|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 2 July 2003
doi: 10.1242/jcs.00649
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |

Biochemistry Department, Oxford University, South Parks Road, Oxford OX1 3QU, UK
Author for correspondence (e-mail:
pears{at}bioch.ox.ac.uk)
Accepted 6 May 2003
| Summary |
|---|
|
|
|---|
Key words: Superoxide, Cell signalling, Dictyostelium discoideum, Superoxide dismutase
| Introduction |
|---|
|
|
|---|
Recent studies of mammals and some plants have established that reactive
oxygen species (ROS) such as hydrogen peroxide and the superoxide anion are
used by certain cells in the regulation of their function, playing an integral
role in certain signalling networks
(Finkel, 1998
;
Thannickal and Fanburg, 2000
).
In mammalian cells, ROS are produced in response to a variety of extracellular
signals [an exhaustive list is provided by Thannickal and Fanburg
(Thannickal and Fanburg,
2000
)], and are essential for the functioning of many signals, for
example for the mitogenic function of PDGF
(Sundaresan et al., 1995
) and
for NGF-induced neuronal differentiation
(Suzukawa et al., 2000
). In
plants, ROS are produced in response to wounding and infection, leading to the
establishment of systemic immunity (Alvarez
et al., 1998
) via specific gene induction
(Orozco-Cardenas et al.,
2001
). In both mammals and plants ROS are produced by NADPH
oxidase enzymes that appear to have evolved specifically to generate
superoxide from NADPH and molecular oxygen
(Torres et al., 1998
;
Pei et al., 2000
). The
superoxide thus generated has a short half-life, mostly reacting with itself
in a dismutation reaction catalysed by superoxide dismutase to give oxygen and
hydrogen peroxide, which is a more stable molecule. Both superoxide and
peroxide are able to affect protein function by reacting with
sulphur-containing groups, for example, the catalytic cysteine residues of
protein tyrosine phosphatases (Lee et al.,
1998
; Meng et al.,
2002
) and cysteine-rich regions of many transcription factors,
including AP-1 (Puri et al.,
1995
) and p53 (Rainwater et
al., 1995
). Superoxide also inactivates enzymes such as aconitase
that require an Fe/S centre for their activity and also the protein
serine/threonine phosphatase calcineurin that requires a Fe/Zn centre
(Wang et al., 1996
;
Namgaladze et al., 2002
).
Unicellular eukaryotes and bacteria also have signalling intermediates that
respond to ROS; in fact the best-understood ROS-responsive transcription
factors in terms of molecular mechanism are from these systems. In E.
coli the OxyR protein is directly oxidised by hydrogen peroxide to form
an intramolecular disulphide, activating the transcriptional response to
peroxide stress (Zheng et al.,
1998
); and the SoxR protein is activated by oxidation of an Fe/S
centre by superoxide (Hidalgo et al.,
1997
). The Yap1 transcription factor of Saccharomyces
cerevisiae (a homologue of mammalian AP-1) is also activated by peroxide,
in this case by preventing its export from the nucleus
(Delaunay et al., 2000
).
However, these organisms are not known to actively produce ROS as a signalling
function, and they tellingly lack close homologues of the NADPH oxidases of
multicellular eukaryotes. It appears the apparatus required by all organisms
to sense potentially dangerous excess free radicals were utilised at some
stage of evolution as part of a signalling system in which ROS are produced
endogenously in response to a stimulus.
Dictyostelium discoideum is a social amoeba, and as such straddles
the boundary between unicellular and multicellular life. It lives in the soil
as individual amoebae feeding on bacteria, but when food runs out it
aggregates to form a multicellular organism of up to a million or so cells.
This body of cells can travel to a suitable situation where it forms a
fruiting body which consists of a ball of spores supported on a slender stalk.
The spores can be dispersed to more clement surroundings where they germinate,
each releasing a fresh amoeba. Despite obvious major differences between the
development of multicellularity in Dictyostelium and other more
conventional multicellular organisms, the regulatory mechanisms involved
display marked similarities. For example SH2 domains and the STAT family of
transcription factors (which are absent in unicellular fungi such as budding
yeast) are present and play important roles in development
(Kawata et al., 1997
).
We were interested to discover whether the active use of ROS in cellular
regulation that appears to be characteristic of multicellular eukaryotes also
occurs in Dictyostelium. A burst of production of peroxide species
during the early stages of development is evident in catalase-deficient
strains (Fisher et al., 1991
).
This could be indicative of prior generation of superoxide; we sought to
investigate this directly. We established an assay for superoxide production
in Dictyostelium and found it to be produced in significant amounts
during early development. Production could be stimulated by a factor in
conditioned medium from developing cells. Reduction of superoxide levels by
pharmacological or genetic means lead to an inhibition of aggregation. These
data show that superoxide signalling plays an essential role in the transition
from the single to multicellular phases of Dictyostelium.
| Materials and Methods |
|---|
|
|
|---|
Assay for superoxide production
XTT
(2,3-bis-[2-methoxy-4-nitro-5-sulphophenyl]-2H-tetrazolium-5-carboxanilide)
was purchased from Molecular Probes. Stock solutions (10 mM) were prepared in
potassium phosphate buffer when required, or stored at 20°C. For
the assay, XTT was added to developing cells at a concentration of 500 µM,
and incubated for the indicated time. Reaction with superoxide causes the pale
yellow XTT to form its bright orange-coloured formazan, the accumulation of
which can be measured by monitoring its absorbance at 470 nm
(Able et al., 1998
;
Ukeda et al., 1997
). Aliquots
of cells were quickly spun at full speed in a microfuge, and the absorption of
the supernatant measured in a spectrophotometer. XTT reduction in the absence
of cells was always determined as a control and subtracted from the values
seen in the presence of cells, before plotting. When assays were performed in
the presence of conditioned medium, control experiments were carried out to
determine the degree of XTT reduction which was due to the conditioned medium
alone. In general the levels were small (a typical OD reading would be 0.095
with the majority of the reduction occurring within the first minute). These
values were subtracted from the reduction seen in the presence of cells.
Vital staining of cells with rhodamine 123
Rhodamine 123 has been shown to be a marker of actively respiring
mitochondria in Dictyostelium
(Matsuyama and Maeda, 1995
).
Exponentially growing Ax2 cells were washed, resuspended in phosphate buffer
at a density of 2x106 cells/ml. Duplicate samples were
treated for 10 minutes with varying concentrations of rotenone or DMSO carrier
and then for a further 10 minutes with 10 µg/ml rhodamine 123 dissolved in
phosphate buffer. The cells were washed briefly three times in phosphate
buffer and observed by fluorescence microscopy to confirm rhodamine
accumulation in distinct subcellular organelles as expected for mitochondria.
The degree of rhodamine sequestration by actively respiring mitochondria was
determined as the degree of fluorescence, determined using a
spectrofluorimeter (excitation 507 nm, emission 529 nm) as described by
Altenberg et al. (Altenberg et al.,
1994
). The fluorescence of cells labelled with rhodamine 123 in
the absence of rotenone was taken to be 100% and cells treated in the absence
of rhodamine 123 as 0%. The degree of fluorescence in the presence of rotenone
is expressed relative to these.
Cell survival experiments
Cell survival in the presence of superoxide scavengers was determined
essentially as described by Deering et al.
(Deering et al., 1996
).
Exponentially growing Ax2 cells were diluted 1:12 in potassium phosphate
buffer to inhibit cell growth and scavengers added at a range of
concentrations. Following 18 hours of incubation at 22°C and 180 rpm,
cells were serially diluted in phosphate buffer and 300 cells plated on two 15
cm SM agar plates in association with Klebsiella aerogenes. 18 hours
of drug treatment was chosen as it is somewhat longer than the aggregation
assays and so should represent the survival within the aggregation assay.
Plates were incubated at 22°C and colonies counted daily from 3 days. The
survival in the presence of the drug is expressed as a percentage of that seen
in its absence.
Preparation of conditioned medium
Exponentially growing cells were washed three times and resuspended in
potassium phosphate buffer at a density of 2x107/ml and
developed in shaking suspension for 6 hours. The cells were pelletted and the
supernatant filtered through a 0.2 µm syringe filter unit. Medium was used
in experiments immediately.
Generation of cells overexpressing superoxide dismutase
A full-length cDNA was kindly provided by the Japanese cDNA sequencing
consortium. It was amplified by polymerase chain reaction using the primers
GGGAGATCTGAACAAAAATTATTATCAGAAGAAGATTTAAATAGGTTACCTACAAAAG and
CTCCTCGAGTTATTGAGAGAACAATGACACC, in order to incorporate a 5'
BglII restriction site and c-myc tag, and a 3'
XhoI restriction site. The PCR product was purified, digested with
BglII and XhoI, and then ligated into the pAct15-Gal plasmid
(Harwood and Drury, 1990
),
from which the lacZ sequence had been excised using the same
endonucleases. Ax2 cells were transformed with this plasmid
(Pang et al., 1999
), selecting
with 10 µg/ml G418. Initial transformants were then further selected by
growing sequentially in 20, 50 and 100 µg/ml G418.
Preparation of RNA and detection of mRNA species
Total cellular RNA was prepared using the Catrimox-14TM method
(Insall et al., 1996
). 25
µg samples were separated by electrophoresis in a 1% formaldehyde gel and
transferred to a nylon membrane. cDNAs of genes to be probed were randomly
labelled with [
-32P]dCTP (Prime-It® RmT Random Primer
Labelling Kit; Stratagene) and hybridised to the membrane, washed and detected
according to the method of Huang et al.
(Huang and Pears, 1999
).
Western blot
Exponentially growing Ax2 cells and cells overexpressing SodA were lysed
directly into hot SDS sample buffer and resolved by 12% SDS-PAGE. After
transfer to PVDF paper the blot was probed with polyclonal anti-sera raised
against full-length human Cu/Zn superoxide dismutase (FL-154; Santa Cruz
Biotechnology). The blot was then stripped and reprobed sequentially with
monoclonal antibody specific for the human c-myc tag (9E10; Santa Cruz) and
then polyclonal antisera against actin (C-11; Santa Cruz) to confirm equal
protein loading.
| Results |
|---|
|
|
|---|
70% by addition of bovine erythrocyte Cu/Zn superoxide dismutase (SOD)
to the medium (Fig. 1B);
half-maximal inhibition occurs at approximately 1 unit/ml SOD. The remaining
XTT reduction could be due to superoxide-independent reactions, or
superoxide-dependent reduction at sites inaccessible to extracellular SOD,
most notably inside the cell. A comparison of the effect of SOD and the low
molecular mass superoxide scavenger tiron (4,5
dihydroxy-1,3-benzene-disulphonic acid) indicated that the further XTT
reduction is due to superoxide generation at sites not accessible to SOD (data
not shown). In addition, inhibition of intracellular SOD by the chelating
agent sodium diethyldithiocarbamate (DEDTC) stimulates XTT reduction
(Fig. 1C) further supporting
the idea that superoxide generated within the cell can be detected using this
assay. A similar assay, widely used to detect superoxide, uses cytochrome c in
place of XTT (Babior et al.,
1973
|
Clearly developing Dictyostelium cells generate significant
amounts of superoxide anions, but in contrast to the clear peak of peroxide
production in catalase-deficient strains observed by Fisher and co-workers,
superoxide appears to be generated at a constant rate
(Fisher et al., 1991
). Fisher
et al. concluded that the mitochondrial respiratory chain was a major direct
source of ROS. In order to assess the contribution of this source to the
superoxide measured using the XTT assay, the effect of the NADH dehydrogenase
inhibitor rotenone [which was used to disrupt mitochondrial function by Fisher
et al. (Fisher et al., 1991
)]
was measured. A short-term 10 minute assay was used in order to avoid indirect
longer-term effects caused by perturbation of mitochondrial respiration on
general cell function. The maximal inhibition of XTT reduction caused by
rotenone was less than 20% (Fig.
2). Rotenone was shown to be effective in disrupting mitochondrial
function as it reduced the amount of rhodamine 123 sequestered by cells.
Rhodamine 123 is a fluorescent dye that accumulates in actively respiring
mitochondria (Johnson et al.,
1980
). Untreated Ax2 cells were found to sequester rhodamine 123
whereas pretreatment of cells for 10 minutes with even the lowest
concentration of rotenone used, reduced the rhodamine 123 associated with
cells to less than 25% of control levels
(Fig. 2B). Generation of
superoxide at the plasma membrane is also supported by the proportionately
large inhibition of XTT reduction by extracellular SOD
(Fig. 1B). Given the short
half-life of superoxide and its low membrane permeability (reviewed by
Korshunov and Imlay, 2002
) it
is more likely that the superoxide measured in this assay is generated at the
plasma membrane.
|
Mammals and plants contain superoxide-generating NADPH oxidase enzymes in
the plasma membrane that are capable of responding to extracellular factors
(Lambeth et al., 2000
;
Pei et al., 2000
). We wished
to determine if a similar phenomenon was occurring in Dictyostelium.
Aggregating Dictyostelium cells are known to emit, and respond to,
pulses of cAMP that interacts with a cell surface receptor to trigger various
responses, including chemotaxis. The addition of a pulse of cAMP, however, had
no effect on XTT reduction in a short-term assay, suggesting that this does
not stimulate superoxide production (data not shown). A mutant strain lacking
the major adenylyl cyclase active during aggregation, ACA
(Pitt et al., 1992
) caused a
similar level of XTT reduction to the parental strain, confirming that
extracellular cAMP does not play a role in stimulating superoxide production
(data not shown).
In order to determine whether any other factors secreted during aggregation are stimulatory, we prepared conditioned medium from Ax2 cells starved in shaking suspension for 6 hours by centrifugation and filtering of the supernatant. Addition of this conditioned medium to starved cells in the presence of 0.5 mM XTT gave a two-fold stimulation of XTT reduction compared with fresh non-conditioned medium (Fig. 3). Prior heating of the conditioned medium to 80°C destroyed this activity, decreasing this stimulation by about 75%. Thus a heat-labile factor produced by developing cells is able to act in an autocrine manner to increase superoxide generation.
|
Given this inducible generation of ROS similar to that seen in multicellular eukaryotes, we tested whether superoxide might have specific functional roles during development. Fig. 4A shows the effect of five superoxide scavengers SOD, tiron and the three tetrazolium salts MTT, NBT and XTT (the last-named at double the concentration used in the superoxide assay) on aggregation after 12 hours of starvation in their presence. The four low molecular mass scavengers completely prevented aggregation in a dose-dependent manner, while SOD had no discernible effect at any concentration tested. This could be either because the effects of the lower molecular weight molecules were independent of superoxide scavenging, or because of the inability of the relatively large, polar SOD molecule to reach a critical site (for example inside the cell). The dose-dependent inhibition of XTT reduction by MTT, NBT and tiron (Fig. 4B), confirm that these molecules do indeed scavenge superoxide. The large percentage of maximal inhibition compared to maximal inhibition seen by SOD (Fig. 1B) suggests that these molecules are capable of reaching superoxide at sites inaccessible to the enzyme.
|
The failure to aggregate could be because the drugs were toxic to Dictyostelium. However Ax2 cells incubated for 18 hours in the presence of the superoxide scavengers did not show a significant loss of cell viability (Fig. 4C). If anything, the cell number increased in the presence of the tetrazolium salts. One explanation for this may be that the scavengers render the cells insensitive to a starvation-induced withdrawal from the cell cycle. Further evidence that the scavengers were not preventing aggregation purely at the level of toxicity is the density dependence of the effect (Fig. 4D). When the cells were plated for aggregation at high densities, aggregates did form, proving cells to be capable of aggregation at these concentrations of scavenger. Higher concentrations of the drug were required to inhibit aggregation at higher cell densities. These results are consistent with the scavengers lowering the production of, or response to, an extracellular signal that can be restored at high cell density where the level of signal is increased, rather than a general toxic effect. When aggregation occurred, streaming of cells was visible suggesting that the cells were capable of chemotactic movement at these concentrations of drug. It is possible that the rate of movement is reduced but in that case one would expect aggregation at normal cell densities to simply be delayed, not completely inhibited.
From these results we concluded that intracellular superoxide is likely to have some essential function either in the attainment of aggregation competence or in aggregation itself, although it remained possible that the effects on cells observed might be independent of superoxide scavenging.
In order to resolve this doubt, we developed a strategy to overexpress the
Dictyostelium cytosolic SOD enzyme by stable transformation of
amoebae with a construct containing the cDNA encoding the SodA protein
(Garcia et al., 2000
). The
cDNA was courtesy of the Japanese cDNA sequencing consortium
(Morio et al., 1998
), and
expression of the SodA protein, tagged with a c-myc epitope at its N terminus,
was driven by the strong actin15 promoter. Overexpression should decrease the
level of superoxide in the cell without the potential side-effects of the
chemical scavengers. Transformants were selected by resistance to G418 as the
transforming plasmid carried the resistance gene, and expression of the
myc-tagged protein was confirmed by western blot
(Fig. 5A). Polyclonal anti-sera
raised against human SOD interacted with a protein precisely co-migrating with
the myc-tagged protein. A doublet is detected in the SOD-OE cells with the
upper band co-migrating with the anti-myc reactive band. The smaller band
seems likely to be SOD protein from which the myc tag has been cleaved as it
co-migrates with the band which reacts with the anti-SOD antisera in Ax2
cells. This lower band (slightly smaller than the human one detected in the
control Jurkat cell lysate, as expected from the predicted molecular masses)
is detectable at lower levels in Ax2 cells. This is consistent with the
antisera cross-reacting with the Dictyostelium SOD which is
overexpressed in the SOD-OE cells.
|
Increasing the concentration of G418 in a pool of transformed cells has
been shown to increase expression of transgenes associated with the neomycin
resistance gene (Simon et al.,
1989
). Selection of cells transformed with the SOD-OE construct
with increasing concentrations of G418 progressively decreased the amount of
superoxide detected in developing cells with the XTT assay
(Fig. 5B). This confirms that
XTT reduction is measuring superoxide production and that overexpression of
SOD reduces the levels of superoxide. Cells selected at high concentrations of
G418 (50 or 100 µg/ml) showed no reduction in growth rate compared to
parental Ax2 cells and a transformation control, suggesting that SOD
overexpression is not generally toxic to the cells
(Fig. 6A). The SOD-OE cells
appeared healthy when viewed under the microscope (data not shown). However,
the cells do show an aggregation-minus (agg) phenotype on agar plates
after growth on a lawn of Klebsiella aerogenes (data not shown). The
agg phenotype was confirmed by developing the SOD-OE cells both on
filters (data not shown) and buffered agar
(Fig. 6B) where SOD-OE cells
failed to form aggregates at cell densities at which control cells could. The
SOD-OE cells could form aggregates when plated at high cell densities, again
showing that the cells were viable and capable of movement. The higher the
concentration of G418 used for selection and therefore the lower the levels of
superoxide produced, the higher the cell density required to see aggregates
forming on buffered agar. Again, these results are consistent with superoxide
acting in a signalling role, rather than that the overexpression has a general
toxic effect on the cells. This provides further strong support for the idea
that intracellular superoxide plays an essential role in early
Dictyostelium development.
|
The course of Dictyostelium development is marked by successive
changes in gene expression, with the induction of certain genes being
necessary for the progression through each stage. In order to gain insight
into the developmental defect of the SOD-overexpressing cells, the time-course
of expression of a number of developmentally regulated genes was examined by
northern blot (Fig. 7). While
some genes, for example pkaC, which encodes the PKA catalytic
subunit, show a normal increase in expression upon starvation, a set of genes
showed greatly decreased expression in the SOD-overexpressing cells. This set
included the genes encoding ACA, cAR1 (the major early cAMP receptor), PDE
(the extracellular cAMP phosphodiesterase), and discoidin I. The last-named
gene shows the greatest disparity between the SOD-overexpressor and its
parent, because it is very strongly expressed in parental strains during early
development, increasing in the first few hours from its lower growth-phase
level. Strikingly discoidin I mRNA was barely detectable in the
SOD-overexpressor during growth; at this stage the level of its expression is
controlled by the secreted protein prestarvation factor (PSF), as are the
levels of cAR1 and PDE (Rathi et al.,
1991
; Rathi et al., 1992). The increase in discoidin expression
subsequent to starvation is predominantly in response to a second secreted
protein, conditioned medium factor (CMF)
(Gomer et al., 1991
); the
later increases in PDE and cAR1 expression are induced by cAMP. These gene
expression data raised the possibility that the SOD-overexpressing strain is
defective in the production of, or response to, one of these factors secreted
in early development.
|
Pulsing the cells with extracellular cAMP, which rescues the defect of many
aggregation-deficient strains such as those lacking cAR1
(Saxe et al., 1991
), had no
effect on the aggregation of the SOD-OE cells (data not shown). However,
development of the SOD-OE cells in conditioned medium prepared from starving
AX2 cells resulted in the formation of aggregates
(Fig. 8). It had been found
that this conditioned medium was able to stimulate superoxide generation
(Fig. 3); this stimulation was
markedly reduced by heat treatment, and again heating medium to 80°C for
20 minutes decreased its ability to rescue development as aggregates were not
formed in its presence. Conditioned medium prepared from SOD-OE cells starved
for 6 hours was also able to rescue the aggregation defect of freshly starved
SOD-OE cells. This suggests that overexpression of SOD, and thus decreased
superoxide levels, may inhibit the production or secretion of some factor or
reduce the response to it, such that a higher concentration, accumulated over
6 hours, is required. The heat lability of the factor is inconsistent with its
being identical to CMF, and accordingly purified recombinant CMF has no effect
on superoxide production (data not shown). PSF is heat labile, as is the
little studied differentiation stimulating factor (DSF) reported by Klein et
al. (Klein et al., 1976). Neither of these factors has been purified, so their
involvement in the phenomena describe here remain to be tested.
|
| Discussion |
|---|
|
|
|---|
An excellent candidate for a source of superoxide anions within the plasma
membrane would be an NADPH oxidase enzyme similar to those found in animals
and plants (Henderson and Chappell,
1996
; Lambeth et al.,
2000
; Torres et al.,
1998
). While certain of these enzymes appear to be constitutively
active at a low level, the activities of others are markedly stimulated by
specific stimuli from outside the cell
(Suh et al., 1999
;
Pei et al., 2000
;
Banfi et al., 2001
). We found
that superoxide generation by Dictyostelium cells could be rapidly
stimulated by a heat-labile factor produced by developing cells. This
stimulation occurred within 10 minutes, and thus probably reflects an increase
in activity of an existing enzyme rather than the synthesis of new protein.
The identity of this factor remains uncertain. The described properties of the
protein factors PSF and DSF (which may be identical) make them candidates;
however neither has been fully characterised and so their involvement has not
been tested. CMF, which is heat-stable, does not stimulate superoxide
generation; nor does cAMP phosphodiesterase (G.B. and C.P., unpublished),
another factor secreted by developing cells, which is heat-labile and
essential for development (Wu et al.,
1995
).
The best candidate for an enzyme to generate superoxide is a homologue of
human NADPH oxidases. Searches of databases of Dictyostelium genomic
and cDNA sequences (Kreppel and Kimmel,
2002
; Morio et al.,
1998
) have revealed at least three homologues of the NADPH oxidase
flavocytochrome subunit, at least one of which is expressed most strongly
during the first few hours of development (G.B. and C.P., unpublished). [The
sequence of this gene is accessible in GenBank, accession no. AF123275; for a
dendrogram displaying the relationship of its sequence with various metazoan
homologues see Cheng et al. (Cheng et al.,
2001
).] Membrane preparations from freshly starved amoebae contain
an NADPH oxidase activity that is inhibited by the flavoprotein inhibitor,
diphenyliodonium (G.B. and C.P., unpublished), consistent with such an enzyme
being a source of superoxide in Dictyostelium.
Whatever the source, we found that superoxide is necessary for normal Dictyostelium development to occur. Three different tetrazolium compounds, and the phenolic compound tiron, were all found to decrease the amount of detectable superoxide in a dose-dependent manner, and above threshold concentrations to inhibit the aggregation of amoebae that is the first visible stage of development. These concentrations of scavengers did not lead to any reduction in cell viability so the failure to aggregate is unlikely to be due to general toxicity. Also if the cells were plated at high cell densities, then aggregation did occur indicating that the cells were still capable of cell movement and cellular responses in the presence of the drugs. These results are consistent with the scavengers leading to a reduction in production of, or response to, an extracellular signal which can be overcome at high cell densities where higher concentrations of signal are available, rather than a general toxic effect. Superoxide dismutase added to the medium decreased the amount of superoxide detected, but had no effect on aggregation. Thus either the pharmacological reagents reach sites inaccessible to SOD or their effect on development is unrelated to their ability to scavenge superoxide. As tiron is structurally distinct from the related tetrazolium compounds it seems unlikely that all four would have a common second target. However when superoxide dismutase levels in the cytoplasm were increased by the expression of the native Cu/Zn SOD gene under the control of a strong constitutive promoter, aggregation was inhibited. The clear implication of these results is that intracellular, but not extracellular, superoxide has a necessary role in development.
The possible molecular causes for this defective phenotype were
investigated by examining the expression of a number of genes differentially
regulated in the first hours of development. Comparison of the SOD-OE strain
with its normally developing parent revealed clear differences in expression
in a number of these genes. The most strongly affected was the discoidin I
mRNA (Blusch et al., 1995
). In
SOD-OE cells, discoidin I mRNA is barely detectable in growing cells, and not
induced at all after starvation. The mRNAs encoding PDE and cAR1 are also
markedly underexpressed in these cells. The expression of these three genes is
induced during late growth and early development by the secreted protein PSF,
noted above as a candidate for the factor present in conditioned medium that
stimulates superoxide generation. In the light of this potential connection,
we tested the effect of developing SOD-OE cells in conditioned medium. In
these conditions, the level of detectable superoxide was restored to near
wild-type levels, and aggregates were formed. Conditioned medium from
6-hour-starved SOD-OE cells was also able to rescue the aggregation of freshly
starved SOD-OE cells; heat-treated medium could not. This indicates that the
developmental defect of these cells results from a deficient response to a
factor that promotes the attainment of aggregation competence or from an
inability to produce this factor.
The phenotype of cells overexpressing cytosolic SOD has a number of
similarities with mutants lacking the dual-specificity protein kinase YakA.
This mutant also fails to express early developmental genes, and does not
aggregate (Souza et al., 1998
)
when grown in association with bacteria on an agar plate. YakA is thought to
function as a key downstream regulator of heterotrimeric G-proteins; and
mutations in the G-protein ß and
4 subunits share a small plaque
phenotype with yaka (van
Es et al., 2001
) and SOD-OE cells (G.B. and C.P.,
unpublished).
This study has demonstrated that a superoxide-dependent signal is necessary
for the initiation of development in Dictyostelium. Previous studies
have pointed to the important roles ROS can play in developmental processes in
animals, for example in the Drosophila eye
(Morey et al., 2001
), and in
mammalian glial and neuronal cells (Smith
et al., 2000
; Suzukawa et al.,
2000
) and also in plants in the formation of cotton fibres
(Potikha et al., 1999
). Our
observations extend the range of organisms that utilise such redox-mediated
signals to the protozoa. Inhibition of ROS-dependent signalling events effect
the transition from the unicellular to multicellular phase of
Dictyostelium, suggesting the evolution of the use of superoxide
signalling in response to extracellular factors arose with multicellularity.
The amenability of Dictyostelium to genetic study and the imminent
completion of the sequencing of its genome should provide ample opportunity
for further study of the mechanisms involved in such signalling.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Able, A., Guest, D. and Sutherland, M. (1998).
Use of a new tetrazolium-based assay to study the production of superoxide
radicals by tobacco cell cultures challenged with avirulent zoospores of
Phytophthora parasitica var nicotanae. Plant
Physiol. 117,491
-499.
Altenberg, G., Vanoye, C., Horton, J. and Reuss, L.
(1994). Unidirectional fluxes of rhodamine 123 in multidrug
resistant cells: evidence against direct drug extrusion from the plasma
membrane. Proc. Natl. Acad. Sci. USA
91,4654
-4657.
Alvarez, M., Pennell, R., Meijer, P.-J., Ishikawa, A., Dixon, R. and Lamb, C. (1998). Reactive oxygen intermediates mediate a systematic signal network in the establishemnt of plant immunity. Cell 92,773 -784.[CrossRef][Medline]
Babior, B., Kipnes, R. and Curnette, J. (1973). Biological defence mechanisms: the production by leukocytes of superoxide, a potential bactericidal agent. J. Clin. Invest. 52,741 -744.[Medline]
Banfi, B., Monar, G., Maturama, A., Seger, K., Hegedus, B.,
Demaurex, N. and Krause, K. (2001). A
Ca2+-activated NADPH oxidase in testis, spleen and lymph nodes.
J. Biol. Chem. 276,37594
-37601.
Blusch, J., Alexander, S. and Nellen, W. (1995). Multiple signal transduction pathways regulate discoidin I gene expression in Dictyostelium discoideum.Differentiation 58,253 -260.[CrossRef][Medline]
Cheng, G., Cao, Z., Xu, X., van Meir, E. and Lambeth, J. (2001). Homologues of gp91phox: cloning and tissue expression of Nox3, Nox4 and Nox5. Gene 269,131 -140.[CrossRef][Medline]
Deering, R., Guyer, R., Stevens, L. and Watson-Thais, T. (1996). Some repair-deficient mutants of Dictyostelium discoideum display enhanced susceptibilities to bleomycin. Antimicob. Agents Chemother. 40,464 -467.[Abstract]
Delaunay, A., Isnard, A. and Toledano, M. (2000). H2O2 sensing through oxidation of the yap1 transcription factor. EMBO J. 19,5157 -5166.[CrossRef][Medline]
Finkel, T. (1998). Oxygen radicals and signalling. Curr. Opp. Cell Biol. 10,248 -253.[CrossRef][Medline]
Fisher, P., Karampetsos, P., Wilczynska, Z. and Rosenberg, L. (1991). Oxidative metabolism and heat shock-enhanced chemiluninescence in Dictyostelium discoideum. J. Cell Sci. 99,741 -750.
Garcia, M., Foote, C., van Es, S., Devreotes, P., Alexander, S. and Alexander, H. (2000). Differential developmental expression and cell type-specificity of Dictyostelium catalases and their response to oxidative stress and UV light. Biochim. Biophys. Acta 1492,295 -310.[Medline]
Gomer, R. H., Yuen, I. S. and Firtel, R. A. (1991). A secreted 80 x 10(3) Mr protein mediates sensing of cell density and the onset of development in Dictyostelium.Development 112,269 -278.[Abstract]
Harwood, A. and Drury, L. (1990). New vectors
for expression of the E. coli lacZ gene in Dictyostelium.Nucl. Acids Res. 18,4292
.
Henderson, L. and Chappell, J. (1996). NADPHoxidase of neutrophils. Biochim. Biophys. Acta 1273,87 -107.[Medline]
Hidalgo, E., Ding, H. and Demple, B. (1997). Redox signal transduction via iron-sulphur clusters in the SoxR transcription activator. Trends Biochem. Sci. 22,207 -210.[CrossRef][Medline]
Huang, H.-J. and Pears, C. (1999). Cell cycle-dependent regulation of early developmental genes. Biochim. Biophys. Acta 1452,296 -302.[Medline]
Insall, R., Borleis, J. and Devreotes, P. (1996). The aimless rasGEF is required for processing of chemotactic signals through G protein coupled receptors in Dictyostelium.Curr. Biol. 6,719 -729.[CrossRef][Medline]
Johnson, L., Walsh, M. and Chen, L. (1980).
Localization of mitochondria in living cells with rhodamine 123.
Proc. Natl. Acad. Sci. USA
77,990
-994.
Kawata, T., Shevchenko, A., Fukuzawa, M., Jermyn, K., Totty, N., Zhukovskaya, N., Sterling, A., Mann, M. and Williams, J. (1997). SH2 signalling in a lower eukaryote: a STAT protein that regulates stalk cell differentiation in Dictyostelium.Cell 89,909 -916.[CrossRef][Medline]
Klein, C. and Darmon, M. (1976). A
differentiation stimulating factor induces cell sensitivity to cyclic AMP
pulses in Dictyostelium. Proc. Natl. Acad. Sci. USA
73,1250
-1254.
Korshunov, S. and Imlay, J. (2002). A potential role for periplasmic superoxide dismutase in blocking penetration of external superoxide into the cytosol of gram-negative bacteria. Mol. Microbiol. 43,95 -106.[CrossRef][Medline]
Kreppel, L. and Kimmel, A. (2002). Genomic
database resources for Dictyostelium discoideum. Nuc. Acids
Res. 30,84
-86.
Lambeth, J., Cheng, G., Arnold, R. and Edens, W. (2000). Novel homologues of gp91phox. Trends Biochem Sci. 25,459 -461.[CrossRef][Medline]
Lee, S.-R., Kwon, K.-S., Kim, S.-R. and Rhee, S.
(1998). Reversible inactivation of protein tyrosine phosphatase
1B in A431 cells stimulated with epidermal growth factor. J. Biol.
Chem. 273,15366
-15372.
Matsuyama, S. and Maeda, Y. (1995). Involvement of cyanide-resistant respiration in cell-type proportioning during Dictyostelium development. Dev. Biol. 172,182 -191.[CrossRef][Medline]
Meng, T. C., Fukada, T. and Tonks, N. (2002). Reversible oxidation and inactivation of protein tyrosine phosphatases in vivo. Mol. Cell, 9,387 -399.[CrossRef][Medline]
Morey, M., Serras, F., Baguna, J., Hafen, E. and Corominas, M. (2001). Modulation of the Ras/MAPK signalling pathway by the redox function of selenoproteins in Drosophila melanogaster.Dev. Biol. 238,145 -156.[CrossRef][Medline]
Morio, T., Urushihara, H., Saito, T., Ugawa, Y., Mizuno, H., Yoshida, M., Yoshino, R., Mitra, B., Pi, M., Sato, T., Takemoto, K., Yasukawa, H., Williams, J., Maeda, M., Takeuchi, I., Ochiai, H. and Tanaka, Y. (1998). The Dictyostelium developmental cDNA project: generation and analysis of expressed sequence tags from the first finger stage of development. DNA Res. 5, 335-340.[Abstract]
Namgaladze, D., Nanga, D., Hofer, W. and Ullrich, V.
(2002). Redox control of calcineurin by targetting the binuclear
Fe2+-Zn2+ center at the enzyme active site. J. Biol.
Chem. 277,5962
-5969.
Orozco-Cardenas, M., Narvaez-Vasquez, J. and Ryan, C.
(2001). Hydrogen peroxide acts as a second messenger for the
induction of defence genes in tomato plants in response to wounding, systemin
and methyl jasmonate. The Plant Cell
13,179
-191.
Pang, K., Lynes, M. and Knecht, D. (1999). Variables controlling the expression level of exogenous genes in Dictyostelium. Plasmid 41,187 -197.[CrossRef][Medline]
Pei, Z., Murata, Y., Benning, G., Thomine, S., Klusener, B., Allen, G., Grill, E. and Schroeder, J. (2000). Calcium channels activated by hydrogen peroxide mediate abscisic acid signalling in guard cells. Nature 406,731 -734.[CrossRef][Medline]
Pitt, G., Milona, N., Borleis, J., Lin, K., Reed, R. and Devreotes, P. (1992). Structurally distinct and stage-specific adenylyl cyclase genes play different roles in Dictyostelium development. Cell 69,305 -315.[CrossRef][Medline]
Potikha, T., Collins, C., Johnson, D., Delmer, D. and Levine,
A. (1999). The involvement of hydrogen peroxide in the
differentiation of secondary walls in cotton fibres. Plant
Physiol. 119,849
-858.
Puri, P., Avantaggiati, M., Burgio, V., Chirillo, P.,
Collepardo, D., Natoli, G., Balsano, C. and Levrero, M.
(1995). Reactive oxygen intermediates mediate angiotensin
II-induced c-Jun.c-Fos heterodimer DNA binding activity and proliferative
hypertophic responses in myogenic cells. J. Biol.
Chem. 270,22129
-22134.
Rainwater, R., Parks, D., Anderson, M., Tegtmeyer, P. and Mann, K. (1995). Role of cysteine residues in regulation of p53 function. Mol. Cell. Biol. 15,3892 -3903.[Abstract]
Rathi, A. and Clarke, M. (1992). Expression of early developmental genes in Dictyostelium discoideum is initiated during exponential growth by an autocrine-dependent mechanism. Mech. Dev. 36,173 -182.[CrossRef][Medline]
Rathi, A., Kayman, S. C. and Clarke, M. (1991). Induction of gene expression in Dictyostelium by prestarvation factor, a factor secreted by growing cells. Dev. Genet. 12,82 -87.[CrossRef][Medline]
Saxe, C., Johnson, R. L., Devreotes, P. N. and Kimmel, A. R. (1991). Expression of a cAMP receptor gene of Dictyostelium and evidence for a multigene family. Genes Dev. 5,1 -8.[Medline]
Simon, M. N., Driscoll, D., Mutzel, R., Part, D., Williams, J. and Veron, M. (1989). Overproduction of the regulatory subunit of the cAMP-dependent protein kinase blocks the differentiation of Dictyostelium discoideum. EMBO J. 8,2039 -2043.[Medline]
Smith, J., Ladi, E., Mayer-Proschel, M. and Noble, M.
(2000). Redox state is a central modulator of the balance between
self-renewal and differentiation in a dividing glial precursor cell.
Proc. Natl. Acad. Sci. USA
97,10032
-10037.
Souza, G., Lu, S. and Kuspa, A. (1998). YakA, a protein kinase required for the transition from growth to development in Dictyostelium. Development 125,2291 -2302.[Abstract]
Suh, Y., Arnold, R., Lassegue, B., Shi, J., Xu, X., Sorescu, D., Chung, A., Griendling, K. and Lambeth, J. (1999). Cell transformation by the superoxide-generating oxidase Mox1. Nature 401,79 -82.[CrossRef][Medline]
Sundaresan, M., Yu, Z., Ferrans, V., Irani, K. and Finkel,
T. (1995). Requirement for generation of
H2O2 for platelet derived growth factor signal
transduction. Science
270,296
-299.
Sussman, M. (1987). Cultivation and synchronous morphogenesis of Dictyostelium under controlled experimental conditions. Methods Cell Biol. 28, 9-29.[Medline]
Suzukawa, K., Miura, K., Mitsushita, J., Resau, J., Hirose, K.,
Crystal, R. and Kamata, T. (2000). Nerve growth
factor-induced neuronal differentiation requires generation of Rac1-regulated
reactive oxygen species. J. Biol. Chem.
275,13175
-13178.
Thannickal, V. and Fanburg, B. (2000). Reactive
oxygen species in cell signalling. Am. J. Physiol. Lung Cell Mol.
Physiol. 279,L1005
-1028.
Torres, M., Onouchi, H., Hamada, S., Machida, C., Hammond-Kosack, K. and Jones, J. (1998). Six Arabidopsis thaliana homologues of the human respiratory burst oxidase (gp91phox). Plant J. 14,365 -370.[CrossRef][Medline]
Ukeda, H., Maeda, S., Ishii, T. and Sawamura, M. (1997). Spectrophotometric assay for superoxide dismutase based on tetrazolium salt reduction by xanthine-xanthine oxidase. J. Anal. Biochem. 251,206 -209.[CrossRef][Medline]
van Es, S., Weening, K. and Devreotes, P.
(2001). The protein kinase yakA regulates G-protein-linked
signalling responses during growth and development of Dictyostelium.J. Biol. Chem. 276,30761
-30765.
Wang, X., Culotta, V. and Klee, C. (1996). Superoxide dismutase protects calcineurin from inactivation. Nature 383,434 -437.[CrossRef][Medline]
Wu, L., Franke, J., Blanton, R., Podgorski, G. and Kessin, R. (1995). The phosphodiesterase secreted by prestalk cells is necessary for Dictyostelium morphogenesis. Dev. Biol. 167,1 -8.[CrossRef][Medline]
Zheng, M., Aslund, F. and Storz, G. (1998).
Activation of the OxyR transcription factor by reversible disulphide bond
formation. Science 279,1718
-1721.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
Related articles in JCS:
This article has been cited by other articles:
![]() |
S. Veeranki, B. Kim, and L. Kim The GPI-anchored superoxide dismutase SodC is essential for regulating basal Ras activity and for chemotaxis of Dictyostelium discoideum J. Cell Sci., September 15, 2008; 121(18): 3099 - 3108. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Araki, J. Langenick, M. Gamper, R. A. Firtel, and J. G. Williams Evidence that DIF-1 and hyper-osmotic stress activate a Dictyostelium STAT by inhibiting a specific protein tyrosine phosphatase Development, April 1, 2008; 135(7): 1347 - 1353. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Takemoto, A. Tanaka, and B. Scott A p67Phox-Like Regulator Is Recruited to Control Hyphal Branching in a Fungal-Grass Mutualistic Symbiosis PLANT CELL, October 1, 2006; 18(10): 2807 - 2821. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Buetler, A. Krauskopf, and U. T. Ruegg Role of Superoxide as a Signaling Molecule Physiology, June 1, 2004; 19(3): 120 - 123. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||