|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 22 July 2003
doi: 10.1242/jcs.00675
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
1 EDMNS/DB, NIDDK, NIH, 8 Center Dr MSC 0842, Bethesda, MD 20892-0842, USA
2 German Institute for Human Nutrition, Arthur-Scheuner-Allee 114-116, 14558
Bergholz-Rehbrucke, Germany
3 Lundberg Laboratory for Diabetes Research, Department of Internal Medicine,
The Sahlgrenska Academy at Gothenburg University, SE-413 45 Gothenburg,
Sweden
* Author for correspondence (e-mail: sam_cushman{at}nih.gov)
Accepted 19 May 2003
| Summary |
|---|
|
|
|---|
Key words: PKB/Akt, GLUT4, Translocation, Phosphorylation
| Introduction |
|---|
|
|
|---|
Until recently, a reasonably consistent picture has emerged regarding the
mechanism of activation of Akt. In the case of insulin action, PI3-kinase is
activated, enhancing the concentration of
phosphatidylinositol-3,4,5,-trisphosphate
(PtdIns(3,4,5)P3) in the plasma membrane and inducing the
binding of Akt through its N-terminal PH domain
(Alessi et al., 1997
;
Stokoe et al., 1997
). This
binding reaction exposes the Akt to constitutively active PDK-1 in the plasma
membrane which phosphorylates Thr309 in Akt2, Thr308 in
Akt1, leading through an unknown mechanism to phosphorylation of Ser
474 and activation of the Akt kinase activity. Signaling is then
prorogated to GLUT4 translocation through a further series of unknown
steps.
Multiple questions have recently been raised, however, regarding the early
stages in Akt activation. One work using isolated human adipose cells suggests
that Thr309 phosphorylation of PDK-1 takes place in an
intracellular compartment associated with the low-density microsomes and that
subsequent translocation of the Thr309-phosphorylated Akt to the
plasma membrane is associated with subsequent Ser474
phosphorylation and activation (Carvalho et
al., 2000
). Additional reports argue the case for the activity of
a distinct Ser474 kinase in the plasma membrane as against a
Ser474 autophosphorylation reaction by Akt itself, both requiring
prior Thr309 phosphorylation
(Hill et al., 2001
;
Hill et al., 2002
;
Andjelkovic et al., 1997
).
Furthermore, two recent studies support the concept that Ser474
phosphorylation does not require prior Thr309 phosphorylation, one
employing stem cells from a PDK-1 knockout mouse
(Williams et al., 2000
) and
the other, a PDK-1 inhibitor (Hill et al.,
2001
). Finally, a study of isolated rat adipose cells suggests
that Ser474 is the primary phosphorylation site in response to
insulin and that Thr309 is only marginally phosphorylated
(Goransson et al., 2002
). A
corollary question relates to the relationship between Akt activation and
GLUT4 translocation; one report purports to demonstrate the recruitment of
PI3-kinase (Heller-Harrison et al.,
1996
) and another, the recruitment of Akt2 itself to the
GLUT4-containing vesicles in response to insulin
(Calera et al., 1998
;
Kupriyanova and Kandror,
1999
).
In collaboration with M. J. Quon and S. I. Taylor, we have developed a
transfection technique which permits expression of exogenous GLUT4 tagged with
an exofocial HA epitope detectable on the cell surface using an antibody
binding assay. The subcellular trafficking of this HA-GLUT4 construct is
indistinguishable from endogenous GLUT4
(Quon et al., 1994
). We have
further characterized HA-GLUT4 constructs in which GFP has been fused to
either the N or C terminus; the subcellular trafficking of HA-GLUT4-GFP, the
C-terminal construct, is also indistinguishable from endogenous GLUT4, whereas
fusion of GFP to the N terminus of GLUT4 leads to a primarily plasma membrane
localization (Dawson et al.,
2001
).
In the present study, we have fused the kinase domain of Akt2-wt (wild type) and various Akt2 mutants to the C terminus of HA-GLUT4 in order to investigate the activity, phosphorylation state and subcellular localization of Akt2 specifically targeted to the GLUT4-trafficking pathway. We observed that the HA-GLUT4-Akt2-wt, but not the HA-GLUT4-Akt2-KD (K179A), spontaneously associates with the plasma membrane in a manner similar to the response to insulin and becomes phosphorylated on Ser474, but not Thr309. HA-GLUT4-Akt2-KD translocates normally with insulin and becomes phosphorylated on Ser474 in response to insulin, but is still not phosphorylated on Thr309. HA-GLUT4-Akt2-wt, but not HA-GLUT4-Akt2-KD, stimulates the translocation of cotransfected myc-GLUT4. These data suggest that targeting Akt2 to the GLUT4-trafficking pathway induces Akt2 activation and GLUT4 translocation. Ser474 phosphorylation is an autocatalytic reaction requiring an active kinase, and kinase activity is associated with a plasma membrane localization. Fusion of Akt2 to the C terminus of GLUT4 appears to substitute for Thr309 phosphorylation in activating the autocatalytic process.
While this work was in progress, the Tarvare laboratory published a report
of a similar project using morphological rather than biochemical assays, and
3T3-L1 adipocytes rather than primary rat adipose cells
(Ducluzeau et al., 2002
). The
results of that study are substantially different than our results for unknown
reasons, however, our work further focuses on the relationship between
phosphorylation state and subcellular localization of GLUT4-targeted Akt2, a
problem not addressed in the Tavare paper.
| Materials and Methods |
|---|
|
|
|---|
PH-Akt2 with
5'-NcoI and 3' blunt ends. The HA-GLUT4-NheI(CT)
(GLUT4 containing NheI site in the C terminus) in pCIS2 was digested
with NheI and HpaI to generate the vector fragment for
subcloning. To fuse the NcoI end of
PH-Akt2 inserts to the
NheI end of HA-GLUT4 vector an oligonucleotide adapter
(NheI-NcoI: 5' CTAGCGGGGCCGGGGCCGGGGC 3' forward
and 5' CATGGCCCCGGCCCCGGCCCCG 3' reverse) was used. The
PH-Akt2-wt,
PH-Akt2-DE,
PH-Akt2-KD and
PH-Akt2-A3
were then fused in-frame to HA-GLUT4 in pCIS2 using NheI and
HpaI (blunt) sites to generate HA-GLUT4-Akt2-wt, HA-GLUT4-Akt2-DE,
HA-GLUT4-Akt2-KD and HA-GLUT4-Akt2-A3. HA-GLUT4-Akt2-S474A and
HA-GLUT4-Akt2-T309A mutants were generated by site-directed mutagenesis using
the QuickChange kit according to manufacturer's instructions (Stratagene, La
Jolla, CA), and mutations were confirmed by BigDye sequencing. Construction of
the HA-tagged GLUT4 and dominant-negative K44A dynamin1 in pCIS2 has been
described previously (Quon et al.,
1994
Cell culture and transfection of rat adipose cells
Preparation of isolated rat epididymal adipose cells from male rats (CD
strain, Charles River Breeding Laboratories, Inc.) was performed as described
previously (Quon et al.,
1994
). Isolated cells were washed twice with Dulbecco's modified
Eagle's medium containing 25 mM glucose, 25 mM Hepes, 4 mM L-glutamine, 200 nM
N6-(2-phenylisopropyl)-adenosine, and 75 µg/ml gentamycin, and resuspended
to a cytocrit of 40% (5-6x106 cells/ml). 200 µl of the
cell suspension were added to 200 µl of Dulbecco's modified Eagle's medium
containing 100 µg of carrier DNA (sheared herring sperm DNA; Boehringer
Mannheim) and expression plasmids as indicated. The total concentration of
plasmid DNA in each cuvette was adjusted to 1 µg/cuvette for HA-GLUT4-Akt2
fusion proteins and 4.5 µg/cuvette for dominant-negative K44A dynamin1. In
experiments where myc-GLUT4 and HA-GLUT4-Akt2 fusion proteins were
cotransfected the total concentration of plasmid DNA in each cuvette was
adjusted to 0.2 µg/cuvette and 0.5 µg/cuvette, respectively.
Electroporation was carried out in 0.4-cm gap-width cuvettes (Bio-Rad) using a
T810 square wave pulse generator (BTX). After applying three pulses (12
mseconds, 200 V), the cells were washed once in Dulbecco's modified Eagle's
medium, pooled in groups of 4-10 cuvettes, and cultured at 37°C, 5%
CO2 in Dulbecco's modified Eagle's medium containing 3.5% bovine
serum albumin.
Cell-surface antibody binding assay
Rat adipose cells were harvested 20-24 hours post-transfection and washed
in Krebs-Ringer bicarbonate Hepes buffer, pH 7.4, 200 nM adenosine (KRBH
buffer) containing 5% bovine serum albumin. The cells from individual cuvettes
were transferred into 1.5 ml microcentrifuge tubes. After stimulation with 67
nM (1x104 microunits/ml) insulin for 30 min at 37°C,
subcellular trafficking of GLUT4 was stopped by the addition of 2 mM KCN. All
of the following steps were performed at room temperature. A monoclonal
anti-HA antibody (HA.11, Berkeley Antibody Co.) or anti-myc antibody (Santa
Cruz) was added at a dilution of 1:1000 or 1:10, respectively, and the cells
were incubated for 1 hour. Excess antibody was removed by washing the cells
three times with KRBH, 5% bovine serum albumin. Then 0.1 µCi of
125I sheep anti-mouse antibody (Amersham Pharmacia Biotech) was
added to each reaction, and the cells were incubated for 1 hour. Finally, the
cells were spun through dinonylphtalate oil to remove the unbound antibody,
and the cell surface-associated radioactivity was counted in a
-counter. The resulting counts were normalized to the lipid weight of
the samples (Weber et al.,
1998
). Unless stated otherwise, the values obtained for
pCIS-transfected cells were subtracted from all other values to correct for
nonspecific antibody binding. Antibody binding assays were performed in
duplicate or triplicate.
Membrane isolation and subcellular fractionation
Transfected cells were harvested after 20 hours of incubation. Crude total
membrane fractions were prepared essentially as described previously
(Chen et al., 1997
).
Homogenization and subcellular fractionation of adipose cells were carried out
according to the method of Simpson et al.
(Simpson et al., 1983
).
Briefly, cells were washed twice with TES buffer (25 mM Tris-HCl, 250 mM
sucrose, 2 mM EDTA, pH 7.4) containing 0.12 mM
4-(2-aminoethyl)-benzenesulphonyl fluoride, 10 g/ml aprotinin, and 10 g/ml
leupeptin at 18°C, and homogenized with a Potter-Elvehjem teflon pestle.
Subcellular membrane fractions, plasma membranes (PM), high-density microsomes
(HDM), and low-density microsomes (LDM), were obtained by differential
centrifugation.
Immunoblotting to detect expression of HA-GLUT4-Akt2 as well as
Ser473- and Thr308-phosphorylated HA-GLUT4-Akt2 fusion
proteins
Immunoblot analysis of HA-GLUT4-Akt2 fusion proteins was performed with a
monoclonal anti-HA antibody (1:1000 dilution) and a polyclonal anti-serum
against Akt-phospho-Ser473 or Thr308 (1:750 dilution).
The crude total membrane or fractions were separated by SDS-polyacrylamide gel
electrophoresis and transferred to nitrocellulose filters, and the filters
were then incubated with 0.2 µCi/ml 125I-labeled protein A.
HA-GLUT4-Akt2 and Ser474- or Thr309-phosphorylated
HA-GLUT4-Akt2 fusion proteins were detected using anti-HA antibody and
anti-Akt-phospho-Ser474 or Thr308-specific antibodies,
respectively, following the manufacturer's protocols. The signals of HA-GLUT4
and HA-GLUT4-Akt2 fusion proteins were quantified using Image Gauge V3.12,
Science lab 98 (Fuji Photo Film Co., Ltd).
| Results |
|---|
|
|
|---|
|
GLUT4-targeted Akt2-wt is phosphorylated on Ser474, but
not Thr309 in the basal state, while kinase-dead Akt2 is only
Ser474 phosphorylated in response to insulin
To address whether the Thr309 and Ser474 residues are
phosphorylated when Akt2 is targeted to the GLUT4-trafficking pathway, total
cell membrane proteins were isolated from adipose cells transfected with
HA-GLUT4-Akt2 fusion proteins and immunoblotted with
anti-Akt1-phospho-Ser473 and -Thr308. As shown in
Fig. 2,
phospho-Ser474 signals for both the fusion proteins (
95 kDa)
and endogenous Akt2 (
62 kDa) are detected. HA-GLUT4-Akt2-wt is
phosphorylated on Ser474 in the basal state, with no further
increase in response to insulin, and this Ser474 phosphorylation is
not inhibited by wortmannin (data not shown). In HA-GLUT4-Akt2-KD, little or
no Ser474 phosphorylation is detected in the basal state. Insulin
treatment, however, leads to a significant increase in Ser474
phosphorylation coincidentally with the marked increase in endogenous Akt2
phosphorylation and translocation of the KD fusion protein itself.
Interestingly, phosphorylation at Thr309 is not detectable in
either HA-GLUT4-Akt2-wt or HA-GLUT4-Akt2-KD, in either the basal or
insulin-stimulated state, although significant levels of Thr309
phosphorylation of endogenous Akt2 are observed in the insulin-stimulated
state (Fig. 2). Subcellular
fractionation experiments further demonstrate that the proportions of
Ser474-phosphorylated-HA-GLUT4-Akt2-wt and -HA-GLUT4-Akt2-KD
relative to their respective expression levels are significantly higher in the
plasma membranes than the other fractions (data not shown).
|
Coexpression of a dominant negative dynamin increases basal
cell-surface expression, but not Ser474phosphorylation of
HA-GLUT4-Akt2-KD
Whether Ser473 phosphorylation of Akt occurs through an
autophosphorylation mechanism remains to be determined. The data shown above
suggest that Akt2 kinase activity might be required for Ser474
phosphorylation. However, further evidence is needed to determine whether
Ser474 phosphorylation of HA-GLUT4-Akt2-KD in the
insulin-stimulated state is mediated by endogenous activated Akt2 itself
rather than another kinase located in the plasma membrane. Thus,
HA-GLUT4-Akt2-KD was forced to the cell surface by co-expression of a dominant
negative dynamin (Al-Hasani et al.,
1998
), and cell-surface expression and Ser474
phosphorylation was examined. As illustrated in
Fig. 3A, coexpression of mutant
dynamin results in a significant increase in cell surface HA-GLUT4-Akt2-KD in
the basal state, which is similar to the insulin-stimulated level. Insulin has
no further effect. However, immunoblotting of both the plasma membrane
fraction (Fig. 3B) and total
cell membranes (data not shown) with anti-Akt1-phospho-Ser473
demonstrates that forcing HA-GLUT4-Akt2-KD to the cell surface by a dominant
negative mutant dynamin does not itself enhance Ser474
phosphorylation to the level of GLUT4-Akt2-wt in the basal state;
Ser474 phosphorylation is still observed after insulin treatment
where endogenous Akt2 is also activated.
|
T309A Mutation does not alter Ser474 phosphorylation and
cell-surface localization
In order to confirm that Ser474 phosphorylation is important for
targeting HA-GLUT4-Akt2 to the cell surface and that Thr309
phosphorylation might not be necessary for Ser474 phosphorylation
when Akt2 is targeted to the GLUT4-trafficking pathway, cell-surface
expression of the HA-GLUT4-Akt2-S474A and -T309A mutants was examined. The
results, shown in Fig. 4,
reveal that attachment of Akt2-S474A does not significantly increase the basal
cell-surface level of HA-GLUT4 compared to Akt2-wt (t-test,
P>0.05), while attachment of Akt2-T309A has an effect not
significantly different than that of Akt2-wt (t-test,
P>0.05) (Fig. 4A).
Moreover, significant levels of Ser474 phosphorylation are still
observed in HA-GLUT4-Akt2-T309A in the basal state
(Fig. 4B).
|
HA-GLUT4-Akt2-wt, but not HA-GLUT4-Akt2-KD induces translocation of
co-transfected myc-GLUT4 in the absence of insulin
To determine whether Akt2 targeted to the GLUT4-trafficking pathway is
active in signaling, HA-GLUT4-Akt fusion proteins were co-transfected with
myc-GLUT4 and the cell-surface expression of myc-GLUT4 was detected by an
anti-myc antibody binding assay. In the absence of insulin, cotransfection of
HA-GLUT4-Akt2-wt increases cell-surface myc-GLUT4 almost up to the level
observed in the insulin-stimulated state, and insulin does not further enhance
this effect. However, this effect is reduced by mutation of Ser474
to Ala and not observed at all with HA-GLUT4-Akt2-KD
(Fig. 5).
|
| Discussion |
|---|
|
|
|---|
Compared to normal HA-GLUT4, the HA-GLUT4-Akt2-wt fusion protein is found predominantly on the cell-surface and in the plasma membrane fraction even in the basal state, and insulin has no further effect. In contrast, HA-GLUT4-Akt2-KD behaves like normal HA-GLUT4, including translocating to the cell surface in response to insulin. We expected that Akt2 fused to GLUT4 would be found in the GLUT4 storage compartment and were surprised that it localized primarily to the cell surface. Because expressed HA-GLUT4 targets to the insulin-responsive compartment and the HA-GLUT4-Akt2-KD construct does so as well, and because Akt2 without the PH domain contains no targeting information, it appears that the two moieties must function together. Furthermore, attaching an Akt2 moiety to HA-GLUT4 does not appear to disrupt normal processing since the HA-GLUT4-Akt2-KD exhibits all of the properties of HA-GLUT4 and GLUT4. These considerations suggest that the trafficking of the GLUT4 moiety provides the mechanism through which the fusion proteins physically associate with the cell surface and that the presence of a functional Akt2 moiety is required for this association.
In order to confirm this interpretation, we examined the phosphorylation state of the Akt2 moiety. Surprisingly, our results show that Thr309 phosphorylation is not detected in HA-GLUT4-Akt2-wt regardless of its targeting to the cell surface in the absence or presence of insulin. In addition, ablation of Thr309 phosphorylation by replacing Thr309 with Ala does not reverse the cell-surface appearance of the HA-GLUT4-Akt2 fusion protein seen with HA-GLUT4-Akt2-wt in the basal state. Finally, translocation of GLUT4-targeted Akt2-wt is not blocked by the PI3-kinase inhibitor wortmannin (data not shown) which is known to inhibit PDK1-activated Thr309 phosphorylation. In contrast, Ser474 phosphorylation of HA-GLUT4-Akt2-wt is observed in the basal state at a level similar to that observed in the insulin-stimulated state. This level of Ser474 phosphorylation is not reduced by replacing Thr309 with Ala nor inhibiting PI3-kinase with wortamannin (data not shown). However, mutation of Ser474 to Ala in the Akt2 moiety of the fusion protein significantly reduces the association of HA-GLUT4-Akt2 with the cell surface in the basal state.
The subcellular distributions show that a significantly high proportion of
expressed HA-GLUT4-Akt2-wt in both the basal and insulin-stimulated states,
and HA-GLUT4-Akt2-KD in the insulin-stimulated state are phosphorylated on
Ser474 in the plasma membrane fraction as compared to the other
fractions, suggesting that Ser474 phosphorylation occurs at the
plasma membrane (Carvalho et al.,
2000
; Scheid et al.,
2002
). Because the Akt2 moiety cannot be released from the
HA-GLUT4, Ser474 phosphorylation appears to stabilize the fusion
protein complex on the cell surface.
The present study using rat adipose cells provides evidence for the concept
that Ser474 phosphorylation is catalyzed by Akt2 itself. For
instance, in the basal state, HA-GLUT4-Akt2-wt shows Ser474
phosphorylation and a cell-surface localization, while HA-GLUT4-Akt2-KD mainly
remains in the intracellular sites and does not show
Ser474-phosphorylation. In response to insulin, Ser474
phosphorylation of HA-GLUT4-Akt2-KD is significantly increased, coincident
with both translocation to the plasma membrane and activation of endogenous
Akt2. To rule out the possibility that other kinases at the plasma membrane
are responsible for Ser474 phosphorylation of HA-GLUT4-Akt2-wt, we
co-expressed dominant negative dynamin-K44A to increase basal cell-surface
HA-GLUT4-Akt2-KD without activating endogenous Akt2
(Al-Hasani et al., 1998
;
Kao et al., 1998
). This
manipulation fails to enhance Ser474 phosphorylation of
HA-GLUT4-Akt2-KD in the basal state despite the marked increase in
cell-surface HA-GLUT4-Akt2-KD. Significant levels of Ser474
phosphorylation of HA-GLUT4-Akt2-KD are observed only when endogenous Akt2 is
activated in response to insulin, and because cell-surface GLUT4 do not
recycle in the presence of the mutant dynammin, this phosphorylation appears
to take place at the plasma membrane.
These data suggest that Akt2 activity itself is required for
Ser474 phosphorylation and that Ser474 is phosphorylated
through an autophosphorylation mechanism. Additional support for this concept
comes from the findings that Ser474 phosphorylation is correlated
with Akt kinase activity. For instance, ML-9, an inhibitor of Akt activity,
inhibits insulin stimulation of Akt kinase activity, GLUT4 translocation, and
Akt phosphorylation on Ser474, but not on Thr309 in
brown adipocytes (Hernandez et al.,
2001
). A similar relationship is observed in adipocytes from type
II diabetic subjects, i.e., both Ser474 phosphorylation and full
activation of Akt are impaired, while Thr309 phosphorylation is
much less affected (Carvalho et al.,
2000
).
A key finding in this study is that targeting Akt2 specifically to the
GLUT4-trafficking pathway results in an insulin-like effect on Akt2 activation
and GLUT4 translocation. The targeting of Akt to membranes has previously been
achieved by replacing the PH domain with a membrane-targeting sequence, such
as a src myristylation signal or a viral gag sequence
(Cross et al., 1984
;
Ahmed et al., 1993
). Expression
of Akt constructs with a myristylation site produces a constitutive
insulin-like effect similar to that observed here
(Kohn et al., 1996
;
Kohn et al., 1996
). In this
case, however, the constructs are found to be bound indiscriminately to all
membranes and thus do not provide information regarding a specific site of
action. In the present study, targeting Akt2 specifically to the
GLUT4-trafficking pathway is a direct way to examine a specific site of Akt2
action. Our data show that HA-GLUT4-Akt2-wt stimulates the cell-surface
translocation of co-transfected myc-GLUT4 to a level similar to that of
myc-GLUT4 itself in the insulin-stimulated state. This effect is not observed
with HA-GLUT4-Akt2-KD and is decreased with the HA-GLUT4-Akt2-S/A mutant. The
effects of the fusion proteins on myc-GLUT4 translocation are comparable to
the behavior of the fusion proteins themselves. These data suggest that
targeting Akt2 specifically to the GLUT4 trafficking pathway activates Akt2
and stimulates GLUT4 translocation in the absence of insulin. Moreover, these
results together with the phosphorylation and subcellular distribution data
above for the fusion proteins indicate that the plasma membrane localization
is associated with Akt2 activation. With myr-Akt1, both Thr309 and
Ser474 are phosphorylated in the absence of insulin; GLUT4-targeted
Akt2-wt is only phosphorylated on Ser474, but still shows a full
effect on GLUT4 translocation. This suggests that Thr309
phosphorylation is necessary for targeting and Ser474
phosphorylation, for Akt2 activity. However, because the Ser/Ala mutant is
still partially active, it is possible that the remaining activity and
cell-surface localization of HA-GLUT4-Akt2-S/A is attributable to
Tyr475 phosphorylation since it has recently been reported that
Tyr475 phosphorylation is associated with Akt2 activation
(Conus et al., 2002
).
While this work was in progress, the Tarvare laboratory published a report
of a similar project using morphological rather than biochemical assays, and
3T3-L1 adipocytes rather than primary rat adipose cells
(Ducluzeau et al., 2002
). In
this study, the similar fusion proteins of HA-GLUT4-Akt1-wt and -KD both
showed a predominantly cytosolic localization, and the distribution of
HA-GLUT4-Akt1-KD was not changed in response to insulin
(Ducluzeau et al., 2002
).
These discrepancies are most likely related to a combination of the different
approaches used for the construction of the fusion proteins, the different
cell types used, and the quantitative differences in the assay techniques. In
the Tavare study, Akt1 was fused to the N terminus of GLUT4 while we fused
Akt2 to the C terminus of GLUT4. As we observed previously, fusion of GFP to
the N terminus, but not the C terminus, of GLUT4 interferes with the targeting
of GLUT4 to the cell surface (Dawson et
al., 2001
). This observation suggests that the discrepancy
possibly lies in the different constructs used in the two studies although the
behavior of Akt fusion proteins might not be exactly the same as that of GFP
fusion proteins. In addition, our observations demonstrate that Akt2 kinase
activity is required for Ser474 phosphorylation and association of
Akt2 with the plasma membrane. For example, fusion of Akt2-KD to HA-GLUT4 does
not increase basal cell-surface levels of HA-GLUT4 as the fusion of Akt2-wt
does, nor is HA-GLUT4-Akt2-KD phosphorylated on Ser474 in the
absence of insulin. Finally, we find that GLUT4-targeted Akt2 stimulates GLUT4
translocation without the addition of insulin.
In summary, we have fused the kinase domain of Akt2-wt and various Akt2 mutants to the C terminus of HA-GLUT4 in order to investigate the activity, phosphorylation state and subcellular localization of Akt2 targeted to the GLUT4-trafficking pathway. We observe that HA-GLUT4-Akt2-wt, but not HA-GLUT4-Akt2-KD spontaneously associates with the plasma membrane in a manner similar to the response to insulin and becomes phosphorylated on Ser474, but not Thr309. HA-GLUT4-Akt2-KD translocates normally with insulin and becomes phosphorylated on Ser 474 in response to insulin, but is still not phosphorylated on Thr309. HA-GLUT4-Akt2-wt, but not HA-GLUT4-Akt2-KD stimulates the translocation of cotransfected myc-GLUT4. These data demonstrate that targeting Akt2 to the GLUT4-trafficking pathway induces Akt2 activation and GLUT4 translocation. Ser474 phosphorylation is an autocatalytic reaction requiring an active kinase, and kinase activity is associated with a plasma membrane localization. Fusion of Akt2 to the C terminus of GLUT4 appears to substitute for Thr309 phosphorylation in activating the autocatalytic process.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Ahmed, N. N., Franke, T. F., Bellacosa, A., Datta, K., Gonzales-Portal, M. E., Taguchi, T., Testa, J. R. and Tsichlis, P. N. (1993). The proteins encoded by c-akt and v-akt differ in post-translational modification, subcellular localization and oncogenic potential. Oncogene 8,1957 -1963.[Medline]
Alessi, D. R., James, S. R., Downes, C. P., Holmes, A. B.,
Gaffney, P. R., Reese, C. B. and Cohen, P. (1997).
Characterization of a 3-phosphoinositide-dependent protein kinase which
phosphorylates and activates protein kinase B
. Curr.
Biol. 7,261
-269.[CrossRef][Medline]
Al-Hasani, H., Yver, D. R. and Cushman, S. W. (1999). Overexpression of the glucose transporter GLUT4 in adipose cells interferes with insulin-stimulated translocation. FEBS Lett. 460,338 -342.[CrossRef][Medline]
Al-Hasani, H., Hinck, C. S. and Cushman, S. W.
(1998). Endocytosis of the glucose transporter GLUT4 is mediated
by the GTPase dynamin. J. Biol. Chem.
273,17504
-17510.
Andjelkovic, M., Alessi, D. R., Meier, R., Fernandez, A., Lamb,
N. J., Frech, M., Cron, P., Cohen, P., Lucocq, J. M. and Hemmings, B. A.
(1997). Role of translocation in the activation and function of
protein kinase B. J. Biol. Chem.
272,31515
-31524.
Calera, M. R., Martinez, C., Liu, H., Jack, A. K., Birnbaum, M.
J. and Pilch, P. F. (1998). Insulin increases the association
of Akt-2 with Glut4-containing vesicles. J. Biol.
Chem. 273,7201
-7204.
Carvalho, E., Eliasson, B., Wesslau, C. and Smith, U. (2000). Impaired phosphorylation and insulin-stimulated translocation to the plasma membrane of protein kinase B/Akt in adipocytes from Type II diabetic subjects. Diabetologia 43,1107 -1115.[CrossRef][Medline]
Cheatham, B., Vlahos, C., Cheatham, L., Wang, L., Blenis, J. and
Kahn, C. R. (1994). Phosphatidylinositol 3-kinase activation
is required for insulin stimulation of pp70 S6 kinase, DNA synthesis, and
glucose transporter translocation. Mol. Cell. Biol.
14,4902
-4911.
Chen, H., Wertheimer, S. J., Lin, C. H., Katz, S. L., Amrein, K.
E., Burn, P. and Quon, M. J. (1997). Protein-tyrosine
phosphatases PTP1B and syp are modulators of insulin-stimulated translocation
of GLUT4 in transfected rat adipose cells. J. Biol.
Chem. 272,8026
-8031.
Conus, N. M., Hannan, K. M., Cristiano, B. E., Hemmings, B. A.
and Pearson, R. B. (2002). Direct identification of tyrosine
474 as a regulatory phosphorylation site for the akt protein kinase.
J. Biol. Chem. 277,38021
-38028.
Cross, F. R., Garber, E. A., Pellman, D. and Hanafusa, H.
(1984). A short sequence in the p60src N terminus is required for
p60src myristylation and membrane association and for cell transformation.
Mol. Cell. Biol. 4,1834
-1842.
Dawson, K., Aviles-Hernandez, A., Cushman, S. W. and Malide, D. (2001). Insulin-regulated trafficking of dual-labeled glucose transporter 4 in primary rat adipose cells. Biochem. Biophy. Res. Commun. 287,445 -454.[CrossRef][Medline]
Ducluzeau, P. H., Fletcher, L. M., Weish, G. I. and Tavare, J.
J. (2002). Functional consequence of targeting protein kinase
B/Akt to GLUT4 vesicles. J. Cell. Sci.
115,2857
-2866.
Goransson, O., Reslo, S., Ronnstrand, L., Manganiello, V. and Degerman, E. (2002). Ser-474 is the major target of insulin-mediated phosphorylation of protein kinase B ß in primary rat adipocytes. Cell. Signal. 14,175 -182.[CrossRef][Medline]
Heller-Harrison, R. A., Morin, M., Guilherme, A. and Czech, M.
P. (1996). Insulin-mediated targeting of phosphatidylinositol
3-kinase to GLUT4-containing vesicles. J. Biol. Chem.
271,10200
-10204.
Hernandez, R., Teruel, T. and Lorenzo, M. (2001). Akt mediates insulin induction of glucose uptake and up-regulation of GLUT4 gene expression in brown adipocytes. FEBS. Lett. 494,225 -231.[CrossRef][Medline]
Hill, M. M., Andjelkovic, M., Brazil, D. P., Ferrari, S.,
Fabbro, D. and Hemmings, B. A. (2001). Insulin-stimulated
protein kinase B phosphorylation on Ser-473 is independentof its activity and
occurs through a staurosporine-insensitive kinase. J. Biol.
Chem. 276,25643
-25646.
Hill, M. M., Clark, S. F., Tucker, D. F., Birnbaum, M. J.,
James, D. E. and Macaulay, S. L. (1999). A role for protein
kinase Bbeta/Akt2 in insulin-stimulated GLUT4 translocation in adipocytes.
Mol. Cell. Biol. 19,7771
-7781.
Hill, M. M., Feng, J. and Hemmings, B. A. (2002). Identification of a plasma membrane Raft-associated PKB Ser473 kinase activity that is distinct from ILK and PDK1. Curr. Biol. 12,1251 -1255.[CrossRef][Medline]
Holman, G. D. and Cushman, S. W. (1994). Subcellular localization and trafficking of the GLUT4 glucose transporter isoform in insulin-responsive cells. BioEssays 16,753 -759.[CrossRef][Medline]
Kao, A. W., Ceresa, B. P., Santeler, S. R. and Pessin, J. E.
(1998). Expression of a dominant interfering dynamin mutant in
3T3L1 adipocytes inhibits GLUT4 endocytosis without affecting insulin
signaling. J. Biol. Chem.
273,25450
-25457.
Kohn, A. D., Summers, S. A., Birnbaum, M. J. and Roth, R. A.
(1996). Expression of a constitutively active Akt Ser/Thr kinase
in 3T3-L1 adipocytes stimulates glucose uptake and glucose transporter 4
translocation. J. Biol. Chem.
271,31372
-31378.
Kohn, A. D., Takeuchi, F. and Roth, R. A.
(1996). Akt, a pleckstrin homology domain containing kinase, is
activated primarily by phosphorylation. J. Biol. Chem.
271,21920
-21926.
Kupriyanova, T. A. and Kandror, K. V. (1999).
Akt-2 binds to Glut4-containing vesicles and phosphorylates their component
proteins in response to insulin. J. Biol. Chem.
274,1458
-1464.
Okada, T., Kawano, Y., Sakakibara, T., Hazeki, O. and Ui, M.
(1994). Essential role of phosphatidylinositol 3-kinase in
insulin-induced glucose transport and antilipolysis in rat adipocytes Studies
with a selective inhibitor wortmannin. J. Biol. Chem.
269,3568
-3573.
Quon, M. J., Guerre-Millo, M., Zarnowski, M. J., Butte, A. J.,
Em, M., Cushman, S. W. and Taylor, S. I. (1994). Tyrosine
kinase-deficient mutant human insulin receptors (Met1153
Ile)
overexpressed in transfected rat adipose cells fail to mediate translocation
of epitope-tagged GLUT4. Proc. Natl. Acad. Sci. USA
91,5587
-5591.
Rea, S. and James, D. E. (1997). Moving GLUT4: the biogenesis and trafficking of GLUT4 storage vesicles. Diabetes 46,1667 -1677.[Abstract]
Scheid, M. P., Marignani, P. A. and Woodgett, J. R.
(2002). Multiple phosphoinositide 3-kinase-dependent steps in
activation of protein kinase B. Mol. Cell. Biol.
22,6247
-6260.
Simpson, I. A., Yver, D. R., Hissin, P. J., Wardzala, L. J., Karnieli, E., Salans, L. B. and Cushman, S. W. (1983). Insulin-stimulated translocation of glucose transporters in the isolated rat adipose cells: characterization of subcellular fractions. Biochem. Biophys. Acta. 763,393 -407.[Medline]
Stokoe, D., Stephens, L. R., Copeland, T., Gaffney, P. R.,
Reese, C. B., Painter, G. F., Holmes, A. B., McCormick, F. and Hawkins, P.
T. (1997). Dual role of
phosphatidylinositol-3,4,5-trisphosphate in the activation of protein kinase
B. Science 277,567
-570.
Wang, Q., Somwar, R., Bilan, P. J., Liu, Z., Jin, J., Woodgett,
J. R. and Klip, A. (1999). Protein kinase B/Akt participates
in GLUT4 translocation by insulin in L6 myoblasts. Mol. Cell.
Biol. 19,4008
-4018.
Weber, T. M., Joost, H. G., Simpson, I. A. and Cushman, S. W. (1998). Methods for assessment of glucose transport activity and the number of glucose transporters in isolated rat adipose cells and membrane fractions. In Receptor Biochemistry and Methodology, Vol. 12B (ed. C. R. Kahn and L. C. Harrison), pp. 171-187.New York: Allan R. Liss.
Williams, M. R., Arthur, J. S., Balendran, A., van der Kaay, J., Poli, V., Cohen, P. and Alessi, D. R. (2000). The role of 3-phosphoinositide-dependent protein kinase 1 in activating AGC kinases defined in embryonic stem cells. Curr. Biol. 10,439 -448.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
G. I. Welsh, S. E. Leney, B. Lloyd-Lewis, M. Wherlock, A. J. Lindsay, M. W. McCaffrey, and J. M. Tavare Rip11 is a Rab11- and AS160-RabGAP-binding protein required for insulin-stimulated glucose uptake in adipocytes J. Cell Sci., December 1, 2007; 120(23): 4197 - 4208. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. B. Yaspelkis III, S. J. Lessard, D. W. Reeder, J. J. Limon, M. Saito, D. A. Rivas, I. Kvasha, and J. A. Hawley Exercise reverses high-fat diet-induced impairments on compartmentalization and activation of components of the insulin-signaling cascade in skeletal muscle Am J Physiol Endocrinol Metab, October 1, 2007; 293(4): E941 - E949. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ishiki and A. Klip Minireview: Recent Developments in the Regulation of Glucose Transporter-4 Traffic: New Signals, Locations, and Partners Endocrinology, December 1, 2005; 146(12): 5071 - 5078. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. S. L. Thong, C. B. Dugani, and A. Klip Turning Signals On and Off: GLUT4 Traffic in the Insulin-Signaling Highway Physiology, August 1, 2005; 20(4): 271 - 284. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. J. Herr, J. R. Bernard, D. W. Reeder, D. A. Rivas, J. J. Limon, and B. B. Yaspelkis III Insulin-stimulated plasma membrane association and activation of Akt2, aPKC {zeta} and aPKC {lambda} in high fat fed rodent skeletal muscle J. Physiol., June 1, 2005; 565(2): 627 - 636. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Wertheim, Z. Cai, and T. E. McGraw The Transcription Factor CCAAT/Enhancer-binding Protein {alpha} Is Required for the Intracellular Retention of GLUT4 J. Biol. Chem., October 1, 2004; 279(40): 41468 - 41476. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||