAGGCTC and reverse 5'ACTTGCGGTGCACGATGGAGG;
c-kit forward 5'TATGGACATGAAGCCTGGCGT and reverse
5'CATTCCTGATGTCTCTGGCTAGC. RNA was prepared from, 7 dpn testis, Sertoli
cell cultures, spermatogonia, spermatocytes, spermatids and STO (embryonic
fibroblast cell line) using the TRIZOL system (Gibco BRL). Total RNA (15
µg) was separated in denaturing agarose gel electrophoresis, blotted onto
nylon membrane (Hybond-N, Amersham, UK) using 10x saline sodium citrate
(SSC) buffer. Hybridization was carried out following Quick Hybrid System's
instruction (Stratagene, CA).
Autophosphorylation assay
Viable cells (106) obtained from 4 dpn testes were harvested and
homogenized in 40 µl of a modified lysis buffer [50 mM Hepes pH 7.5, 150 mM
NaCl, 1 mM EDTA, 1 mM EGTA, 10% glycerol, 1 mM DTT, 0.1% Tween 20, 10 mM
ß-glycerophosphate, 1 mM NaF, 0.1 mM sodium vanadate, 0.1 mM PMSF and
protease inhibitor cocktail (P8340; Sigma)]. Clarified supernatants were
prepared from whole cell lysates and 100 µg of protein from the
supernatants was incubated in 50 µl of the lysis buffer with 20 µg/ml
anti-c-kit polyclonal antibody for 2 hours at 4°C on a rotating shaker.
The immunocomplexes were recovered with protein A sepharose (Sigma) for 1 hour
at 4°C, while the supernatants were saved for normalization with an
anti-ß-actin antibody in western blotting. The immunocomplexes were then
washed three times at 4°C with PBS containing 0.05% BSA and once with the
specific kinase reaction buffer (50 mM Hepes pH 7.5, 10 mM MgCl2
and 1 mM DTT). Kinase assays were performed at 30°C for 30 minutes in a 20
µl volume of kinase reaction buffer containing 10 mM
ß-glycerophosphate, 0.1 mM sodium vanadate, protease inhibitor cocktail
(Sigma), 2.5 mM EGTA, 50 µM ATP, 0.1 mM PKAi, and 3 µCi of
[
-32P]ATP/reaction. Beads were washed three times with PBS
and boiled in 4x Laemmli buffer. The immunocomplexes were separated by
SDS/PAGE. Phosphorylated Kit protein was visualized by autoradiography of the
dried gel and quantified by densitometric analysis.
Immunofluorescence analysis
Cryostat sections were obtained from unfixed frozen embryo testes at
different ages of development. Control and treated spermatogonia were adhered
onto poly-L-lysine glass slides. Both tissues and cells were fixed for 10
minutes at room temperature in 2% paraformaldhyde, washed in PBS,
permeabilized for 10 minutes with PBS containing 0.1% Triton X-100, and
incubated for 30 minutes at room temperature with PBS containing 0.5% BSA.
Samples were then incubated overnight at 4°C in a humidified chamber with
the respective antibodies at a final concentration of 2 µg/ml and then for
1 hour at room temperature with cyanin 3 (AP 180 C; CHEMICON, CA) or
FITC-conjugated secondary antibodies (401319 anti-rabbit IgG and 401514
anti-goat IgG; Calbiochem, Darmstadt, Germany). Slides were washed and mounted
in 50% glycerol in PBS and immediately examined by fluorescence microscopy.
Nuclei were counterstained with 1 µg/ml Hoechst (33342; Sigma). Control
experiments were performed using non-immune immunoglobulins instead of the
specific antibody. For histological analysis, representative frozen sections
of 4 and 7 dpn testes were stained with 0.05% Toluidine Blue.
Electrophoretic mobility shift assay (EMSA)
Gel mobility shift assay was performed as previously reported
(Grimaldi et al., 1993
).
Briefly, nuclear extracts were prepared from spermatogonia at 7 dpn treated or
untreated with BMP4 after 1 hour of culture. After cell lysis, nuclei were
isolated by centrifugation and extracted for 30 minutes at 4°C with
extraction buffer containing 490 mM NaCl, 10 mM Hepes pH 7.9, 10 mM KCl, 1.5
mM MgCl2, 0.1 mM EGTA, 0.5 mM DTT, 10 mM ß-glycerophosphate,
0.1 mM sodium vanadate, 1/100 (v/v) of protease inhibitors mixture and 5%
glycerol. Nuclear extracts were collected after centrifugation at 100,000
g for 30 minutes and concentrated on Centricon-10 membranes
after NaCl adjustment to the final concentration of 60 mM NaCl. EMSAs were
performed as previously described using 9 µg of nuclear proteins added to a
premix solution containing 2 µg double-stranded poly(dI-dC) (Pharmacia,
Piscataway, NJ), and a 0.5-1 ng [
-32P]dATP-labeled
double-stranded GCCGnCGC (GCCG motif)-containing oligonucleotide
(5'GATATCTGCCGCCGCTTTGCCGCCGCTTTGCCGCCGCG3' and
3'ATCCGCGGCGGCAAAGCGGCGGCAAAGCGGCGGCA5') (see
Kusanagi et al., 2000
). For
binding specificity, extracts were incubated with 100 fold molar excess of
unlabeled oligonucleotide or with a mutated form of the oligonucleotide
(5'GATCTGCCGTCGCTTTGCCGTCGCTTTGCCGTCGCG3' and
3'GATCCGCGACGGCAAAGCGACGGCAAAGCGACGGCA5'; mut1)
(Kusanagi et al., 2000
).
Anti-Smad4 and anti-Smad5 antibodies were added to nuclear extracts for 1 hour
at 4°C before incubating with probe to prevent or to supershift the
formation of the specific retarded band. Anti-Smad8 was used as negative
control. After 30 minutes of incubation at room temperature, the reaction
mixture was loaded on a 6% polyacrylamide gel in 1x Trisborate-EDTA
buffer. Gels were dried and analyzed by autoradiography.
| Results |
|---|
|
|
|---|
|
Immunofluorescence analysis on frozen cryostat sections of 4 and 7 dpn testes using an anti-Alk3 antibody showed that the only cells expressing Alk3 are spermatogonia (Fig. 2B). The same analysis carried out on isolated spermatogonia showed that at 7 dpn two classes of cells could be identified: a strongly labeled spermatogonia cell type with a large nucleus and decondensed chromatin, and a weaker labeled class of spermatogonia with a smaller nucleus and condensed chromatin (Fig. 2C). Western blot analysis showed a strong Alk3 immunoreactive band in spermatogonia and the absence of a specific signal in spermatocytes (Fig. 2D).
|
To investigate whether Alk3 was expressed also in PGCs, which are the cell types primarily affected by BMP mutations, we performed an immunolocalization experiment during their migratory period. PGCs at 10.5 days post coitum (dpc), identified by intense alkaline phosphatase activity (Fig. 2E, left panel), showed specific staining for Alk3 as well as for Kit (Fig. 2E, right panels, respectively), the same as observed for mitotic postnatal spermatogonia (Fig. 2B).
BMP4 induces [3H]thymidine incorporation in Kit-negative
and Kit-expressing spermatogonia cultures
Because spermatogonia express high levels of both Alk3 and BMPIIR, and
Sertoli cells of the corresponding age express high levels of BMP4
transcripts, we evaluated the effect of BMP4 on spermatogonia proliferation by
a [3H]thymidine incorporation assay
(Fig. 3). BMP4 treatment
induced a 2.5 to 3 fold increase in the percentage of [3H]thymidine
incorporating cells in cultures of spermatogonia isolated from 4 dpn animals,
and a 2 to 2.5 fold increase in 7 dpn cells. Parallel experiments were
conducted including Kitl as a mitogen and an increase of 3.9 fold of
[3H]thymidine incorporating cells was observed in 7 dpn
spermatogonia, as previously reported
(Rossi et al., 1993
;
Dolci et al., 2001
). On the
contrary, 4 dpn spermatogonia did not respond to Kitl, confirming that at this
age spermatogonia expressing Kit are rare
(Dolci et al., 2001
). Addition
of both BMP4 and Kitl in 7 dpn spermatogonia was not significantly additive in
terms of fold increase of [3H]thymidine incorporating cells,
suggesting that, at this developmental age, BMP4 is acting in spermatogonia
co-expressing Kit and Alk3. BMP4 did not influence cell viability, since in
TUNEL assays the percentage of apoptosis was similar in BMP4 treated samples
compared to the control (not shown).
|
BMP4 induces a rapid nuclear translocation of Smad4 and Smad5
Activation of type II-type I receptors of the TGFß family members
leads to the phosphorylation of receptor activated Smads (R-Smads: Smad 1,
Smad2, Smad3, Smad5, and Smad8) (Graff et
al., 1996
). Among the R-Smads, Smad1, Smad5 and Smad8 have been
shown to be preferential substrates for type I BMP receptors
(Hoodless et al., 1996
;
Nishimura et al., 1998
). Upon
phosphorylation, R-Smads oligomerize with common mediator Smad (Smad4)
(Zhang et al., 1997
) and
translocate to the nucleus. Since we observed that BMP4 induced an increase of
the proliferation rate in spermatogonia, we analyzed which of the transduction
molecules among the BMP-activated Smads were activated by BMP4. We first
performed immunofluorescence experiments on testicular sections at 4 and 7 dpn
of development using antibodies against Smad1, Smad4, Smad5 and Smad8
(Fig. 4). The anti-Smad4 and
anti-Smad8 antibodies stained all the cellular types within the testis, and
Smad8 was localized predominantly in the cytoplasm
(Fig. 4A). In agreement with
previous observations (Zhao and Hogan,
1997
), Smad1 was negative at both ages (not shown). Interestingly,
anti-Smad5 antibodies specifically decorated the nuclear compartment of
spermatogonia at both 4 dpn and 7 dpn (Fig.
4B). Smad5 was also expressed in PGCs at 10.5 dpc, during their
migratory period, and at 12.5 dpc, when they have already colonized the gonads
(Fig. 4C).
|
To test which of the Smads was actually transducing BMP4 signaling in spermatogonia, cells, isolated from 4 and 7 dpn animals, were stimulated by the factor and after 1 hour they were subjected to immunofluorescence. Fig. 5A shows that BMP4 induces nuclear translocation of Smad4 in 4 dpn spermatogonia, while in the controls a cytoplasmatic ring was evident. Similar studies were performed using anti-Smad5 and anti-Smad8 antibodies. Smad5 showed nuclear localization in control spermatogonia; however, after 1 hour of BMP4 stimulation, the intensity of the immunostaining in the nuclear compartment increased (Fig. 5B). On the contrary, Smad8 was predominantly cytoplasmic both in the control and BMP-treated cells (Fig. 5C). Nuclear translocation of Smad4 and the increase of Smad5 nuclear levels were also confirmed by western blot analysis of nuclear and cytoplasmic extracts obtained from control and BMP4-treated 7 dpn spermatogonia (Fig. 5D).
|
Smad4/Smad5 form a functional DNA-binding complex in BMP4-treated
spermatogonia
Because both Smad4 and Smad5 levels increased in the nuclear compartment of
spermatogonia treated with BMP4 for 1 hour, we tested whether they were
interacting in the BMP4-treated cells. After immunoprecipitation with
anti-Smad4 antibodies, an increase of Smad5 association was evident in
BMP4-treated cell extracts (Fig.
6A). It has been shown that the transcriptional activity of the
Smad4/R-Smad complex can be mediated by the recruitment of the transcriptional
coactivator CBP/p300 in the complex
(Pouponnot et al., 1998
). To
verify whether this event was also occurring in spermatogonia, the anti-Smad4
immunoprecipitates were probed with an anti-CBP/p300 antibody.
Fig. 6A shows that, only in the
BMP-treated cells, CBP is actually associated to the complex.
|
We then investigated whether a GC-rich synthetic double-stranded oligomer,
which has been previously shown to be recognized by the Smad4/Smad5 complex
(Kusanagi et al., 2000
), was
able to form DNA-protein complexes in the presence of nuclear extracts from
BMP4-treated or untreated spermatogonia.
Fig. 5B shows an
electrophoretic mobility shift assay (EMSA), in which after 1 hour of BMP4
treatment a discrete DNA-protein complex was evident in nuclear extracts from
BMP4-treated cells. The presence of a molar excess of unlabeled
double-stranded oligomer was able to prevent the formation of the complex,
whereas the presence of a molar excess of a mutated oligomer did not compete
for the complex formation. Pre-incubation of the extracts with anti-Smad4
(Fig. 6B) was able to inhibit
the formation of the specific retarded band but this effect was not observed
with anti-Smad8 antibody (Fig.
6C). The presence of anti-Smad5 resulted in supershift of the DNA
complex, indicating that both Smad4 and Smad5 are present in the BMP4-induced
DNA-protein complex (Fig.
6C).
BMP4 regulates c-kit expression in spermatogonia
It has been suggested that BMP4 may play a potential role in PGC
differentiation by inducing receptors for survival factors
(Fujiwara et al., 2001
). Since
Kit is a receptor that mediates proliferation and survival of differentiated
spermatogonia through its ligand Kitl, we hypothesized that BMP4 treatment
could induce c-kit expression in undifferentiated 4 dpn
spermatogonia, which are not sensitive to Kitl
[(Dolci et al., 2001
); see also
Fig. 2]. Cells were cultured
for 48 hours in the presence or absence of BMP4, and Kitl was added for the
last 24 hours in a set of cultures for both conditions. We found that BMP4
pretreatment actually induces Kitl responsiveness in Kit-negative
spermatogonia, since a significant additive effect of the two growth factors
in the last 24 hours of culture was observed
(Fig. 7A). To acquire Kitl
sensitivity, 4 dpn spermatogonia had to be incubated in the presence of BMP4
at least for 24 hours, since when BMP4 and Kitl were added simultaneously for
24 hours, no additive effect of Kitl was observed (see
Fig. 3).
|
A probable explanation for the induction of Kitl responsiveness in these
cells would be the induction of c-kit expression. To test this
hypothesis, we treated 4 dpn spermatogonia for 24 hours with or without 100
ng/ml of BMP4 and immunoprecipitated the cell extracts with an anti-Kit
antibody. Because of the low levels of Kit expression at this age, the
immunoprecipitates were subjected to constitutive autophosphorylation in a
kinase assay by the addition of [
-32P]ATP prior to the
electrophoretic separation. Fig.
7B shows that BMP4 induces a dramatic increase of Kit expression
in 4 dpn spermatogonia. Kit induction by BMP4 was confirmed also in
spermatogonia isolated from 7 dpn mice by northern blot analysis
(Fig. 7C).
| Discussion |
|---|
|
|
|---|
BMP4/Alk3/Smad5 are differentially and developmentally regulated in
the prepuberal testis
The role of BMP4 in the generation of PGCs has been clearly shown in
knockout mice (Lawson et al.,
1999
). In the early mouse embryo, at around 5.5 dpc, BMP4 is
produced by the extraembryonic ectoderm, and in combination with BMP8b
(Ying et al., 2001
) and with
BMP2 (from endodermal origin) (Ying and
Zhao, 2001
), it plays a role in the induction of PGC precursors.
At later stages (7 dpc) it is produced by extraembryonic mesoderm and it has
been shown to be required for the proper allocation within the allantois,
survival and differentiation of PGCs
(Fujiwara et al., 2001
). Here
we report that, in the postnatal development, BMP4 regulates proliferation and
differentiation of the descendants of male PGCs, i.e. spermatogonia. BMP8b has
been shown to be produced by germ cells
(Zhao et al., 1996
), whereas
BMP4 is expressed at high levels in the early postnatal testis by Sertoli
cells and its expression is developmentally regulated. The maximal BMP4
expression in the testis coincides with the presence of Kit-negative
spermatogonia within the seminiferous tubules, suggesting that these cells
might be the natural target of BMP4 action in the prepuberal testis. Indeed,
spermatogonia express the BMP receptor Alk3 at 4 dpn and are sensitive to
BMP4, as demonstrated by the in vitro proliferation assay. Activation of the
BMP4 signal transduction pathway in spermatogonia appears to be mediated by
the Smad4/5 complex. Smad5 is specifically expressed in mitotic spermatogonia,
but not in somatic cells, and mediates a rapid Smad4 nuclear translocation
upon BMP4 treatment of spermatogonia. Since Smad1 is not expressed in mitotic
spermatogonia and Smad8 does not change its cytoplasmic distribution after
BMP4 stimulation, Smad5 is the molecular target of Alk3 activation in these
cell types.
BMP-activated Smads are known to play an essential role in PGC generation
and localization in the early mouse embryo
(Tremblay et al., 2001
;
Chang and Matzuk, 2001
);
however, it has not been formally shown whether they are expressed in PGCs.
Here we show that both the receptor Alk3 and Smad5 are expressed in migratory
PGCs and in the germ cell compartment of the male fetal gonad, and that their
expression is maintained in the postnatal life in mitotic spermatogonia, thus
suggesting that Alk3 and Smad5 mediate BMP signaling throughout the
development of mitotic germ cells.
Smad4/5 and CBP form an active complex upon BMP4 stimulation
We demonstrate that Smad5 activation in response to BMP4 leads to Smad4
association and nuclear translocation after 1 hour of stimulation. The GCCG
motif has been shown to be a Smad1/5/4-binding element
(Kusanagi et al., 2000
;
Ishida et al., 2000
) and
appears to be conserved in Drosophila Dpp activated promoters
(Kim et al., 1997
;
Xu et al., 1998
). We found
that the BMP4-induced Smad4/5 complex formation has DNA-binding ability. When
an oligomer containing the GCCG motif was used as a probe in EMSA experiments,
it was specifically retarded in BMP4-treated extracts. It is known that Smad4
is able to form homo- and hetero-oligomers with R-Smads upon activation (for a
review, see Heldin et al.,
1997
). The DNA-binding activity of the heteromeric complex induced
by BMP4 was inhibited by the presence of an anti-Smad4 antibody against the
MH2 domain (oligomerization domain). However, since the anti-Smad4 antibody is
able to co-immunoprecipitate Smad5, it is possible that the antibody inhibits
Smad4-Smad4 interactions in the formation of the heteromeric complex, rather
than interfering with the physical association of Smad4 to Smad5.
Just as with many transcription factors, the R-Smad proteins interact with
the transcriptional coactivators CBP and p300 through their MH2 domains
(Feng et al., 1998
;
Janknecht et al., 1998
;
Pouponnot et al., 1998
;
Topper et al., 1998
). CBP/p300
are essential coactivators for a wide variety of transcriptional promoters
(Mannervik and Akusjarvi,
1997
) and possess intrinsic histone acetyltransferase activity.
CBP and p300 contain three highly conserved cysteine-histidine-rich domains,
two of which have been shown to interact with the Smad activation domain of
Smad4, (de Caestecker et al.,
2000
), and with R-Smads (Feng
et al., 1998
; Janknecht et
al., 1998
; Nishihara et al.,
1998
), respectively. According to this model, we found that only
in extracts from BMP4-treated spermatogonia is CBP associated to the Smad4/5
heteromeric complex, suggesting that cooperation between Smads and CBP
enhances BMP4-mediated activation of transcription in spermatogonia.
Kit is upregulated by BMP4 in mitotic spermatogonia
It has been shown that TGF-ß can downregulate c-kit
expression in hemopoietic cells
(Sansilvestri et al., 1995
;
Heinrich et al., 1995
), while
it upregulates c-kit expression in T-leukemia cells and in
melanoblasts (Tomeczkowski et al.,
1998
; Kawakami et al.,
2002
). To date no reports have been obtained on the factors that
regulate c-kit expression in germ cells. We found that exposure of
spermatogonia to exogenous BMP4 is able to upregulate Kit expression both at
the RNA and protein level, conferring Kitl responsiveness to spermatogonia at
4 dpn, when the majority of germ cells are Kit negative. It is possible that
BMP4 activation of Smad4/5 directly mediates c-kit expression in germ
cells. Indeed, there are several GCCG elements within the 4225 bp of the
c-kit promoter region (accession no. X86451), suggesting potential
binding sites for Smad4/5. An alternative possibility is that the
BMP4-activated signaling might regulate the expression of germ cell specific
transcription factor(s), which in turn activates c-kit gene
expression. It has been shown, in fact, that the c-kit gene is
specifically regulated by tal1/SCL transcription factor in hematopoietic cells
(Krosl et al., 1998
) and by
MITF in mast cells (Tsujimura et al.,
1996
).
Our data show that BMP4 acts both as proliferation and differentiation
factor in undifferentiated spermatogonia in vitro. Proliferation of
undifferentiated spermatogonia has also been shown to be stimulated by GDNF
produced by Sertoli cells within the prepuberal testis
(Meng et al., 2000
;
Viglietto et al., 2000
);
however, GDNF seems rather to block their differentiation, as shown by
overexpression experiments in transgenic mice
(Meng et al., 2000
). Since
spermatogonia stem cells are able to renew themselves and at the same time to
progress through differentiation (i.e. to the Kit-dependent stages of
proliferation), BMP4 could be one of the factors that regulates such process.
Alternatively, BMP4 could act on a subset of spermatogonia that has lost stem
cell features but still has to become a Kit-positive class of germ cells.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Blume-Jensen, P., Jiang, G., Hyman, R., Lee, K. F., O'Gorman, S. and Hunter, T. (2000). Kit/stem cell factor receptor-induced activation of phosphatidylinositol 3'-kinase is essential for male fertility. Nat. Genet. 24,157 -162.[CrossRef][Medline]
Brannan, C. I., Bedell, M. A., Resnick, J. L., Eppig, J. J.,
Handel, M. A., Williams, D. E., Lyman, S. D., Donovan, P. J., Jenkins,
N. A. and Copeland, N. G. (1992). Developmental abnormalities
in Steel17H mice result from a splicing defect in the steel factor cytoplasmic
tail. Genes Dev. 6,1832
-1842.
Chang, H. and Matzuk, M. (2001). Smad5 is required for mouse primordial germ cell development. Mech. Dev. 104,61 -67.[CrossRef][Medline]
De Caestecker, M. P., Yahata, T., Wang, D., Parks, W. T., Huang,
S., Hill, C. S., Shioda, T., Roberts, A. B. and Lechleider, R. J.
(2000). The Smad4 activation domain (SAD) is a proline-rich,
p300-dependent transcriptional activation domain. J. Biol.
Chem. 275,2115
-2122.
De Rooij, D. G. (2001). Proliferation and differentiation of spermatogonial stem cells. Reproduction 121,347 -354.[Abstract]
Dolci, S., Williams, D. E., Ernst, M. K., Resnick, J. L., Brannan, C. I., Lock, L. F., Lyman, S. D., Boswell, H. S. and Donovan, P. J. (1991). Requirement for mast cell growth factor for primordial germ cell survival in culture. Nature 352,809 -811.[CrossRef][Medline]
Dolci, S., Pellegrini, M., di Agostino, S., Geremia, R. and
Rossi, P. (2001). Signaling through extracellular
signal-regulated kinase is required for spermatogonial proliferative response
to stem cell factor. J. Biol. Chem.
276,40225
-40233.
Feng, X. H., Zhang, Y., Wu, R. Y. and Derynck, R.
(1998). The tumor suppressor Smad4/DPC4 and transcriptional
adaptor CBP/p300 are coactivators for smad3 in TGF-beta-induced
transcriptional activation. Genes Dev.
12,2153
-2163.
Feng, L. X., Ravindranath, N. and Dym, M.
(2000). Stem cell factor/c-kit up-regulates cyclin D3 and
promotes cell cycle progression via the phosphoinositide 3-kinase/p70 S6
kinase pathway in spermatogonia. J. Biol. Chem.
275,25572
-25576.
Fujiwara, T., Dunn, N. R. and Hogan, B. L.
(2001). Bone morphogenetic protein 4 in the extraembryonic
mesoderm is required for allantois development and the localization and
survival of primordial germ cells in the mouse. Proc. Natl. Acad.
Sci. USA 98,13739
-13744.
Graff, J. M., Bansal, A. and Melton, D. A. (1996). Xenopus Mad proteins transduce distinct subsets of signals for the TGF beta superfamily. Cell 85,479 -487.[CrossRef][Medline]
Grimaldi, P., Piscitelli, D., Albanesi, C., Blasi, F., Geremia,
R. and Rossi, P. (1993). Identification of
3',5'-cyclic adenosine monophosphate-inducible nuclear factors
binding to the human urokinase promoter in mouse Sertoli cells.
Mol. Endocrinol. 7,1217
-1225.
Heinrich, M. C., Dooley, D. C. and Keeble, W. W.
(1995). Transforming growth factor beta 1 inhibits expression of
the gene products for steel factor and its receptor (c-kit).
Blood 85,1769
-1780.
Heldin, C. H., Miyazono, K. and ten Dijke, P. (1997). TGF-beta signalling from cell membrane to nucleus through SMAD proteins. Nature 390,465 -471.[CrossRef][Medline]
Hoodless, P. A., Haerry, T., Abdollah, S., Stapleton, M., O'Connor, M. B., Attisano, L. and Wrana J. L. (1996). MADR1, a MAD-related protein that functions in BMP2 signaling pathways. Cell 85,489 -500.[CrossRef][Medline]
Ishida, W., Hamamoto, T., Kusanagi, K., Yagi, K., Kawabata,
M., Takehara, K., Sampath, T. K., Kato, M. and Miyazono, K.
(2000). Smad6 is a Smad1/5-induced smad inhibitor.
Characterization of bone morphogenetic protein-responsive element in the mouse
Smad6 promoter. J. Biol. Chem.
275,6075
-6079.
Janknecht, R., Wells, N. J. and Hunter, T.
(1998). TGF-beta-stimulated cooperation of smad proteins with the
coactivators CBP/p300. Genes Dev.
12,2114
-2119.
Kawakami, T., Soma, Y., Kawa, Y., Ito, M., Yamasaki, E., Watabe, H., Hosaka, E., Yajima, K., Ohsumi, K. and Mizoguchi, M. (2002). Transforming growth factor beta1 regulates melanocyte proliferation and differentiation in mouse neural crest cells via stem cell factor/KIT signaling. J. Invest. Dermatol. 118,471 -478.[CrossRef][Medline]
Kim, J., Johnson, K., Chen, H. J., Carroll, S. and Laughon, A. (1997). Drosophila Mad binds to DNA and directly mediates activation of vestigial by Decapentaplegic. Nature 388,304 -308.[CrossRef][Medline]
Kissel, H., Timokhina, I., Hardy, M. P., Rotschild, G., Tajima, Y., Soares, V., Angeles, M., Whitlow, S. R., Manova, K. and Bessmer P. (2000). Point mutation in Kit receptor tyrosine kinase reveals essential roles for kit signaling in oogenesis and spermatogenesis without affecting other kit responses. EMBO J. 19,1312 -1326.[CrossRef][Medline]
Kusanagi, K., Inoue, H., Ishidou, Y., Mishima, H. K., Kawabata,
M. and Miyazono, K. (2000). Characterization of a bone
morphogenetic protein-responsive Smad-binding element. Mol. Biol.
Cell 11,555
-565.
Krosl, G., He, G., Lefrancois, M., Charron, F., Romeo, P. H.,
Jolicoeur, P., Kirsch, I. R., Nemer, M. and Hoang, T.
(1998). Transcription factor SCL is required for c-kit expression
and c-Kit function in hemopoietic cells. J. Exp. Med.
188,439
-450.
Lawson, K. A., Dunn, N. R., Roelen, B. A., Zeinstra, L. M.,
Davis, A. M., Wright, C. V., Korving, J. P. and Hogan, B. L.
(1999). Bmp4 is required for the generation of primordial germ
cells in the mouse embryo. Genes Dev.
13,424
-436.
Mannervik, M. and Akusjarvi, G. (1997). The transcriptional co-activator proteins p300 and CBP stimulate adenovirus E1A conserved region 1 transactivation independent of a direct interaction. FEBS Lett. 414,111 -116.[CrossRef][Medline]
Manova, K., Nocka, K., Besmer, P. and Bachvarova, R. F.
(1990). Gonadal expression of c-kit encoded at the W locus of the
mouse. Development 110,1057
-1069.
Meng, X., Lindahl, M., Hyvonen, M. E., Parvinen, M., de Rooij,
D. G., Hess, M. W., Raatikainen-Ahokas, A., Sainio, K., Rauvala, H.,
Lakso, M. et al. (2000). Regulation of cell fate decision of
undifferentiated spermatogonia by GDNF. Science
287,1489
-1493.
Nishihara, A., Hanai, J. I., Okamoto, N., Yanagisawa, J., Kato, S., Miyazono, K. and Kawabata, M. (1998). Role of p300, a transcriptional coactivator, in signalling of TGF-beta. Genes Cells 3,613 -623.[Abstract]
Nishimura, R., Kato, Y., Chen, D., Harris, S. E., Mundy, G. R.
and Yoneda, T. (1998). Smad5 and DPC4 are key
molecules in mediating BMP-2-induced osteoblastic differentiation of the
pluripotent mesenchymal precursor cell line C2C12. J. Biol.
Chem. 273,1872
-1879.
Pesce, M., Klinger, G. F. and de Felici, M. (2002). Derivation in culture of primordial germ cells from cells of the mouse epiblast: phenotypic induction and growth control by Bmp4 signalling. Mech. Dev. 112, 15-24.[CrossRef][Medline]
Pouponnot, C., Jayaraman, L. and Massague, J.
(1998). Physical and functional interaction of SMADs and
p300/CBP. J. Biol. Chem.
273,22865
-22868.
Rossi, P., Albanesi, C., Grimaldi, P. and Geremia, R. (1991). Expression of the mRNA for the ligand of c-kit in mouse sertoli cells. Biochem. Biophys. Res. Commun. 176,910 -914.[CrossRef][Medline]
Rossi, P., Marziali, G., Albanesi, C., Charlesworth, A., Geremia, R. and Sorrentino, V. (1992). A novel c-kit transcript, potentially encoding a truncated receptor, originates within a kit gene intron in mouse spermatids. Dev. Biol. 152,203 -207.[CrossRef][Medline]
Rossi, P., Dolci, S., Albanesi, C., Grimaldi, P., Ricca, R. and Geremia, R. (1993). Follicle-stimulating hormone induction of steel factor (SLF) mRNA in mouse sertoli cells and stimulation of DNA synthesis in spermatogonia by soluble SLF. Dev. Biol. 155, 68-74.[CrossRef][Medline]
Sansilvestri, P., Cardoso, A. A., Batard, P., Panterne, B.,
Hatzfeld, A., Lim, B., Levesque, P., Monier, M. N. and Hatzfeld, J.
(1995). Early CD34high cells can be separated into KIT high cells
in which transforming growth factor-beta (TGF-beta) downmodulates c-kit and
KIT low cells in which anti-TGF-beta upmodulates c-kit.
Blood 86,1729
-1735.
Schrans-Stassen, B. H., van de Kant, H. J., de Rooij, D. G. and
van Pelt, A. M. (1999). Differential expression of
c-kit in mouse undifferentiated and differentiating type A spermatogonia.
Endocrinology 140,5894
-5900.
Sorrentino, V., Giorgi, M., Geremia, R., Besmer, P. and Rossi, P. (1991). Expression of the c-kit proto-oncogene in the murine male germ cells. Oncogene 6, 149-151.[Medline]
Tomeczkowski, J., Frick, D., Schwinzer, B., Wittner, N., Ludwig, W. D., Reiter, A., Welte, K. and Sykora, K. W. (1998). Expression and regulation of c-kit receptor and response to stem cell factor in childhood malignant T-lymphoblastic cells. Leukemia 12,1221 -1229.[CrossRef][Medline]
Topper, J. N., DiChiara, M. R., Brown, J. D., Williams, A. J.,
Falb, D., Collins, T. and Gimbrone, M. A. Jr (1998).
CREB binding protein is a required coactivator for Smad-dependent,
transforming growth factor beta transcriptional responses in endothelial
cells. Proc. Natl. Acad. Sci. USA
95,9506
-9511.
Tremblay, K. D., Dunn, N. R. and Robertson, E. J. (2001). Mouse embryos lacking Smad1 signals display defects in extra-embryonic tissues and germ cell formation. Development 128,3609 -3621.
Tsujimura, T., Morii, E., Nozaki, M., Hashimoto, K., Moriyama,
Y., Takebayashi, K., Kondo, T., Kanakura, Y. and Kitamura, Y.
(1996). Involvement of transcription factor encoded by the mi
locus in the expression of c-kit receptor tyrosine kinase in cultured mast
cells of mice. Blood 88,1225
-1233.
Viglietto, G., Dolci, S., Bruni, P., Baldassarre, G., Chiariotti, L., Melillo, R. M., Salvatore G., Chiappetta, G., Sferratore, F., Fusco, A. and Santoro, M. (2000). Glial cell line-derived neutrotrophic factor and neurturin can act as paracrine growth factors stimulating DNA synthesis of Ret-expressing spermatogonia. Int. J. Oncol. 16,689 -694.[Medline]
Xu, X., Yin, Z., Hudson, J. B., Ferguson, E. L. and Frasch,
M. (1998). Smad proteins act in combination with synergistic
and antagonistic regulators to target Dpp responses to the Drosophila
mesoderm. Genes Dev. 12,2354
-2370.
Ying, Y., Liu, X. M., Marble, A., Lawson, K. A. and Zhao, G.
Q. (2000). Requirement of Bmp8b for the generation of
primordial germ cells in the mouse. Mol. Endocrinol.
14,1053
-1063.
Ying, Y. and Zhao, G. Q. (2001) Cooperation of endoderm-derived BMP2 and extraembryonic ectoderm-derived BMP4 in primordial germ cell generation in the mouse. Dev. Biol. 232,484 -492.[CrossRef][Medline]
Ying, Y., Qi, X. and Zhao, G. Q. (2001).
Induction of primordial germ cells from murine epiblasts by synergistic action
of BMP4 and BMP8B signaling pathways. Proc. Natl. Acad. Sci.
USA 98,7858
-7862.
Yoshinaga, K., Nishikawa, S., Ogawa, M., Hayashi, S., Kunisada, T., Fujimoto, T. and Nishikawa, S. (1991). Role of c-kit in mouse spermatogenesis: identification of spermatogonia as a specific site of c-kit expression and function. Development 113,689 -699.[Abstract]
Zhang, Y., Musci, T. and Derynck, R. (1997). The tumor suppressor Smad4/DPC 4 as a central mediator of Smad function. Curr. Biol. 7,270 -276.[CrossRef][Medline]
Zhao, G. Q., Deng, K., Labosky, P. A., Liaw, L. and Hogan, B.
L. (1996). The gene encoding bone morphogenetic protein 8B is
required for the initiation and maintenance of spermatogenesis in the mouse.
Genes Dev. 10,1657
-1669.
Zhao, G. Q. and Hogan, B. L. (1997). Evidence that Mothers-against-dpp-related 1 (Madr1) plays a role in the initiation and maintenance of spermatogenesis in the mouse. Mech. Dev. 61,63 -73.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
S. Mithraprabhu and K. L Loveland Control of KIT signalling in male germ cells: what can we learn from other systems? Reproduction, November 1, 2009; 138(5): 743 - 757. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Grimaldi, P. Orlando, S. Di Siena, F. Lolicato, S. Petrosino, T. Bisogno, R. Geremia, L. De Petrocellis, and V. Di Marzo The endocannabinoid system and pivotal role of the CB2 receptor in mouse spermatogenesis PNAS, July 7, 2009; 106(27): 11131 - 11136. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Basciani, G. De Luca, S. Dolci, M. Brama, M. Arizzi, S. Mariani, G. Rosano, G. Spera, and L. Gnessi Platelet-Derived Growth Factor Receptor {beta}-Subtype Regulates Proliferation and Migration of Gonocytes Endocrinology, December 1, 2008; 149(12): 6226 - 6235. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Itman, S. Mendis, B. Barakat, and K. L. Loveland All in the family: TGF-{beta} family action in testis development. Reproduction, August 1, 2006; 132(2): 233 - 246. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. Goldman, R. Hackenmiller, T. Nakayama, S. Sopory, C. Wong, H. Kulessa, and J. L. Christian Mutation of an upstream cleavage site in the BMP4 prodomain leads to tissue-specific loss of activity Development, May 15, 2006; 133(10): 1933 - 1942. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Prabhu, M. L Meistrich, E. A McLaughlin, S. D Roman, S. Warne, S. Mendis, C. Itman, and K. L. Loveland Expression of c-Kit receptor mRNA and protein in the developing, adult and irradiated rodent testis. Reproduction, March 1, 2006; 131(3): 489 - 499. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Loveland, C. Hogarth, A. Szczepny, S. M. Prabhu, and D. A. Jans Expression of Nuclear Transport Importins beta 1 and beta 3 Is Regulated During Rodent Spermatogenesis Biol Reprod, January 1, 2006; 74(1): 67 - 74. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J Meachem, S. M Ruwanpura, J. Ziolkowski, J. M Ague, M. K Skinner, and K. L Loveland Developmentally distinct in vivo effects of FSH on proliferation and apoptosis during testis maturation J. Endocrinol., September 1, 2005; 186(3): 429 - 446. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Xia, Y. Sidis, A. Mukherjee, T. A. Samad, G. Brenner, C. J. Woolf, H. Y. Lin, and A. Schneyer Localization and Action of Dragon (Repulsive Guidance Molecule b), a Novel Bone Morphogenetic Protein Coreceptor, throughout the Reproductive Axis Endocrinology, August 1, 2005; 146(8): 3614 - 3621. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Lacham-Kaplan In vivo and in vitro differentiation of male germ cells in the mouse Reproduction, August 1, 2004; 128(2): 147 - 152. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Aubin, A. Davy, and P. Soriano In vivo convergence of BMP and MAPK signaling pathways: impact of differential Smad1 phosphorylation on development and homeostasis Genes & Dev., June 15, 2004; 18(12): 1482 - 1494. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nakamoto, A. Shiratsuchi, H. Oda, K. Inoue, T. Matsumura, M. Ichikawa, T. Saito, S. Seo, K. Maki, T. Asai, et al. Impaired spermatogenesis and male fertility defects in CIZ/Nmp4-disrupted mice Genes Cells, June 1, 2004; 9(6): 575 - 589. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||