|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 15 July 2003
doi: 10.1242/jcs.00663
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
6ß4 integrin regulates keratinocyte chemotaxis through differential GTPase activation and antagonism of
3ß1 integrin

1 Program in Epithelial Biology, Stanford University School of Medicine,
Stanford, CA 94305, USA
2 Pathology & Institute for Medicine and Engineering, University of
Pennsylvania, Philadelphia, PA 19104, USA
Author for correspondence (e-mail:
mpm{at}stanford.edu)
Accepted 12 May 2003
| Summary |
|---|
|
|
|---|
6ß4 integrin. We
investigated the role of
6ß4 integrin in laminin-5-dependent
keratinocyte migration by re-expressing normal or attachment-defective ß4
integrin in ß4 integrin null keratinocytes. We found that expression of
ß4 integrin in either a ligand bound or ligand unbound state was
necessary and sufficient for EGF-induced cell migration. In a ligand bound
state, ß4 integrin supported EGF-induced cell migration though sustained
activation of Rac1. In the absence of
6ß4 integrin ligation, Rac1
activation became tempered and EGF chemotaxis proceeded through an alternate
mechanism that depended upon
3ß1 integrin and was characterized by
cell scattering.
3ß1 integrin also relocalated from cell-cell
contacts to sites of basal clustering where it displayed increased
conformational activation. The aberrant distribution and activation of
3ß1 integrin in attachment-defective ß4 cells could be
reversed by the activation of Rac1. Conversely, in WT ß4 cells the normal
cell-cell localization of
3ß1 integrin became aberrant after the
inhibition of Rac1. These studies indicate that the extracellular domain of
ß4 integrin, through its ability to bind ligand, functions to integrate
the divergent effects of growth factors on the cytoskeleton and adhesion
receptors so that coordinated keratinocyte migration can be achieved.
Key words:
6ß4 Integrin, EGF, Laminin-5, Keratinocyte, Chemotaxis
| Introduction |
|---|
|
|
|---|
3ß1 integrin (Carter et
al., 1991
6ß4 integrin
(Sonnenberg et al., 1991
2ß1 integrin and MMP-1
(Pilcher et al., 1997
3ß1 integrin
(Goldfinger et al., 1999
6ß4 integrin has generally been viewed as a mediator of
attachment and HD formation at sites more distal from the wound edge
(Kurpakus et al., 1991
;
Nguyen et al., 2000a
) or even
as an inhibitor of keratinocyte motility
(Hintermann et al., 2001
).
However, several lines of evidence suggest
6ß4 integrin may play a
more direct and active role in keratinocyte migration.
6ß4
integrin interacts with receptor tyrosine kinases such as EGFR, ErbB-2 and Met
(Falcioni et al., 1997
;
Hintermann et al., 2001
;
Trusolino et al., 2001
).
Stimulation of keratinocytes with EGF induces tyrosine phosphorylation of the
cytoplasmic domain of ß4 which is implicated in both HD disassembly and
epithelial motility (Mainiero et al.,
1996
).
6ß4 may play an active role in chemotactic
migration through lysophosphatidic acid (LPA) by activation of a cAMP-specific
phosphodiesterase and RhoA GTPase
(O'Connor et al., 2000
;
O'Connor et al., 1998
). and
6ß4 can localize with filamentous actin and stabilize
lamellipodial membrane protrusions
(Rabinovitz and Mercurio,
1997
; Rabinovitz et al.,
1999
).
Since growth factor stimulation is required to induce keratinocyte
migration during wound healing, we examined the role of laminin-5,
3ß1 integrin and
6ß4 integrin in this process. We
re-expressed wild-type and attachment-defective ß4 integrin in ß4
null patient keratinocytes and studied the effects of
6ß4 integrin
ligation on EGF-mediated keratinocyte chemotaxis. We found that EGF-induced
keratinocyte migration response depends upon the interaction between laminin-5
and the ß4 integrin ectodomain. When bound to laminin-5,
6ß4
integrin promoted EGF-dependent cell migration through Rac1 activation.
Without laminin-5 ligation through
6ß4 integrin, EGF induced
keratinocyte chemotaxis through
3ß1 integrin. We show evidence
that these two pathways are antagonistic and suggest a mechanism through which
6ß4 may coordinate these two signals to regulate integrated
epithelial movement during wound healing.
| Materials and Methods |
|---|
|
|
|---|
Antibodies
Mouse mAb 3E1, ASC-8 and rat mAb GoH3 recognizing the extracellular domains
of ß4 and
6 respectively, and rabbit polyclonal antiserum to
ß4 wwere obtained from Chemicon (Temecula, CA). Mouse mAb ASC-8 is
inhibitory to
6ß4 attachment and was used in all inhibition assays
at 10 µg/ml. The mouse mAb 121 raised against HD1/plectin and the mouse mAb
233 raised against BP180 were a gift from Dr K. Owaribe (Nagoya University,
Nagoya, Japan). The rabbit laminin-5 antisera has been characterized
(Marinkovich et al., 1992
).
Anti-laminin-5 mAb BM165 (Rousselle et
al., 1991
) was purified through protein G affinity chromatography.
BM165 prevents attachment to the
3 subunit of laminin-5 and was used at
10 µg/ml. Mouse anti-
3 integrin mAb P1B5 and mouse mAb HUTS-4
against the active conformation of ß1 integrins were obtained from
Chemicon. P1B5 is inhibitory to
3ß1 integrin attachment and was
used at 10 µg/ml. Mouse mAb 349 and rat mAb 346-11A against human paxillin
and integrin were obtained from Transduction Labs and Pharmingen respectively
(Lexington, NY). Rabbit sera 119 and P1 raised against RhoA and Cdc42
respectively were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).
Mouse mAb 23A8 against Rac1 was obtained from Upstate Biotech (Lake Placid,
NY). Mouse mAb 9E10 to the myc tag was obtained from Oncogene Research
Products (Boston, MA). Phosphotyrosine western blots were carried out with
mouse mAb 4G10 (Upstate Biotech, Lake Placid, NY). Rabbit antibodies to p44/42
MAP kinase and phospho-p44/42 MAP kinase were obtained from New England
Biolabs Inc (Beverly, MA). FITC- and TRITC-conjugated phalloidin was purchased
from Sigma Chemical Co. (St Louis, MO). TRITC-conjugated goat anti-rabbit,
Cy5-conjugated goat anti-rat and FITC-conjugated donkey anti-mouse secondary
antibodies were purchased from Jackson ImmunoResearch (Westgrove, PA). The
sheep anti-mouse and donkey anti-rabbit horseradish peroxidase-conjugated
secondary antibodies were obtained from Amersham (Arlington Heights, IL).
cDNA constructs and vectors
ß4pRK-5 was a generous gift from Dr F. G. Giancotti (Sloan Kettering
Cancer Institute, NY). Previous reports have shown that a ß4 integrin
cDNA from this lab contained an in frame deletion of 7 amino acids (880-886)
in the membrane proximal region (Dans et
al., 2001
). Therefore, before use we sequenced this region to
ensure no deletions were present. ß4 cDNA was cloned as a 5.6 kb
EcoRI fragment into the EcoRI site of retroviral expression
vector LZRS (Kinsella and Nolan,
1996
) containing the encephalomyocarditis virus (EMCV)-IRES and
blasticidin-resistance sequences (Deng et
al., 1998
). An attachment-deficient (AD) ß4 construct was
produced through cloning the EcoRI ß4 cDNA insert into the
EcoRI site of pSK and performing mutagenesis using the GeneEditor in
vitro site-directed mutagenesis system (Promega, Madison WI). Primers used for
the point mutation of ß4 sequences were as follows: ß4(AD) (D230A,
P232A, E233A, incorporating a novel NaeI site) 5'
GGCAACCTGGCTGCTGCTGCCGGCGGCTTCG 3'.
Positive clones were sequenced and ligated into the EcoRI site of
LZRS-IRES-blasticidin. Dominant inhibitory Rho family GTPase constructs cloned
into the GFP fusion vector EGFP-C1 (Clontech) were a generous gift from Dr
Eugene Butcher (Stanford Medical Center, CA). GFP tagged GTPase inserts were
cloned into LZRS-IRES-blasticidin by PCR using the EcoRI tailed
primer GTPaseF, 5' CCCCCCGAATTACAGATCCGCTAGCGCTACCGGTC 3' and
GTPaseR 5' CGGTACCGTCGACTGCAGAATTC 3'. PCR products were digested
with EcoRI and cloned into LZRS and verified by sequencing. Myc
tagged V12Rac1 was a kind gift of Dr Alan Hall (University College London, UK)
and was cloned as an EcoRI fragment into LZRS-IRES-blasticidin. The
GTPase pull-down construct pGEX-2T-RBD against GTP-RhoA was a kind gift from
Dr Martin A. Schwartz (Scripps Research Insitute, La Jolla, CA) while
pGEX-2T-PAK against GTP-Rac1 and GTPCdc42 was a kind gift from Dr John Collard
(Netherlands Cancer Institute, Amsterdam, The Netherlands).
Retroviral transduction
Amphotropic retrovirus was produced in modified 293 cells as previously
described (Kinsella and Nolan,
1996
). 1x105 keratinocytes were seeded into
6-well tissue culture plates and incubated for 24 hours 15 minutes prior to
infection, 5 µg/ml polybrene (Sigma) was added to both viral supernatant
and keratinocyte media. Media was removed and 4 ml retroviral supernatant
added. Plates were centrifuged at 300 g for 1 hour at 32°C
using a Beckman GS-6R centrifuge. Cells were incubated at 37°C for 24
hours followed by replacement with fresh SFM and selection with 5 µg/ml
blasticidin (Calbiochem, La Jolla, CA).
Biochemical methods
Phosphorylation of
6ß4 by EGF was assessed by
immunoprecipitation of ß4 from EGF-treated cell lysates. Briefly,
keratinocytes in culture were starved of growth factors by incubating in
keratinocyte SFM without additives (SFM/WA) for 16 hours. Cells were then
treated with recombinant human EGF (100 ng/ml) before washing with ice cold
PBS followed by the addition of lysis buffer (20 mM Tris pH 8.0, 137 mM NaCl,
1% NP-40, 10% glycerol, 1 mM PMSF, 10 µg/ml aprotinin, 1 µg/ml
leupeptin, 10 mM EDTA, 500 µM Na3VO4) for 20 minutes
on ice. Equalized lysates (1 mg) were added to 3 µg mAb 3E1 and 100 µl
protein A/G immobilized beads (Pierce, Rockford, IL) and incubated for 17
hours at 4°C. Beads were washed with lysis buffer twice then once with
ice-cold water before being boiled for 10 minutes with 7 M urea sample buffer
(125 mM Tris pH 6.95, 7 M urea, 1 mM EDTA, 2% SDS, 0.1% bromophenol blue, 10%
ß-ME). After SDS-PAGE of samples, the degree of phosphorylation was
ascertained by western blot with mAb 4G10. GTPase activation assays were
carried out using a modified GST pull-down protocol
(Ren et al., 1999
). Briefly,
cells were growth starved as above, treated with 2 ng/ml EGF, harvested at
intervals, washed once with ice cold PBS and extracted with lysis buffer (50
mM Tris pH 7.2, 0.1% SDS, 1% Triton X-100, 0.5% deoxycholate, 50 mM NaCl, 1%
NP-40, 10% glycerol, 1 mM PMSF, 10 µg/ml aprotinin, 10 µg/ml leupeptin
and 1 mM Na3VO4). Lysates were immediately incubated for
30 minutes with GST-PAK or GST-RBD beads at 4°C washed three times with
lysis buffer, once with ice-cold water and eluted with 35 µl 7 M urea
sample buffer with 20% ß-mercaptoethanol before electrophoresis on a 12%
SDS-PAGE gel.
Cell scattering and adhesion assays
Cell scattering was ascertained by examining clonal growth after 4 days.
Briefly, cells were plated at low density (<5000 cells per 60 mm plate) and
allowed to grow in each selected medium for 4 days. For studies with EGF-free
medium, cells were plated in normal SFM for 16 hours then the medium was
changed to SFM/WA. Cell scattering was quantified by counting colonies of less
than eight cells, defining unscattered colonies as having at least 90% of the
cells in contact with each other. Each count was performed with at least 50
colonies and repeated three times. Cell adhesion assays were performed using a
crystal violet assay attachment assay
(Wayner et al., 1991
), coating
96-well plates with 10 µg/ml affinity purified laminin-5 and incubating
cells for 60 minutes at 37°C. Laminin-5 secreted by cells was visualized
by matrix extraction. Briefly, cells were allowed to adhere to 6-well plates
as described then were removed with 2 ml 20 mM ammonium hydroxide for 5
minutes at room temperature. Plates were rinsed three times with PBS then 200
µl matrix extraction buffer added (8 M urea, 1% SDS, 10 mM Tris-HCl (pH
6.8), 5% ß-mercaptoethanol) before removal by scraping. Western blotting
was performed with 10 µg of each lysate.
Migration assays
Monolayer scratch assays were performed by plating 106 cells
into 60 mm tissue culture plates and incubating cells in SFM for 24 hours.
Medium was changed to SFM/WA for 16 hours. Fresh mitomycin-C (Sigma) was added
at 10 µg/ml and cells incubated 3 hours on ice. Cells were washed twice
with SFM/WA and scratched with a 1 mm cell scraper. Plates were washed three
times with SFM/WA and marked areas photographed using a Zeiss Axiovert 25
microscope (50x magnification). Cells were incubated with or without 2
ng/ml EGF and photographed at defined time intervals. Migration was quantified
by calculating percentage change in the area between migrating cell sheets
using NIH image software and >3 repeats per data point. Chemotaxis assays
were performed using a modified Boyden chamber assay
(Leavesley et al., 1992
).
Briefly, 6.5 mm, 8.0 µm pore size transwell inserts (Costar, Corning, NY)
were coated with extracellular matrix (ECM) diluted in 250 µl PBS for 3
hours at 37°C, rinsed twice with PBS and blocked with 5% BSA/PBS for 60
minutes at 37°C then placed in 750 µl medium in 24-well plates.
5x104 growth factor-starved keratinocytes were added to the
upper chamber and incubated for 16 hours Chambers were washed twice with PBS,
fixed with 3% paraformaldehyde/PBS for 15 minutes and stained with 0.1%
crystal violet for 15 minutes. Non-migrating cells were removed by swabbing
and cells quantified by counting three fields of view (100x) on a Zeiss
Axioscope. Experiments were performed in triplicate and repeated at least
twice.
Immunofluorescence microscopy
For HD components, cells were cultured in HAMF12:DMEM (1:3) containing 10%
fetal calf serum, 0.4 µg/ml hydrocortisone and 10-6 M
isoproterenol (both from Sigma Chemical Co., St Louis, MO). Cells were then
fixed with 3% paraformaldehyde permeabilized with 0.5% Triton X-100 in PBS at
room tempeerature (RT) for 30 minutes. For focal adhesion (FA) components,
cells were fixed with 3% formaldehyde/0.5% Triton X-100 buffer (20 mM Tris, pH
7.4, 50 mM NaCl, 1 mM EGTA, 5 mM EDTA, 50 mM sodium pyrophosphate, 100 µM
Na3VO4, 1 µg/ml aprotinin, 1 µg/ml leupeptin) for
30 minutes at RT. Cells were blocked with 1% BSA for 60 minutes before
staining with appropriate primary and secondary antibodies. Actin was labeled
with FITC or TRITC-phalloidin diluted at 1 ng/ml. Labeled slides were viewed
using an Applied Precision deltavision deconvolution system and a Bio-Rad
confocal microscope.
Quantification of lamellipodial area
Cells were seeded into 8 chamber slides in SFM. After 6 hours, medium was
changed to SFM/WA and cells were incubated at 37°C for 16 hours Cells were
treated with recombinant EGF (2 ng/ml) and fixed with 3.4% formaldehyde at RT
for 15 minutes. Cells were stained with TRITC-phalloidin and visualized on a
Leitz Aristaplan microscope, capturing images with a digital spot camera
(National Instruments, Austin TX). Lamellipodial area was calculated as
described (Rabinovitz and Mercurio,
1997
) using NIH image software. Each value is expressed as the
mean of >50 cells.
| Results |
|---|
|
|
|---|
6ß4 integrin and laminin-5 are essential for EGF induced
migration in keratinocytes
6ß4 integrin null EB-PA keratinocytes to study
6ß4 integrin in keratinocyte migration. Control vector (LacZ) or
full-length ß4 integrin were retrovirally expressed in EB-PA cells to
create ß4(-) and ß4(+) cells respectively. ß4(-) cells showed
normal laminin-5 secretion but no detectable ß4 integrin and the HD
proteins BP180, BP230 and HD1/plectin were diffusely localized
(Fig. 1A top panels; BP230 not
shown). In contrast, ß4(+) cells basally accumulated ß4 integrin
which co-localized with
6 integrin, HD1/plectin, BP180, BP230 and
laminin-5 (Fig. 1A bottom
panels; BP230 not shown). Flow cytometry showed that ß4(+) cells
expressed cell surface ß4 integrin at a level comparable to normal
keratinocytes (73.2±12.2% of control, n=3).
|
Without EGF, neither ß4(-) nor ß4(+) cells migrated in a
monolayer scratch assay (Fig.
1B,C; <10.9±5.6% scratch closure over 48 hours), however
upon addition of EGF only ß4(+) cells migrated significantly into the
wound scratch (ß4(-) 10.9±5.6% closure vs. ß4(+),
35.3±1.6% scratch closure over 48 hours, P<0.05). Similar
observations were obtained when migration was assayed using ECM-coated
transwell chambers. EGF also induced the migration of ß4(+) cells but not
ß4(-) cells across transwells coated with collagen IV, collagen I,
fibronectin or laminin-1 (Fig.
1D, collagen IV shown, overall fold induction: ß4(+)
2.04±0.18 versus ß4(-) 1.08±0.03). These ECM substrates are
not ligands for
6ß4 integrin (with the exception of laminin-1),
therefore we investigated whether interactions between
6ß4
integrin and autocrine laminin-5 were responsible for mediating cell
migration. In the presence of BM165, an antibody to laminin-5 that inhibits
cell adhesion, EGF-induced migration of ß4(+) cells was significantly
reduced, suggesting ligation of ß4 integrin by laminin-5 was necessary
for EGF-induced keratinocyte chemotaxis
(Fig. 1E, collagen IV shown).
Similar results were also obtained with collagen I, fibronectin and, laminin-1
(data not shown).
To identify the cellular receptors for laminin-5 responsible for mediating
EGF-induced chemotaxis in keratinocytes, the transwell assays were repeated
using ß4(+) cells in the presence of
6ß4 integrin (mAb ASC-8)
and
3ß1 integrin (mAb P1B5) inhibitory antibodies or an IgG
control (Fig. 1F). Collagen IV
was selected as a migration substrate as it is neither a ligand for
6ß4 nor for
3ß1 integrin. These studies showed that
although ß4 integrin expression is necessary for attachment, either
6ß4 or
3ß1 integrin is sufficient for EGF-induced
chemotaxis in keratinocytes. Thus, both
6ß4 integrin and laminin-5
expression are essential for EGF-induced chemotaxis in keratinocytes but this
process can be mediated by laminin-5 induced ligation of either
6ß4 or
3ß1 integrin.
Mutation of ß4 integrin extracellular domain permits recruitment
of HD components but prevents laminin-5 attachment and EGF induced ß4
integrin phosphorylation
To further examine the contribution of
6ß4 integrin ligation to
EGF induced chemotaxis we designed and expressed an attachment-defective
ß4 integrin mutant in the EB-PA cells. An extracellular ligand-binding
mutant of ß4 integrin was designed according to published data that
identified two regions in the ß3 integrin extracellular domain that were
essential for attachment in the platelet integrin
IIbß3
(asterisks, Fig. 2A)
(Baker et al., 1997
). Homology
analysis of the exodomains of ß3 and ß4 integrins revealed a high
level of conservation between these two ligand attachment regions.
Accordingly, a mutant ß4 cDNA construct was engineered that incorporated
three substitutions within the second homology domain at D230A, P232A and
E233A and termed adhesion defective ß4, or ß4(AD).
|
EB-PA cells expressing ß4(AD) had strong basal expression of the
ß4 integrin that co-localized in type I HD clusters with
6
integrin, plectin, BP180 and secreted laminin-5, in a pattern that was similar
to that exhibited by the ß4(+) cells
(Fig. 2B). Recruitment of HD
components by ß4(AD) is in agreement with previous reports that ß4
integrin recruitment to HDs is driven by cytoplasmic interactions with BP180
and plectin and not by
6ß4 attachment to laminin-5
(Homan et al., 1998
;
Nievers et al., 2000
;
Nievers et al., 1998
).
ß4(AD) and ß4(+) cells were studied by attachment assays using
affinity purified laminin-5 (Fig.
2C). Contributions of
6ß4 and
3ß1 integrin
to adhesion were analyzed using inhibitory antibodies (ASC8;
6ß4
integrin, and P1B5;
3ß1 integrin, respectively). Both cell types
attached at comparable levels to laminin-5, however inhibition of
3ß1 integrin completely prevented ß4(AD) attachment while not
affecting ß4(+) cells. Note that these assays measure substrate
attachment and not the strength of substrate attachment, which could be
enhanced in ß4(+) cells.
6ß4 integrin can uniquely mediate
attachment to laminin-5 even at 4°C
(Xia et al., 1996
). While
ß4(+) cells could attach effectively at 4°C, ß4 (AD) cells could
not (Fig. 4D). However,
pre-incubating ß4(+) cells with ß4 integrin inhibitory antibody
(ASC-8) reduced the adhesion level of the ß4 (+) cells at 4°C to the
same level exhibited by ß4(AD) cells. These studies demonstrate that
although ß4(AD) cells fail to adhere through
6ß4 integrins
they retain normal function of
3ß1 integrin. We conclude that the
adhesion defect of ß4(AD) cells is a consequence of direction mutation of
the extracellular domain of the ß4 integrin subunit rather than of a
non-specific effect upon
3ß1 integrin expression or function.
|
6ß4 integrin becomes tyrosine phosphorylated following
stimulation with high concentrations of EGF
(Mainiero et al., 1996
). To
further evaluate the ligand binding characteristics of our ß4 integrin
mutant (AD) cells, we tested the ability of EGF to induce tyrosine
phosphorylation of ß4 integrin. Although EGF induced phosphorylation of
ß4 integrin in ß4(+) cells, no phosphorylation of ß4 integrin
was observed in ß4(AD) cells (Fig.
2E, compare top panel to the lower panel). All three cell types
secreted and processed laminin-5 to a similar degree regardless of EGF
treatment (Fig. 2F). Finally,
we examined the possibility that expression of the ß4(AD) mutant induced
non-specific effects on EGFR expression or signaling. Flow cytometry of
surface EGFR of ß4(+) compared with ß4(AD) cells revealed similar
levels of expression (mean fluorescence 162.1±10.6 vs.
199.4±11.6). Signaling by the EGFR was tested by examination of the
effects of EGF on MAP kinase activation
(Fig. 2G). Treatment of all
cell types resulted in strong activation of p44/42 MAP kinase. Separate
studies also confirmed that the kinetics of this activation was unchanged
(data not shown). Taken together, these experiments show that mutation of
conserved extracellular residues within the ß4 subunit prevents
attachment to laminin-5 and inhibits ligation-dependent tyrosine
phosphorylation of ß4 integrin. However, loss of attachment function does
not prevent ß4 integrin from mediating its other cellular functions
including the recruitment of HD components.
Ligation of
6ß4 integrin is required for sustained
activation of Rac1, lamellipodia formation and RhoA-independent
chemotaxis
Members of the Rho GTPase family drive chemotaxis by EGF in many cell types
(Nobes and Hall, 1995
).
Therefore, we examined the effects of
6ß4 expression and ligation
upon EGF-dependent Rho GTPase activity
(Fig. 3A,B). ß4(-) cells
showed transient EGF induced stimulation of Rac1 activity and modest
activation of Cdc42. Expression of wild-type
6ß4 integrin resulted
in rapid and sustained activation of both Rac1 and Cdc42 (for at least 2
hours). In contrast, expression of ß4(AD) resulted in a truncated Rac1
activation profile similar to ß4(-) cells. Interestingly, while
ß4(-) and ß4(+) cells exhibited similar EGF-dependent RhoA activity
ß4(AD) cells showed higher RhoA activation both before and after EGF
treatment (Fig. 3B). Thus we
concluded that
6ß4 expression and ligation are essential for
sustained EGF-dependent Rac1 and Cdc42 activation. Interestingly, in the
absence of
6ß4 integrin laminin-5 interactions, Rac1/Cdc42
activation is truncated whereas RhoA activity appears to be amplified.
|
Since Rac1 induces membrane ruffling and lamellipodia extension, structures
of known importance to cell migration
(Lauffenburger and Horwitz,
1996
; Mitchison and Cramer,
1996
), we next investigated the relevance of
6ß4
integrin-dependent Rac1 activation to lamellipodia formation after EGF
exposure. Cells were treated with EGF and fixed at time intervals following
EGF stimulation and lamellipodial area was quantified
(Fig. 3C). EGF induced membrane
extension in all cells tested, and this effect peaked after 5 minutes.
However, ß4(-) and ß4(AD) cells failed to sustain lamellipodia
induction beyond 20 minutes. In contrast, ß4(+) cells maintained
lamellipodia for at least 2 hours following EGF exposure. Therefore, sustained
lamellipodia formation in ß4(+) cells mirrors the activation of Rac1 in
that it requires both
6ß4 integrin expression and ligation to
laminin-5. To more directly test this observation, NHK were incubated with
ß4 inhibitory antibody (ASC-8) and lamellipodial induction was measured
in response to EGF (Fig. 3D).
Consistently, inhibition of
6ß4 integrin ligation markedly
truncates sustained lamellipodia formation similar to that observed in
ß4(-) and ß4(AD) cells.
To further explore the significance of Rac1 activation in keratinocyte
chemotaxis, we retrovirally expressed dominant inhibitory forms of GFP-tagged
N17Rac1, N17Cdc42 or N19RhoA in ß4(+) cells and tested for effects on
chemotaxis using the transwell assay (expression verified by western blot and
immunofluorescence microscopy, data not shown). Transwell assays conducted
with collagen IV revealed significant inhibition of EGF-induced chemotaxis in
ß4(+) cells after N17Rac1 or N17Cdc42 were expressed
(Fig. 3D). However, expression
of N19RhoA did not inhibit induction. These results suggest that expression
and ligation of
6ß4 integrin is required for sustained stimulation
of Rac1, lamellipodia formation and chemotaxis in a process that appears to be
independent of activated RhoA.
Attachment defective
6ß4 integrin undergoes chemotaxis
through an alternate pathway involving RhoA and integrin
3ß1
We observed that expression and ligation of
6ß4 integrin is
required for sustained activation of Rac1 and lamellipodia formation. However,
we previously observed that blocking
6ß4 ligation with the
inhibitory antibody ASC-8 does not block chemotaxis of ß4(+) cells
(Fig. 1F). We therefore used
ß4(AD) cells and asked whether the absence of
6ß4 integrin
ligation results in chemotaxis through an alternative EGF-dependent mechanism.
In both monolayer scratch (Fig.
4A, 24-hour time point shown, full closure in 48 hours;
n=3) and transwell migration assays (using collagen I, collagen IV,
fibronectin or laminin-1; Fig.
4B, average fold induction 6.16±1.51, collagen IV shown),
EGF-induced chemotaxis was enhanced in ß4(AD) cells. To ascertain the
contribution of laminin-5 and integrin
3ß1 to this process we
repeated the transwell assay in the presence of inhibitory antibodies.
Treatment of ß4(AD) cells with either laminin-5 or
3ß1
integrin antibodies inhibited the chemotactic response to EGF
(Fig. 4B), indicating that
laminin-5-
3ß1 integrin interactions are required for chemotaxis in
ß4(AD) cells.
The GTPase activation profile of ß4(AD) cells showed elevated levels
of RhoA activation before and after treatment with EGF. We expressed
inhibitory Rac1, RhoA and Cdc42 constructs in ß4(AD) cells to determine
whether changes in GTPase activation profiles reflected altered Rho family
GTPase requirements for ß4(AD) chemotaxis. Chemotaxis was uniformly
inhibited by N17Rac1, N17Cdc42 and N19Rho expression
(Fig. 4C) suggesting cell
motility in response to EGF was now also dependent upon RhoA. Activation of
RhoA in epithelial cells is often associated with cell scattering
(Sander et al., 1999
). In
support of a role for RhoA in ß4(AD) migration, ß4(AD) cells
appeared to migrate predominantly as individual cells following stimulation
with EGF as opposed to migrating as an intact sheet of cells
(Fig. 4A). The scattering
phenotype of ß4(AD) cells was quantified by examining colony formation
following growth in normal EGF-supplemented medium
(Fig. 4D). Four days after
plating (5000 cells per 60 mm plate) ß4(AD) cells showed extensive colony
scattering (65.3±1.6% of total colonies), while ß4(-) and
ß4(+) cells predominantly formed epithelial colonies with intact
cell-cell interactions (18.2±4.2% and 23.1±4.2% scattered
respectively).
To verify that the scattering effects that we observed were indeed due to loss of ß4 integrin adhesion, colony scattering experiments were carried out using ß4(+) cells treated with the ß4 integrin inhibitory antibody (ASC-8) following 16 hours of EGF treatment (Fig. 4E). ß4 (+) cells incubated with the ß4 integrin adhesion blocking antibody (ASC-8) exhibited increased cell scattering (P<0.05; Fig. 4E, right), similar to that exhibited by ß4(AD) cells, although the scattering was maintained for a shorter duration, possibly due to antibody internalization and turnover.
These data illustrated that while ligation of
6ß4 mediates EGF
induced chemotaxis through Rac1, in the absence of
6ß4 ligation
(but not expression) chemotaxis appears to be mediated through an alternative
pathway that depends upon
3ß1 integrin and utilizes RhoA. If true
then in the absence of ß4 integrin ligand binding, loss of RhoA activity
should inhibit EGF-induced keratinocyte migration. We tested this hypothesis
by conducting transwell assays in the presence of ß4 integrin ligand
blocking antibody (ASC-8) using ß4(+) cells that expressed a
dominant-negative RhoA (Fig.
4F). As anticipated, when
6ß4 integrin ligation is
prevented, EGF-induced chemotaxis is decreased, suggesting an increased
dependency on RhoA for migration upon inhibition of
6ß4
ligation.
Expression and ligation of
6ß4 integrin change the
distribution and conformational activation of
3ß1 integrin
Our studies thus far suggested that EGF-induced keratinocyte chemotaxis
through
3ß1 integrin becomes altered following expression and
ligation of
6ß4 integrin. Additional studies were therefore
conducted to further examine the effects of
6ß4 integrin on
3ß1 integrin function in our keratinocyte model. Since reports
have suggested that keratinocyte immortalization with HPV18 E6 and E7 genes
might alter adhesion and cytoskeletal organization
(Nguyen et al., 2000a
), we
also conducted studies using retrovirally transduced primary cells isolated
from a second EB-PA patient. Because
3ß1 integrin regulates the
actin cytoskeleton, we first analyzed the effect of expression and ligation of
6ß4 integrin on the distribution of actin and the FA component
paxillin using immunofluorescence. ß4(-) cells had diffusely organized
actin and paxillin (Fig. 5A)
with basally distributed
3ß1 integrin
(Fig. 5D). In contrast,
ß4(+) cells displayed organized, cortical stress fibers and FAs
(Fig. 5B) with basal laterally
distributed
3ß1 integrin (Fig.
5E), comparable to normal keratinocytes
(Symington et al., 1993
).
Importantly, when compared with ß4(+) cells, ß4(AD) cells had
reduced
3ß1 integrin at sites of cell-cell contact and exhibited
prominent stress fibers, increased focal adhesions (which is a phenotype that
is consistent with enhanced RhoA activity;
Fig. 5C) and clustered basal
3ß1 integrin (Fig.
5F). Furthermore, parallel cultures immunostained with the ß1
integrin activation specific antibody, HUTS-4, suggested that these cells had
a notable increase in ß1 integrin activity
(Fig. 5I). In contrast,
ß4(-) cells had more punctate basal ß1 integrin activation
(Fig. 5G) and ß4(+) cells
had only limited peripheral staining e(Fig.
5H), similar to normal keratinocytes
(Penas et al., 1998
). Using
immunofluorescence, we compared the distribution of ß1 integrin binding
partners (
1,
2,
3,
4,
5) to determine the
specific contribution of different heterodimer partners to this activation
(data not shown). Data showed that only
3 integrin relocalized from
sites of cell-cell to cell-matrix adhesions in association with activated
ß1 integrin in ß4(AD) cells. These data suggested that the
ß4(AD) cell phenotype is potentially linked to enhanced
3ß1
integrin activation at the basal membrane of cells, which is consistent with
focal adhesions.
|
6ß4 integrin controls relocalization and inactivation of
3ß1 integrin through Rac1 activation and suppression of RhoA
Our data indicate that chemotaxis of ß4(AD) cells requires RhoA. RhoA
is essential for the formation of actin stress fibers and focal adhesions and
its functions can be antagonized by Rac1
(Nimnual et al., 2003
;
Sander et al., 1999
). We
therefore asked whether RhoA could play a role in the basal clustering and
activation of
3ß1 integrin and if this could be antagonized by
Rac1 activation through
6ß4 integrin. We expressed inhibitory
N19RhoA or activated V12Rac1 in ß4(AD) cells and recorded their impact
upon the
3ß1 integrin activation and actin cytoskeletal
organization. Both inhibitory RhoA (Fig.
6A, middle row) and activated Rac1
(Fig. 6A, bottom row) prevented
stress fiber formation, basal clustering of
3ß1 integrin and
3ß1 integrin activation. In addition, expression of N19RhoA
induced relocalization of
3ß1 integrin to sites of cell-cell
contact while activated Rac1 enhanced cortical actin staining, reminiscent of
its status in ß4(+) cells. (Interestingly, expression of N19RhoA in
ß4(-) cells was not sufficient to alter the basal distribution of
3ß1 integrin, data not shown.) These studies lead us to conclude
that the cytoskeletal phenotype of ß4 (AD) cells is dependent upon RhoA
and can be inhibited by activating Rac1. Our previous experiments indicated
that
6ß4 ligation permits a sustained EGF-dependent activation of
Rac1. We therefore asked whether inhibition of Rac1 in ß4(+) cells could
recapitulate any of the cytoskeletal characteristics exhibited by ß4 (AD)
cells (Fig. 6B). Expression of
inhibitory N17Rac1 in ß4(+) cells enhanced FA formation, basal clustering
of
3ß1 and ß1 integrin activation
(Fig. 6B, bottom panels).
|
In conclusion, these studies showed that
6ß4 integrin ligation
regulates the cellular localization of a3b1 integrin and tempers its activity
by potentiating Rac1 activity. The coordination of this process is essential
for facilitating EGF-induced chemotaxis via regulation of Rho GTPase
cross-talk.
| Discussion |
|---|
|
|
|---|
6ß4 integrin as a primary control point for
translation of EGF stimulation into keratinocyte migration. By rescuing the
ß4 integrin subunit in ß4-null EB-PA cells we were able to show that
6ß4 integrin and laminin-5 expression are essential for
EGF-induced chemotaxis. However, the relationship between
6ß4
expression and chemotactic signal transduction is complex and appears to be
controlled by the ligand bound status of the ß4 integrin subunit.
We found that ligation of
6ß4 integrin drove chemotaxis by
sustained activation of the Rho family GTPase Rac1. EGF stimulation may result
in Rac1 activation through Fyn-mediated tyrosine phosphorylation of the
ß4 integrin cytoplasmic domain
(Mainiero et al., 1996
;
Mariotti et al., 2001
).
However, at the physiological levels of EGF used in our chemotaxis assays we
did not observe tyrosine phosphorylation of the ß4 subunit. Alternately,
Rac1 activation may be potentiated through increased phosphoinositide 3 kinase
(PI3 kinase) activity following
6ß4 ligation
(Nobes and Hall, 1995
;
Shaw et al., 1997
). Sustained
Rac1 activation appears to redirect
3ß1 integrin away from basal
focal contacts and towards sites of cell-cell contact thereby functioning to
temper its activation state. This implies that
6ß4 integrin
antagonizes
3ß1 integrin through Rac1 to ultimately modulate
signal transduction and thereby regulating cell motility (summarized in
Fig. 7).
|
In the absence of ß4 integrin ligation, Rac1 activation is no longer
sustained and keratinocytes migrate through an alternative chemotactic pathway
that depends upon
3ß1 integrin and RhoA. The nature of this
migration is also less directed and cells exhibit scattering. Interestingly,
recent data have shown that introduction of an attachment-defective
EGFP/ß4 fusion into EB-PA cells also increased keratinocyte migration
(Geuijen and Sonnenberg, 2002
).
This increase was apparently associated with a destabilization of the link
between laminin-5 and the cytoskeleton through plectin. Although a similar
situation may also occur in ß4(AD) cells, this does not explain how EGF
chemotaxis is restored by ß4(AD) expression. In this regard, our data
show that while ß4(-) cells exhibit basal clustering of
3ß1
integrin,
3ß1 activity is reduced and they fail to undergo
chemotaxis in response to EGF stimulation. Thus, expression of ß4(AD)
must facilitate the activation of alternative chemotactic pathways through
effects on EGFR signaling. This activity could arise through destabilization
of hemidesmosome-associated proteins, conformational alterations secondary to
introduction of ß4(AD) or more direct effects on ß4 integrin
activity mediated via loss of ß4 ligation.
Indirect activation of
3ß1 integrin though
ß4(AD)
So how might expression of non-ligated ß4 integrin modulate
3ß1 integrin function? One attractive possibility is that
6ß4 integrin might compete for a regulatory molecule that modifies
3ß1 integrin activation state. For example, members of the
tetraspanin family of cell surface molecules have been shown to modify
integrin function, particularly those of the ß1 integrin family
(Berditchevski and Odintsova,
1999
). At least one member of this family, CD151 also associates
preferentially with
6ß4 integrin
(Sterk et al., 2000
), and
expression of integrin ß4 subunit in EB-PA cells relocates CD151 from
3ß1 to
6ß4 receptor clusters. It is possible that in
our experiments introduction of ß4(AD) results in a competitive
relocalization of tetraspanins away from
3ß1 integrin, which then
alters the conformational activation of
3ß1 integrin.
Direct activation of
3ß1 integrin though ß4(AD)
In a number of tumor systems, the ability of
6ß4 to mediate
invasion and activate PI3K does not require ligation of the ß4 integrin
subunit (Gambaletta et al.,
2000
; Shaw et al.,
1997
). Significantly, part of this process has been elucidated,
since ß4 integrin has an affinity for the hepatocyte growth factor
receptor, Met, and amplifies invasive signals, including PI3 kinase through
Met, irrespective of its ability to ligate with laminins
(Trusolino et al., 2001
). This
signal transduction proceeds via tyrosine phosphorylation of the ß4
integrin subunit. In our experiments, EGF did not mediate tyrosine
phosphorylation of the ß4 subunit in ß4(AD) cells so an analogous
ligand-independent function for EGF does not immediately appear likely.
However, EGFR family member Erbß2, like Met, can associate with ß4
integrin and amplify PI3 kinase activation and invasion independent of
6ß4 ligation, (Gambaletta et
al., 2000
). Therefore, it is possible that loss of
6ß4
ligation may trigger an alternative chemotactic pathway through EGFR that is
independent of tyrosine phosphorylation.
Potential significance of EGFR signaling through
6ß4
integrin during wound healing
Previous studies have ruled out a significant function for
6ß4
integrin in epithelial migration because inhibitory antibodies to
6 or
ß4 fail to markedly impair chemotaxis or wound healing
(Goldfinger et al., 1999
;
Hintermann et al., 2001
;
Nguyen et al., 2000b
). We
suggest that inhibition of
6ß4 ligation results in the activation
of a secondary chemotactic pathway that is dependent upon
3ß1
integrin.
What would be the significance of this antagonstic relationship between
6ß4 and
3ß1 integrins to migrating keratinocytes
during wound healing? Studies have shown that keratinocytes rely on two
distinct pathways for attachment and spreading as cells move across the
provisional dermal collagen matrix (Nguyen
et al., 2000a
). Cells at the wound front in vivo are dependent
upon Rho family GTPases for attachment while cells distal from the wound edge
mediate attachment and spreading via ligation of
6ß4 to secreted
laminin-5 and PI3 kinase activation. These differences in integrin activity
and signaling have been attributed to changes in ECM composition from dermal
collagen to laminin-5. In light of our current observations this model can now
be integrated with the observed functions of
6ß4 in the control of
chemotactic migration. We believe that it is unlikely that keratinocytes make
isolated contact between collagen I and
2ß1 integrin at the front
edge of a wound. Indeed, leading cells highly express unprocessed laminin-5,
and upregulate expression of many integrins including
2ß1,
3ß1 and
6ß4
(Kainulainen et al., 1998
;
Kurpakus et al., 1991
;
Larjava et al., 1993
).
Therefore, growth factor-induced chemotactic signals must be translated from
several of these inputs into a functionally coordinated response.
We suggest that
6ß4 integrin acts as a central control point
for coordinated chemotactic responses during wound healing. At the wound
front, changes in the kinetics of
6ß4 attachment, ECM composition
or its degree of processing, or even the density of laminin-5 deposition
(Geuijen and Sonnenberg, 2002
)
may compromise ligation of
6ß4 integrin resulting in increased
dependence on chemotaxis through
3ß1 integrin. As cells advance,
6ß4 integrin ligates with secreted laminin-5, which enhances Rac1
activity and suppresses
3ß1-dependent chemotaxis. This may be
required to help maintain epithelial cohesion between leading cells and the
epithelial sheet during reepithelialization. In support of this, spatial
activation of Rac1 in epithelial cells plated on laminin has been implicated
in the regulation of cellular cohesion through E-cadherin
(Sander et al., 1998
).
Activated Cdc42 and Rac1 have also been implicated in the maintenance of both
epithelial polarity and formation of tight junctions
(Jou et al., 1998
;
Kroschewski et al., 1999
;
Nobes and Hall, 1999
). Thus,
we conclude, that activation of Rac1 through EGF stimulation of
6ß4 integrin is important for EGF-mediated motility and possibly
for the maintenance of cellular polarity and cohesion during wound
healing.
In summary, we have elucidated a novel mechanism by which
6ß4
integrin coordinates EGF signaling to keratinocytes to mediate chemotaxis. The
divergent nature of this signal transduction may help to explain how
keratinocytes coordinate EGF-stimulated migration and maintain epithelial
integrity while migrating over matrix of changing composition. It may also
help our understanding of the distinct roles of
6ß4 during tumor
progression.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Baker, E. K., Tozer, E. C., Pfaff, M., Shattil, S. J., Loftus,
J. C. and Ginsberg, M. H. (1997). A genetic analysis of
integrin function: Glanzmann thrombasthenia in vitro. Proc. Natl.
Acad. Sci. USA 94,1973
-1978.
Barrandon, Y. and Green, H. (1987). Cell migration is essential for sustained growth of keratinocyte colonies: the roles of transforming growth factor-alpha and epidermal growth factor. Cell 50,1131 -1137.[CrossRef][Medline]
Berditchevski, F. and Odintsova, E. (1999).
Characterization of integrintetraspanin adhesion complexes: role of
tetraspanins in integrin signaling. J. Cell Biol.
146,477
-492.
Carter, W. G., Ryan, M. C. and Gahr, P. J. (1991). Epiligrin, a new cell adhesion ligand for integrin-3-1 in epithelial basement membranes. Cell 65,559 -610.
Dans, M., Gagnoux-Palacios, L., Blaikie, P., Klein, S.,
Mariotti, A. and Giancotti, F. G. (2001). Tyrosine
phosphorylation of the beta 4 integrin cytoplasmic domain mediates Shc
signaling to extracellular signal-regulated kinase and antagonizes formation
of hemidesmosomes. J. Biol. Chem.
276,1494
-1502.
Deng, H., Choate, K. A., Lin, Q. and Khavari, P. A. (1998). High-efficiency gene transfer and pharmacologic selection of genetically engineered human keratinocytes. Biotechniques 25,274 -280.[Medline]
Falcioni, R., Antonini, A., Nistico, P., Di Stefano, S., Crescenzi, M., Natali, P. G. and Sacchi, A. (1997). Alpha 6 beta 4 and alpha 6 beta 1 integrins associate with ErbB-2 in human carcinoma cell lines. Exp. Cell Res. 236, 76-85.[CrossRef][Medline]
Gambaletta, D., Marchetti, A., Benedetti, L., Mercurio, A. M.,
Sacchi, A. and Falcioni, R. (2000). Cooperative signaling
between alpha(6)beta(4) integrin and ErbB-2 receptor is required to promote
phosphatidylinositol 3-kinase-dependent invasion. J. Biol.
Chem. 275,10604
-10610.
Geuijen, C. A. and Sonnenberg, A. (2002).
Dynamics of the alpha6beta4 integrin in keratinocytes. Mol. Biol.
Cell 13,3845
-3858.
Goldfinger, L. E., Hopkinson, S. B., deHart, G. W., Collawm, S., Couchman, J. R. and Jones, J. C. R. (1999). The a3 laminin subunit, a6b4 and a3b1 integrin coordinately regulate wound healing in cultured epithelial cells and in the skin. J. Cell Sci. 112,2615 -2629.[Abstract]
Hintermann, E., Bilban, M., Sharabi, A. and Quaranta, V.
(2001). Inhibitory role of alpha6beta4-associated erbB-2 and
phosphoinositide 3-kinase in keratinocyte haptotactic migration dependent on
alpha3beta1 integrin. J. Cell Biol.
153,465
-478.
Homan, S. M., Mercurio, A. M. and LaFlamme, S. E. (1998). Endothelial cells assemble two distinct alpha6beta4-containing vimentin-associated structures: roles for ligand binding and the beta4 cytoplasmic tail. J. Cell Sci. 111,2717 -2728.[Abstract]
Jou, T. S., Schneeberger, E. E. and Nelson, W. J.
(1998). Structural and functional regulation of tight junctions
by RhoA and Rac1 small GTPases. J. Cell Biol.
142,101
-115.
Kainulainen, T., Hakkinen, L., Hamidi, S., Larjava, K.,
Kallioinen, M., Peltonen, J., Salo, T., Larjava, H. and Oikarinen, A.
(1998). Laminin-5 expression is independent of the injury and the
microenvironment during reepithelialization of wounds. J. Histoch.
Cytochem. 46,353
-360.
Kaur, P., McDougall, J. K. and Cone, R. (1989).
Immortalization of primary human epithelial cells by cloned cervical carcinoma
DNA containing human papillomavirus type 16 E6/E7 open reading frames.
J. Gen. Virol. 70,1261
-1266.
Kinsella, T. M. and Nolan, G. P. (1996). Episomal vectors rapidly and stably produce high-titer recombinant retrovirus. Hum. Gene. Ther. 7,1405 -1413.[Medline]
Kroschewski, R., Hall, A. and Mellman, I. (1999). Cdc42 controls secretory and endocytic transport to the basolateral plasma membrane of MDCK cells. Nat. Cell Biol. 1,8 -13.[CrossRef][Medline]
Kurpakus, M. A., Quaranta, V. and Jones, J. C.
(1991). Surface relocation of alpha 6 beta 4 integrins and
assembly of hemidesmosomes in an in vitro model of wound healing.
J. Cell Biol. 115,1737
-1750.
Larjava, H., Salo, T., Haapasalmi, K., Kramer, R. H. and Heino, J. (1993). Expression of integrins and basement membrane components by wound keratinocytes. J. Clin. Invest. 92,1425 -1435.[Medline]
Lauffenburger, D. A. and Horwitz, A. F. (1996). Cell migration: a physically integrated molecular process. Cell 84,359 -369.[CrossRef][Medline]
Leavesley, D. I., Ferguson, G. D., Wayner, E. A. and Cheresh, D.
A. (1992). Requirement of the integrin beta 3 subunit for
carcinoma cell spreading or migration on vitronectin and fibrinogen.
J. Cell Biol. 117,1101
-1107.
Mainiero, F., Pepe, A., Yeon, M., Ren, Y. and Giancotti, F.
G. (1996). The intracellular functions of alpha6beta4
integrin are regulated by EGF. J. Cell Biol.
134,241
-253.
Marikovsky, M., Breuing, K., Liu, P. Y., Eriksson, E.,
Higashiyama, S., Farber, P., Abraham, J. and Klagsbrun, M.
(1993). Appearance of heparin-binding EGF-like growth factor in
wound fluid as a response to injury. Proc. Natl. Acad. Sci.
USA 90,3889
-3893.
Marinkovich, M. P., Lunstrum, G. P. and Burgeson, R. E.
(1992). The anchoring filament protein kalinin is synthesized and
secreted as a high molecular weight precursor. J. Biol.
Chem. 267,17900
-17906.
Mariotti, A., Kedeshian, P. A., Dans, M., Curatola, A. M.,
Gagnoux-Palacios, L. and Giancotti, F. G. (2001). EGF-R
signaling through Fyn kinase disrupts the function of integrin alpha6beta4 at
hemidesmosomes: role in epithelial cell migration and carcinoma invasion.
J. Cell Biol. 155,447
-458.
Martin, P. (1997). Wound healing - aiming for
perfect skin regeneration. Science
276, 75-81.
Mitchison, T. J. and Cramer, L. P. (1996). Actin-based cell motility and cell locomotion. Cell 84,371 -379.[CrossRef][Medline]
Nguyen, B. P., Gil, S. G. and Carter, W. G.
(2000a). Deposition of laminin 5 by keratinocytes regulates
integrin adhesion and signaling. J. Biol. Chem.
275,31896
-31907.
Nguyen, B. P., Ryan, M. C., Gil, S. G. and Carter, W. G. (2000b). Deposition of laminin 5 in epidermal wounds regulates integrin signaling and adhesion. Curr. Opin. Cell. Biol. 12,554 -562.[CrossRef][Medline]
Nievers, M. G., Kuikman, I., Geerts, D., Leigh, I. M. and Sonnenberg, A. (2000). Formation of hemidesmosome-like structures in the absence of ligand binding by the (alpha)6(beta)4 integrin requires binding of HD1/plectin to the cytoplasmic domain of the (beta)4 integrin subunit. J. Cell Sci. 113,963 -973.[Abstract]
Nievers, M. G., Schaapveld, R. Q., Oomen, L. C., Fontao, L., Geerts, D. and Sonnenberg, A. (1998). Ligand-independent role of the beta 4 integrin subunit in the formation of hemidesmosomes. J. Cell Sci. 111,1659 -1672.[Abstract]
Nimnual, A. S., Taylor, L. J. and Bar-Sagi, D. (2003). Redox-dependent downregulation of Rho by Rac. Nat. Cell Biol. 5,236 -241.[CrossRef][Medline]
Nobes, C. D. and Hall, A. (1995). Rho, rac, and cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia. Cell 81,53 -62.[CrossRef][Medline]
Nobes, C. D. and Hall, A. (1999). Rho GTPases
control polarity, protrusion, and adhesion during cell movement. J.
Cell Biol. 144,1235
-1244.
O'Connor, K. L., Nguyen, B. K. and Mercurio, A. M.
(2000). RhoA function in lamellae formation and migration is
regulated by the alpha6beta4 integrin and cAMP metabolism. J. Cell
Biol. 148,253
-258.
O'Connor, K. L., Shaw, L. M. and Mercurio, A. M.
(1998). Release of cAMP gating by the alpha6beta4 integrin
stimulates lamellae formation and the chemotactic migration of invasive
carcinoma cells. J. Cell Biol.
143,1749
-1760.
Penas, P. F., Gomez, M., Buezo, G. F., Rios, L., Yanez-Mo, M., Cabanas, C., Sanchez-Madrid, F. and Garcia-Diez, A. (1998). Differential expression of activation epitopes of beta1 integrins in psoriasis and normal skin. J. Invest. Dermatol. 111, 19-24.[CrossRef][Medline]
Pilcher, B. K., Dumin, J. A., Sudbeck, B. D., Krane, S. M.,
Welgus, H. G. and Parks, W. C. (1997). The activity of
collagenase-1 is required for keratinocyte migration on a type I collagen
matrix. J. Cell. Biol.
137,1445
-1457.
Pulkkinen, L., Rouan, F., Bruckner-Tuderman, L., Wallerstein, R., Garzon, M., Brown, T., Smith, L., Carter, W. and Uitto, J. (1998). Novel ITGB4 mutations in lethal and nonlethal variants of epidermolysis bullosa with pyloric atresia: missense versus nonsense. Am. J. Human Genet. 63,1376 -1387.[CrossRef][Medline]
Rabinovitz, I. and Mercurio, A. M. (1997). The
integrin alpha6beta4 functions in carcinoma cell migration on laminin-1 by
mediating the formation and stabilization of actin-containing motility
structures. J. Cell Biol.
139,1873
-1884.
Rabinovitz, I., Toker, A. and Mercurio, A. M.
(1999). Protein kinase C-dependent mobilization of the
alpha6beta4 integrin from hemidesmosomes and its association with actin-rich
cell protrusions drive the chemotactic migration of carcinoma cells.
J. Cell Biol. 146,1147
-1160.
Ren, X. D., Kiosses, W. B. and Schwartz, M. A. (1999). Regulation of the small GTP-binding protein Rho by cell adhesion and the cytoskeleton. EMBO J. 18,578 -585.[CrossRef][Medline]
Rousselle, P., Lunstrum, G. P., Keene, D. R. and Burgeson, R.
E. (1991). Kalinin: an epithelium-specific basement membrane
adhesion molecule that is a component of anchoring filaments. J.
Cell Biol. 114,567
-576.
Sander, E. E., ten Klooster, J. P., van Delft, S., van der
Kammen, R. A. and Collard, J. G. (1999). Rac downregulates
Rho activity: reciprocal balance between both GTPases determines cellular
morphology and migratory behavior. J. Cell Biol.
147,1009
-1022.
Sander, E. E., van Delft, S., ten Klooster, J. P., Reid, T., van
der Kammen, R. A., Michiels, F. and Collard, J. G. (1998).
Matrix-dependent Tiam1/Rac signaling in epithelial cells promotes either
cell-cell adhesion or cell migration and is regulated by phosphatidylinositol
3-kinase. J. Cell Biol.
143,1385
-1398.
Shaw, L. M., Rabinovitz, I., Wang, H. H., Toker, A. and Mercurio, A. M. (1997). Activation of phosphoinositide 3-OH kinase by the alpha6beta4 integrin promotes carcinoma invasion. Cell 91,949 -960.[CrossRef][Medline]
Sonnenberg, A., Calafat, J., Janssen, H., Daams, H., van der
Raaio-Helmer, L. M. H., Falcioni, R., Kennel, S. J. and Aplin, J. D.
(1991). Integrin
6ß4 complex is located in
hemidesomosomes, suggesting a major role in epidermal cell-basement membrane
adhesion. J. Cell Biol.
113,907
-917.
Sterk, L. M., Geuijen, C. A., Oomen, L. C., Calafat, J.,
Janssen, H. and Sonnenberg, A. (2000). The tetraspan molecule
CD151, a novel constituent of hemidesmosomes, associates with the integrin
alpha6beta4 and may regulate the spatial organization of hemidesmosomes.
J. Cell Biol. 149,969
-982.
Symington, B. E., Takada, Y. and Carter, W. G.
(1993). Interaction of integrins alpha 3 beta 1 and alpha 2 beta
1: potential role in keratinocyte intercellular adhesion. J. Cell
Biol. 120,523
-535.
Tokumaru, S., Higashiyama, S., Endo, T., Nakagawa, T., Miyagawa,
J. I., Yamamori, K., Hanakawa, Y., Ohmoto, H., Yoshino, K., Shirakata, Y. et
al. (2000). Ectodomain shedding of epidermal growth factor
receptor ligands is required for keratinocyte migration in cutaneous wound
healing. J. Cell Biol.
151,209
-220.
Trusolino, L., Bertotti, A. and Comoglio, P. M. (2001). A Signaling adapter function for alpha6beta4 integrin in the control of HGF-dependent invasive growth. Cell 107,643 -654.[CrossRef][Medline]
Wayner, E. A., Orlando, R. A. and Cheresh, D. A.
(1991). Integrins alpha v beta 3 and alpha v beta 5 contribute to
cell attachment to vitronectin but differentially distribute on the cell
surface. J. Cell Biol.
113,919
-929.
Xia, Y., Gil, S. G. and Carter, W. G. (1996).
Anchorage mediated by integrin alpha6beta4 to laminin 5 (epiligrin) regulates
tyrosine phosphorylation of a membrane-associated 80-kD protein. J.
Cell Biol. 132,727
-740.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
I. C. Schneider, C. K. Hays, and C. M. Waterman Epidermal Growth Factor-induced Contraction Regulates Paxillin Phosphorylation to Temporally Separate Traction Generation from De-adhesion Mol. Biol. Cell, July 1, 2009; 20(13): 3155 - 3167. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Hamill, S. B. Hopkinson, P. DeBiase, and J. C.R. Jones BPAG1e Maintains Keratinocyte Polarity through {beta}4 Integrin-mediated Modulation of Rac 1 and Cofilin Activities Mol. Biol. Cell, June 15, 2009; 20(12): 2954 - 2962. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Huveneers and E. H. J. Danen Adhesion signaling - crosstalk between integrins, Src and Rho J. Cell Sci., April 15, 2009; 122(8): 1059 - 1069. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tran, P. Rousselle, P. Nokelainen, S. Tallapragada, N. T. Nguyen, E. F. Fincher, and M. P. Marinkovich Targeting a Tumor-Specific Laminin Domain Critical for Human Carcinogenesis Cancer Res., April 15, 2008; 68(8): 2885 - 2894. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Taboubi, J. Milanini, E. Delamarre, F. Parat, F. Garrouste, G. Pommier, J. Takasaki, J.-C. Hubaud, H. Kovacic, and M. Lehmann G{alpha}(q/11)-coupled P2Y2 nucleotide receptor inhibits human keratinocyte spreading and migration FASEB J, December 1, 2007; 21(14): 4047 - 4058. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. S. Tan, G. Icre, A. Montagner, B. B.-t. Heggeler, W. Wahli, and L. Michalik The Nuclear Hormone Receptor Peroxisome Proliferator-Activated Receptor {beta}/{delta} Potentiates Cell Chemotactism, Polarization, and Migration Mol. Cell. Biol., October 15, 2007; 27(20): 7161 - 7175. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Friedland, J. N. Lakins, M. G. Kazanietz, J. Chernoff, D. Boettiger, and V. M. Weaver {alpha}6beta4 integrin activates Rac-dependent p21-activated kinase 1 to drive NF-{kappa}B-dependent resistance to apoptosis in 3D mammary acini J. Cell Sci., October 15, 2007; 120(20): 3700 - 3712. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Waterman, N. Sakai, N. T. Nguyen, B. A.J. Horst, D. P. Veitch, C. N. Dey, S. Ortiz-Urda, P. A. Khavari, and M. P. Marinkovich A Laminin-Collagen Complex Drives Human Epidermal Carcinogenesis through Phosphoinositol-3-Kinase Activation Cancer Res., May 1, 2007; 67(9): 4264 - 4270. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Werner, F. Chen, J. V. Moyano, F. Yehiely, J. C. R. Jones, and V. L. Cryns Caspase Proteolysis of the Integrin beta4 Subunit Disrupts Hemidesmosome Assembly, Promotes Apoptosis, and Inhibits Cell Migration J. Biol. Chem., February 23, 2007; 282(8): 5560 - 5569. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. U. Sehgal, P. J. DeBiase, S. Matzno, T.-L. Chew, J. N. Claiborne, S. B. Hopkinson, A. Russell, M. P. Marinkovich, and J. C. R. Jones Integrin beta4 Regulates Migratory Behavior of Keratinocytes by Determining Laminin-332 Organization J. Biol. Chem., November 17, 2006; 281(46): 35487 - 35498. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Pullar, B. S. Baier, Y. Kariya, A. J. Russell, B. A.J. Horst, M. P. Marinkovich, and R. R. Isseroff beta4 Integrin and Epidermal Growth Factor Coordinately Regulate Electric Field-mediated Directional Migration via Rac1 Mol. Biol. Cell, November 1, 2006; 17(11): 4925 - 4935. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. C. Sroka, M. E. Pennington, and A. E. Cress Synthetic D-amino acid peptide inhibits tumor cell motility on laminin-5 Carcinogenesis, September 1, 2006; 27(9): 1748 - 1757. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Natarajan, J. D. Omobono II, Z. Guo, S. Hopkinson, A. J.F. Lazar, T. Brenn, J. C. Jones, and J. G. Rheinwald A Keratinocyte Hypermotility/Growth-Arrest Response Involving Laminin 5 and p16INK4A Activated in Wound Healing and Senescence Am. J. Pathol., June 1, 2006; 168(6): 1821 - 1837. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Wilhelmsen, S. H.M. Litjens, and A. Sonnenberg Multiple Functions of the Integrin {alpha}6{beta}4 in Epidermal Homeostasis and Tumorigenesis Mol. Cell. Biol., April 15, 2006; 26(8): 2877 - 2886. [Full Text] [PDF] |
||||
![]() |
N. T. Chartier, M. Laine, S. Gout, G. Pawlak, C. A. Marie, P. Matos, M. R. Block, and M. R. Jacquier-Sarlin Laminin-5-integrin interaction signals through PI 3-kinase and Rac1b to promote assembly of adherens junctions in HT-29 cells J. Cell Sci., January 1, 2006; 119(1): 31 - 46. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. Nikolopoulos, P. Blaikie, T. Yoshioka, W. Guo, C. Puri, C. Tacchetti, and F. G. Giancotti Targeted Deletion of the Integrin {beta}4 Signaling Domain Suppresses Laminin-5-Dependent Nuclear Entry of Mitogen-Activated Protein Kinases and NF-{kappa}B, Causing Defects in Epidermal Growth and Migration Mol. Cell. Biol., July 15, 2005; 25(14): 6090 - 6102. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Hintermann, N. Yang, D. O'Sullivan, J. M. G. Higgins, and V. Quaranta Integrin {alpha}6{beta}4-erbB2 Complex Inhibits Haptotaxis by Up-regulating E-cadherin Cell-Cell Junctions in Keratinocytes J. Biol. Chem., March 4, 2005; 280(9): 8004 - 8015. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. P. Choma, K. Pumiglia, and C. M. DiPersio Integrin {alpha}3{beta}1 directs the stabilization of a polarized lamellipodium in epithelial cells through activation of Rac1 J. Cell Sci., August 1, 2004; 117(17): 3947 - 3959. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bruewer, A. M. Hopkins, M. E. Hobert, A. Nusrat, and J. L. Madara RhoA, Rac1, and Cdc42 exert distinct effects on epithelial barrier via selective structural and biochemical modulation of junctional proteins and F-actin Am J Physiol Cell Physiol, August 1, 2004; 287(2): C327 - C335. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Zahir, J. N. Lakins, A. Russell, W. Ming, C. Chatterjee, G. I. Rozenberg, M. P. Marinkovich, and V. M. Weaver Autocrine laminin-5 ligates {alpha}6{beta}4 integrin and activates RAC and NF{kappa}B to mediate anchorage-independent survival of mammary tumors J. Cell Biol., December 22, 2003; 163(6): 1397 - 1407. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||