|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 16 September 2003
doi: 10.1242/jcs.00760
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
6ß4 integrin supports cell motility and liver metastasis formation

1 Department of Tumor Progression and Immune Defense, German Cancer Research Center, Heidelberg, Germany
2 Division of Cell Biology, Kihara Institute for Biological Research, Yokohama City University, Yokahama, Japan
3 Department of Applied Genetics, University of Karlsruhe, Karlsruhe, Germany
Author for correspondence (e-mail: m.zoeller{at}dkfz.de)
Accepted 8 July 2003
| Summary |
|---|
|
|
|---|
6ß4 integrin. An antibody-defined molecule was identified by mass spectrometry and cloning as
6ß4 integrin. Transfection-induced expression of
6ß4 in the non-metastasizing subline did not support migration on laminin 5 or tumor progression. However, when the non-metastasizing subline was doubly transfected to express
6ß4 and the D6.1A tetraspanin, intraperitoneally injected tumor cells frequently formed liver metastasis. For the following reasons we assume that metastasis formation is supported by an interaction between
6ß4 and D6.1A. (i) The 2 molecules can associate and co-localize. (ii) Co-localization is strengthened by PKC stimulation. (iii) PKC stimulation, which induces a migratory phenotype, leads to a redistribution of
6ß4/D6.1A complexes. In resting cells, the molecules co-localize at the trail of the cell; during PKC stimulation they become transiently internalized and are (re-)expressed in the leading lamella. Thus, in the appropriate milieu, i.e. intraperitoneally,
6ß4 changes from an adhesion-supporting towards a migration-supporting molecule by its association with a tetraspanin. The findings provide a convincing experimental explanation for the repeatedly described involvement of
6ß4 in tumor progression.
Key words:
6ß4 integrin, Tetraspanin, Metastasis, Adhesion, Motility
| Introduction |
|---|
|
|
|---|
We have described five monoclonal antibodies (mAb) that recognize surface molecules on metastasizing, but not on non-metastasizing rat tumor lines (Claas et al., 1996
; Matzku et al., 1983
). The molecules have been identified as CD44v4-v7 (Günthert et al., 1991
), the tetraspanin D6.1A (Claas et al., 1998
), C4.4A, a molecule with homology to uPAR (Rösel et al., 1998
), D5.7A, the rat homologue of EpCAM (Würfel et al., 1999
) and, described in this report, the
6ß4 integrin. Thus, all five molecules are presumably unaltered gene products and physiological functions of some of them are well described. Interestingly, all five are also known for their involvement in metastasis formation (reviewed by Zöller, 1998
). The
6ß4 integrin is a receptor for laminin, preferentially for laminin 5 (Belkin and Stepp, 1999
; Falk-Marzillier et al., 1998
; Lee et al., 1992
; Nguyen et al., 2000
; Stahl et al., 1997
) and is a major component of hemidesmosomes (Dowling and Fuchs, 1996; Jones et al., 1998
; Niessen et al., 1997
; Nievers et al., 1998
). There are numerous reports that, dependent on the cell type, upregulation or downregulation of
6ß4 is required for tumor progression (reviewed by Mercurio and Rabinovitz, 2001
; Zutter et al., 1998
). In addition, increased motility and invasiveness is linked to PKC activation via the EGFR, which is accompanied by disintegration of hemidesmosomes (Gambaletta et al., 2000
; Maniero et al., 1996
; Rabinovitz et al., 1999
; Rigot et al., 1998
), the formation and stabilization of actin-containing motility structures (Rabinovitz and Mercurio, 1997
) and the stimulation of MMP-2 secretion (Daemi et al., 2000
; Sugiura and Berditchevski, 1999
).
Tetraspanins have been described as molecular facilitators (Claas et al., 2001
; Maecker et al., 1997
; Todres et al., 2000
). They form protein complexes that are mostly composed of different tetraspanins and integrins, but can also contain members of other protein families (Fitter et al., 1999
; Horvath et al., 1998
; Indig et al., 1997
; Lozahic et al., 2000
; Mannion et al., 1996
; Rubinstein et al., 1997
; Scherberich et al., 1998
; Serru et al., 1999
; Sincock et al., 1999
; Tiwari-Woodruff et al., 2001
; Yauch et al., 1998
). The strongest association between tetraspanins and integrins has been described for CD151 and the
3 and
6 integrins (Sincock et al., 1999
; Yauch et al., 1998
; Yauch et al., 2000
). For the rat tetraspanin D6.1A, which is closely related to CD9, we originally noted an association with the
3 and the
6ß1 integrin (Claas et al., 1996
). Meanwhile, an association with the
6ß4 integrin was described for 2 tetraspanins (Baudoux et al., 2000
; Jones et al., 1996
; Sterk et al., 2000
). CD151 associates with
6ß4 within hemidesmosomes (Sterk et al., 2000
), whereas an association between CD9 and
6ß4 has only been observed outside of hemidesmosomes (Baudoux et al., 2000
). The association between tetraspanins and integrins may be accompanied by changes in adhesiveness versus motility (Berditchevski and Odintsova, 1999
; Domanico et al., 1997
; Hinterman et al., 2001; Penas et al., 2000
). As possible underlying mechanisms shedding, internalization and redistribution on the cell membrane have been discussed (Bretscher, 1992
; Friedl et al., 1998
; Gaietta et al., 1994
; Nath et al., 2000
). Tetraspanins are also known to contribute to the metastatic process (Charrin et al., 2001
; Claas et al., 1998
; Odintsova et al., 2000
; Testa et al., 1999
) (reviewed by Levy et al., 1998
).
We have cloned the rat
6ß4 integrin, which is highly expressed on several metastasizing rat tumor lines, and show that
6ß4 expression on locally growing tumor lines does not confer the metastatic phenotype. Instead, there is evidence that co-expression of the
6ß4 integrin and the D6.1A tetraspanin contributes to the hematogeneous spread of tumor cells. Metastatic spread is supported by the acquisition of a motile phenotype via transient internalization and re-expression of the
6ß4 integrin and D6.1A at the leading edge of the tumor cell.
| Materials and Methods |
|---|
|
|
|---|
6 integrin chain were transfected with the ß4 integrin chain cDNA using the pIRESneo vector and selection in G418 (BSp73AS-ß4). Where indicated, the BSp73AS-ß4 cells were cotransfected with the D6.1A cDNA in the pKEX2XR vector and selected in hygromycin (BSp73AS-db). Cells were transfected by electroporation (Eurogentech Easyject, 260V, 1050µF). Positive clones (defined by FACS analysis) were recloned under limiting dilution conditions. BSp73AS cells transfected with the D6.1A cDNA (BSp73AS-D6.1A) have been described elsewhere (Claas et al., 1998
Antibodies and staining procedures
The mAb A2.6 (anti-CD44v6), D6.1 (anti-D6.1A), C4.4 (anti-C4.4A), D5.7 (anti-D5.7A) and B5.5 (anti-
6ß4), A8.10 (undefined specificity) have been described previously (Matzku et al., 1989
). Ox50 (anti-rat CD44), B2C11 (anti-rat CD9) and Ralph3.1 (anti-rat
3) were obtained from the European Collection of Animal Cell Cultures. Hybridoma culture supernatants were purified by protein G-Sepharose FPLC (flow pressure liquid chromatography. Where indicated, purified antibodies were labeled with biotin or fluoresceinisothiocyanate (FITC) or Texas Red (TxR). The rat integrin-specific antibodies anti-ß1, -ß2, -ß4, anti-
1, -
2, -
3, -
4 and -
6, anti-rat CD9 and unlabeled, biotin- and horseradish peroxidase (HRP)-conjugated as well as dye-labeled (FITC, phycoerythrin (PE), Cy-2 and TxR) secondary antibodies and dye-labeled streptavidin as well as TRITC-labeled phalloidin were obtained commercially (Becton Dickinson, Heidelberg, Germany).
Flow cytometry followed routine procedures using 3-5x105 cells per sample. Trypsinized cell were allowed to recover for 2 hours at 37°C in RPMI 1640, 10% fetal calf serum (FCS). Samples were analyzed by FACSCalibur (Becton Dickinson, Heidelberg, Germany).
For immunofluorescence microscopy cells were seeded on cover slides, which had been pretreated with extracellular matrix (ECM) substrates. After spreading, slides were washed, cells were fixed in 4% paraformaldehyde (w/v in PBS) and, where indicated, were permeabilized (4 minutes in 0.1% Triton X-100). After washing and blocking [0.2% gelatin, 0.5% bovine serum albumin (BSA) in PBS], cells were incubated with the primary antibody at pretested concentrations (5-10 µg/ml) in PBS/BSA for 60 minutes at 4°C. Slides were rinsed and subsequently incubated for 60 minutes at 4°C with a fluorochrome-conjugated secondary antibody. After washing, cells were incubated with an excess of unlabeled mouse IgG to block potentially free binding sites of the dye-labeled anti-mouse IgG. Unlabeled mouse IgG was also added during incubation with the second, dye-labeled antibody. Cells were stained with a directly labeled second antibody or with phalloidin-TRITC (0.5 µg/ml) (F-actin) for an additional 60 minutes incubation at 4°C. For cross-linking experiments, cells were incubated at 37°C for 15 minutes with the primary antibody and for 20 minutes with an excess (10 µg/ml) of the secondary, dye-labeled antibody. Cells were washed with ice-cold PBS and all consecutive steps were performed at 4°C. After staining and washing 3 times in PBS and once in H2O, slides were mounted in Elvanol. Digitized images were generated using a Leica DMRBE microscope equipped with a SPOT CCD camera from Diagnostic Instruments Inc. and Software SPOT2.1.2, or using a confocal microscope. Where indicated, cells had been pretreated with phorbolmyristate acetate (PMA) (108 M) for 2 hours.
Substrates
Fibronectin (Fn) and collagen IV (Col IV) were obtained commercially (Sigma, Deisenhofen, Germany). Recombinant human laminin-5 (Ln5) was expressed in HEK293 cells and purified from the conditioned medium by immuno-affinity chromatography as reported recently (Kariya et al., 2002
). In some experiments 804G supernatant was used as a source of Ln5 (Riddelle et al., 1991
). Plates were coated with 10 µg/ml Fn and Col IV, 0.3 µg/ml recombinant Ln5 or undiluted 804G supernatant. After coating, free binding sites were blocked by incubation with PBS/1% BSA.
Purification and cloning of the rat
6 and ß4 integrin
Progressor cells (5x108) were lysed in 25 mM Hepes, pH 7.2, 1% Triton X-114, 500 mM NaCl, 1 mM CaCl2, 1 mM PMSF, diluted to 50 ml and was run over a B5.5-coated Sepharose 4B column. B5.5-bound material was eluted with 50 mM glycine buffer, pH 2.7, 500 mM NaCl, 0.1% Triton X-100 and was neutralized with 1 M Tris-HCl, pH 8.0. Fractions were analyzed by SDS-PAGE. Protein-containing fractions were pooled and precipitated by methanol/chloroform before being loaded on SDS-PAGE gels and stained with Coomassie Blue. Two bands at 200 kDa and 130 kDa were cut out, digested with trypsin and subjected to mass spectrometry.
To define the ß4 isoforms expressed in the metastasizing cells lines BSp73ASML, Progressor and Regressor, an expression analysis by RT-PCR was performed using primers to detect the ß4B (53aa insertion) and ß4C (70aa insertion) isoforms (AGAGGCCCAGCGTTTCAG and <reverse> TACCCGGAACACATAGGAGTG) the primers spanning base pairs 4293-4957 and the ß4D (7aa deletion) isoform (CTCTCTGCAGCTGAGCTGG and <reverse> TCACTGAGGCCAGGAACC) the primers spanning base pairs 5122-5280 (nucleotide numbers are from the rat ß4 sequence u60096, which includes the +53 variant). Total RNA was extracted by the guanidine isothiocyanate/acid phenol method of Chomzynski and Sacchi (Chomzynski and Sacchi, 1987
). cDNA was synthesized from 2 µg total RNA and subjected to PCR amplification using the indicated primers. Amplification was performed at 60°C for 30 cycles.
From the rat
6 integrin chain two short sequences were known, EST AA955091 and a 265 bp fragment kindly provided by Dr L. Feltri, Institute San Rafaele, Milano, Italy (Feltri et al., 1997
). Primers binding to these sequences were used together with pcDNA3-specific primers in an attempt to clone the full-length cDNA from a library of the Regressor line (Claas et al., 1998
). Since the 5' end of the gene was not present in the library, it was cloned by the RACE technique using terminal transferase from 804G cells (submitted to EMB database, accession numbers AJJ12933 and AJJ12934).
For the transfection of BSp73AS cells with the ß4 integrin chain the cDNA was cloned into the pIRESneo vector. Three clones spanning bp 0-3143 (F14), bp 1875-5455 (L7) and bp 3684-5896 (L5) in the pBluescript SK+ vector were kindly provided by Dr L. Feltri (Institute San Rafaele, Milano, Italy). F14 was cut out with EcoRV and HindIII, was blunted and ligated into pIRESneo, which had been digested with EcoRV. L7 was digested with ClaI and BamHI (bp1946-3626) and cloned into pIRESneo-F14. L5 was digested with BamHI (bp 3626-5896) and was ligated into the pIRESneo-F14/L7part. Integrity of the cDNA was controlled by re-cleaving after ligation and association of the clone with the
6 integrin and staining with B5.5 (see below).
For transfecting BSp73AS-ß4 cells with D6.1A cDNA, pcDNA3-D6.1A and pKEX-2XR were digested with EcoRI and XbaI, blunted with Klenow fragment and digested again using NotI. Transfection was done by electroporation.
Immunoprecipitation
Cells (5x106) were lysed in ice-cold lysis buffer (25 mM Hepes, 100 mM NaCl; 1 mM CaCl2, 1 mM MgCl2, pH 7.2) containing 1% CHAPS. Lysis was performed for 1 or 4 hours at 4°C. Lysis buffers contained a protease inhibitor cocktail (Boehringer Mannheim). After centrifugation for 30 minutes at 13000 rpm cell lysates were subjected to immunoprecipitation.
Lysates were precleared by the addition of 10 µg/ml control antibody for 60 minutes followed by incubation with 1/10 volume protein G Sepharose for 2 hours at 4°C. Precleared lysates were incubated for 60 minutes at 4°C with 2 µg of antibody or control IgG. Protein G Sepharose was added for an additional 60 minutes. Immune complexes were washed 4-6 times with lysis buffer. Immunoprecipitated proteins were analyzed by SDS-PAGE, followed by Western blotting.
Western blotting
Lysates were resolved on 10-12% SDS-PAGE under reducing or non-reducing conditions and the proteins were transferred to Immobilon P at 90 V for 90 minutes. After blocking the membranes with 3% BSA, immunoblotting was performed by using the indicated antibodies, followed by donkey anti-mouse-HRP or donkey anti-rabbit-HRP. Blots were developed with the enhanced chemiluminescence detection system.
Cell spreading, adhesion, migration and proliferation
Cell spreading was induced by seeding the tumor cells (1x105/ml in RPMI 1640, 10% FCS) in Petri dishes or on cover slides, which had been precoated with Col IV or Fn or recombinant Ln5 or supernatant of the 804G cell line, which contains Ln5. Cells were incubated at 37°C for various times. Spreading was analyzed by light microscopy.
In adhesion assays, cells were incubated with [3H]thymidine for 16 hours. Cells were washed and seeded in triplicates on substrate-coated flat-bottom 96-well plates. Cells were incubated for 20-120 minutes. Plates were washed vigorously. The remaining adherent cells were detached by incubation in 0.2% trypsin. Plates were harvested using an automatic harvester and were counted in a ß-counter. Where indicated, 10 µg/ml antibodies were added during incubation.
Cell migration was evaluated using a modification of the scratch assay. Petri dishes were coated with substrates as described above. Thereafter, the central area of the Petri dishes was covered with a cover slide (6 mm diameter). Tumor cells were seeded on substrate-coated Petri dishes in RPMI supplemented with 10% FCS. Upon reaching subconfluency, the cover slide was removed. Medium was sucked off, plates were washed to remove non-adherent cells and RPMI supplemented with 1% FCS and, where indicated, 10 µg/ml antibodies were added. Plates were incubated for 72 hours, washed, fixed and stained with Hematoxylin-Eosin. Mean values and standard deviations of the number of cells migrating in the originally cell-free area were evaluated by counting 10 fields of 1 mm2 directly at the boundary towards the originally cell-free area using an inverted microscope at 24, 48 and 72 hours after removal of the cover slide. Fast migrating cells were evaluated by counting cells in the central area of the removed cover slide. Values represent the mean of 3 independently performed experiments.
Proliferative activity was determined by [3H]thymidine incorporation (10 µCi/ml) after seeding 104 tumor cells in triplicates in 96-well flat-bottom plates and incubation for 8 hours at 37°C. Thereafter cells were centrifuged, medium was discarded and adherent cells were detached by trypsin treatment. Cells were harvested and [3H]thymidine incorporation was determined as described above.
Metastasis assay
Tumor cells (2x105) were injected either intrafootpad (i.f.p.) or intraperitoneally (i.p.). When tumors in the footpad reached a mean diameter of 0.5 cm, they were excised (Animal license 089/98). Animals were regularly controlled for the development of lymph node metastases and a palpable mass in the peritoneal cavity. Animals were sacrificed and analyzed macroscopically for the presence of metastases when they became anemic, short breathing or lost weight, or when a palpable mass in the peritoneal cavity or in lymph nodes reached a mean diameter of 2-3 cm.
Statistics
Significance of differences was evaluated using the two-tailed Student's t-test.
| Results |
|---|
|
|
|---|
6 integrin chain
Lysates of the metastasizing tumor line Progressor were loaded on a B5.5-coated Sepharose 4B column. Eluates were run on SDS-PAGE and showed two bands of 130 kDa and 200 kDa (Fig. 1A). Bands were cut out, digested with trypsin, and peptides were subjected to mass spectrometry. The 200 kDa band revealed 26 peaks, of which 18 matched the rat ß4 integrin chain. From the rat
6 integrin cDNA only two short fragments were known. Yet, the 130 kDa band revealed 29 peptides, of which 16 matched the murine
6 integrin chain, suggesting the 130 kDa band to be the rat
6 integrin.
|
Two known rat
6 integrin cDNA fragments, ETS AA955091 and a 265 bp fragment, were obtained from the German Resource Center, Berlin, Germany, and from L. Feltri, Institute San Rafaele, Milano, Italy (Feltri et al., 1997
). Primers designed from these fragments were used in combination with pcDNA3-specific primers to amplify the 5' and 3' ends of the
6 cDNA from the above mentioned library of the Regressor line (see Materials and Methods). The 5' end of the gene was not present in the library and was cloned from 804G cells (see Materials and Methods). The full-length cDNA of the
6 integrin chain was sequenced (accession no. AJJ12933 and AJJ12934). The rat
6 integrin chain shows 94% and 86% identity to mouse and human cDNA, respectively. The homology at the protein level is 96% to mouse and 89% to human
6 (Fig. 2).
|
Expression of ß4 in the tumor line from which the extracts were derived and in two additional metastasizing lines was verified by PCR. Primers for the PCR (see Materials and Methods) had been chosen such that splice variants of the ß4 chain would have become apparent. All three metastasizing lines expressed the ß4A isoform (DeMelker and Sonnenberg, 1999
). The ß4 integrin was not expressed by BSp73AS, a non-metastasizing subline of BSp73 (Fig. 1B).
To prove that the mAb B5.5 recognizes
6ß4, the non-metastasizing BSp73AS line was transfected with the ß4 cDNA. BSp73AS cells are not recognized by B5.5, but express
6ß1, which implies that B5.5 does not recognize
6. After transfection of BSp73AS cells with ß4 cDNA several clones were obtained that were stained by B5.5 (Fig. 1C). Expression of ß1 was reduced in BSp73AS-ß4 clones. This might be due to the efficient association of ß4 with
6, a phenomenon already described (Shaw et al., 1996
). It should be mentioned that the staining of BSp73AS-ß4 cells with B5.5 does not allow any prediction on the binding epitope because ß4 is only expressed in association with
6. Hence, B5.5 might recognize an epitope on ß4 or an epitope made up by
6 and ß4.
Expression of
6ß4 on the non-metastasizing BSp73AS line
Functional activity of
6ß4 was first explored in BSp73AS cells transfected with ß4 cDNA. Expression of
6ß4 on BSp73AS cells was accompanied by a change in cell shape. The epitheloid-like BSp73AS cells became spindle shaped, and staining of the actin cytoskeleton revealed the formation of stress fibers (Fig. 3A).
|
However, expression of
6ß4 in BSp73AS cells had no impact on metastasis formation after intrafootpad tumor cell application (data not shown). Also, the change in cell shape was not accompanied by altered adhesion to either plastic, Fn or Col IV. Adhesion to Ln5, the major ligand of
6ß4, was only slightly improved as compared to BSp73AS cells and only after a short incubation period. However, the metastasizing lines adhered better to Ln5 than to plastic (Fig. 3B). Also,
6ß4 expression on BSp73AS cells had no impact on migration on Ln5. However, in the presence of B5.5, migration of BSp73AS-ß4 cells was slightly improved. The metastasizing Progressor cells readily migrated on Ln5-coated plates. Particularly at later time points, the migratory capacity on Ln5 was strengthened in the presence of B5.5 (Fig. 3C, Table 1). Thus, the question arose of why expression of
6ß4 on BSp73AS-ß4 cells, distinct from BSp73ASML and Progressor cells, had little bearing on adhesion to and migration on Ln5.
|
Co-localization of
6ß4 with the tetraspanin D6.1A
Because expression of
6ß4 on BSp73AS-ß4 cells had no impact on metastasis formation or adhesion to Ln5, we speculated that in metastasizing lines
6ß4 may exert functional activity in concert with additional molecules not present in the non-metastatic BSp73AS line. We first evaluated by antibody cross-linking whether
6ß4 would co-cluster with additional molecules highly overexpressed on metastasizing tumors. Cells were seeded on cover slides and allowed to adhere overnight. Thereafter, cells were incubated with either A2.6 (anti-CD44v6), C4.4 (recognizing the uPAR-related molecule C4.4A), D6.1 (recognizing the tetraspanin D6.1A), D5.7 (anti-EpCAM) or anti-CD9. Bound antibodies were cross-linked with an excess of FITC-labeled anti-mIgG. Thereafter, cells were washed and fixed. Free binding sites of FITC-labeled anti-mouse IgG were blocked by incubation with an excess of unlabeled mouse IgG. Cells were then stained with TxR-labeled B5.5. In fact, cross-linking of CD44v6 and of the tetraspanin D6.1A was associated with coclustering of
6ß4 on BSp73ASML (data not shown) and Progressor cells. Very few
6ß4 molecules were detected in clusters of EpCAM (D5.7A) or the uPAR-related molecule C4.4A. Interestingly,
6ß4 also hardly co-clustered with the tetraspanin CD9 (Fig. 4,Fig. 4). In contrast, after cross-linking of
6ß4, CD44v6 and D6.1A, but not EpCAM or C4.4A co-clustered with
6ß4. However, it should be mentioned that a considerable amount of D6.1A was not detected in
6ß4 clusters (data not shown).
|
|
Because tetraspanins associate in particular with integrins (reviewed by Maecker et al., 1997
), we focussed on the co-localization of
6ß4 and D6.1A. These studies were performed with metastasizing lines and BSp73AS cells transfected with ß4 and D6.1A cDNA (BSp73AS-db). Several BSp73AS-db clones were established. The integrin and tetraspanin expression profile of one characteristic clone in comparison to BSp73AS, BSp73AS-ß4, BSp73AS-D6.1 and the metastasizing lines BSp73ASML, Progressor and 804G is listed in Table 2. All lines express
3,
6 and ß1 at a high level. Only the metastasizing lines (and transfected lines) express
2 and ß4. With the exception of a downregulation of ß1 in BSp73AS-ß4 cells and a slight upregulation of
3 in BSp73AS-db cells, transfection of the non-metastasizing line with ß4 and D6.1A cDNA did not influence integrin expression. Only the metastasizing lines (and by transfection the BSp73AS-D6.1A, BSp73AS-db lines) express the tetraspanin D6.1A. But, all lines express the tetraspanins CD151 (unpublished finding) and CD9.
|
To test, whether D6.1A and
6ß4 also co-localize in the BSp73AS-db line, cells were seeded on Ln5-coated cover slides and were allowed to spread for 48 hours before staining with B5.5/anti-mIgG-FITC and D6.1-TxR or D6.1/anti-mIgG-FITC or anti-CD9/anti-mIgG-FITC and B5.5-TxR. In BSp73AS-db cells,
6ß4 mostly co-localized with D6.1A. D6.1A also co-localized with
6ß4, although a considerable proportion of D6.1A was seen outside of
6ß4 clusters. Only very few
6ß4 molecules co-localized with CD9 (Fig. 5).
|
We next tested whether co-localization of D6.1A and
6ß4 could be verified by co-immunoprecipitation. Progressor cells were lysed for 1 hour at 4°C in the mild detergent CHAPS. Lysates were precipitated with anti-ß4, anti-
3, anti-ß1 and D6.1 and were blotted with D6.1. D6.1A clearly co-precipitated with ß4 and also with
3 and ß1, which has been shown before (Claas et al., 1998
) (Fig. 6A). To control for the specificity of co-precipitation, Progressor cells were biotinylated and precipitated with C4.4 (anti-C4.4A <uPAR-related>), D5.7 (anti-EpCAM), Ox50 (anti-panCD44), anti-CD9, anti-ß4, anti-
6, B5.5, D6.1 and A8.10. CD44, EpCAM and C4.4A are highly expressed on metastasizing lines. mAb A8.10, which recognizes a molecule only detected on BSp73AS cells, served as a negative control. After gel separation, all precipitates were blotted with streptavidin, D6.1 and anti-CD9. D6.1A co-precipitated with
6ß4 (B5.5), ß4 and CD9. Smaller amounts of D6.1A were recovered in the
6 and the CD44 precipitate. It should be mentioned that Progressor cells hardly express the CD44 standard isoform, but large amount of CD44v6, i.e. small amounts of D6.1A co-precipitate with CD44 variant isoforms. There was a very faint co-precipitate with D5.7A (EpCAM), but none with C4.4A and with the control antibody A8.10. A different picture emerged when the precipitates were blotted with anti-CD9. CD9 was only recovered in D6.1 and anti-CD9 precipitates (Fig. 6B). Notably,
6ß4 and D6.1A did not co-immunoprecipitate after lysis in strong detergents like Triton X-100, which argues against a direct association of the two molecules (data not shown).
|
Since the B5.5 and the anti-ß4 precipitates contained only part of D6.1A, the specificity of co-precipitation of the two molecules was controlled by several means. First, using lysates of Progressor cells (CHAPS, 4 hours, 4°C) the ß4 could be re-precipitated from precipitates with B5.5 or D6.1 but not Ox50 or A8.10, although high amounts of precipitate were required to reach the detection limit. Second, when mixing BSp73AS-D6.1A and BSp73AS-ß4 cells, the B5.5 precipitate of the lysate (CHAPS, 4 hours, 4°C) did not contain D6.1A. Yet, it did so when BSp73AS-db cells were lysed (data not shown).
Thus, a small proportion of
6ß4 and D6.1A can be co-precipitated when using mild detergent. To obtain further information on the conditions for this association, we compared co-localization of the two molecules by immunofluorescence microscopy under resting and stimulatory conditions.
Non-random co-localization and redistribution of
6ß4 and D6.1A after PKC activation
PKC was described to regulate integrin-dependent cell motility (Ng et al., 1999
) and to facilitate cell migration (Maniero et al., 1996
). Also, the motility of keratinocytes was modulated when
6ß4 associated with CD9 (Baudoux et al., 2000
). Thus, it became of interest to determine whether PKC activation would be accompanied by changes in co-localization of
6ß4 and D6.1A. The distribution/co-distribution of
6ß4 and D6.1A was evaluated by immunofluorescence in metastatic lines and BSp73AS-db cells. Cells were seeded on Ln5-coated cover slides and were allowed to spread for 48 hours. Thereafter cells were treated for 30 minutes to 2 hours with PMA. Cells were fixed and permeabilized for between 30 minutes and 10 hours after PMA addition. Cell were stained immediately after fixation and permeabilized with either phalloidin-TRITC or were stained with D6.1 or anti-CD9 and were counterstained with B5.5.
PMA treatment was accompanied by changes in the actin cytoskeleton. Growing actin bundles were already seen 1 hour after PMA addition in BSp73AS-db cells. Cells developed long filipodia and spikes. Later on, actin bundles were seen at the front of the leading lamella. Long actin fibres were no longer seen 10 hours after PMA treatment, but organization in fibres was still more pronounced than in untreated cells. Although actin bundle formation was not seen in PMA-treated Progressor cells, the actin distribution clearly changed after PMA treatment. The equal distribution seen in untreated cells was lost, actin was enriched in filipodia and later on it clustered in the body of the cells. From there it moved towards the leading lamella. At 6 hours after PMA treatment actin was strongly enriched in the leading lamella and at 10 hours after PMA treatment at the front of the leading lamella (Fig. 7A).
|
D6.1A and
6ß4 were more or less equally distributed after spreading of Progressor cells on Ln5 (Fig. 6B1). This accounted also for BSp73ASML and BSp73AS-db cells (data not shown). During PMA treatment, Progressor cells developed long filipodia, which were strongly stained by B5.5 and D6.1, whereas the body of the cells became almost devoid of integrin and tetraspanin. After PMA removal, the tetraspanin and
6ß4 were transiently seen in the body of the cells (4 and 6 hours). Ten hours after PMA treatment, lamellae were brightly stained by B5.5 and D6.1. The apparent internalization was not restricted to
6ß4 and D6.1A. Membrane staining of EpCAM was strongly reduced (data not shown) and CD9 rapidly and completely disappeared from the cell membrane. CD9 became strongly enriched in intracellular bodies for up to 8 hours. When PMA-treated and permeabilized Progressor cells were stained with anti-CD9 and B5.5, yellow areas were seen in digital overlays, which could indicate co-localization of CD9 and
6ß4. B5.5 staining of the leading lamella was more pronounced at 10 hours than at 8 hours after PMA treatment. At 10 hours after PMA treatment, CD9 had also reached the front of the leading lamella, however,
6ß4 and CD9 did not generally co-localize at the migratory front of the cells (Fig. 7B2). EpCAM became equally redistributed in the cell membrane and there was no evidence for a selective co-distribution of EpCAM and the
6ß4 integrin (data not shown).
|
A similar redistribution of a6ß4 and D6.1A as described for Progressor cells was seen in BSp73ASML and BSp73AS cells. BSp73ASML cells, which appear round and `unstructured' developed protrusions and lamellae. Protrusions and lamellae were first largely devoid of the integrin and the tetraspanin, which were concentrated intracellularly. Already 6 hours after PMA treatment, lamellae were stained by B5.5 and D6.1. In PMA-treated BSp73AS-db cells co-localization of the integrin and the tetraspanin was mainly seen in spikes and filipodia. Later on, both molecules disappeared from the cell surface and co-localization in the leading lamella was seen only after 10 hours (data not shown).
The redistribution of
6ß4 and D6.1A after PMA treatment was also seen in 804G cells, which were transiently transfected with D6.1A-EYFP cDNA. In the resting state, only a very minor part of D6.1A and
6ß4 co-localized in filipodia. After 30 minutes PMA treatment D6.1A and
6ß4 readily colocalized. After 2 hours of treatment, cells started to migrate with long filipodia at the trailing edge, which was strongly stained by B5.5. D6.1A co-localized with
6ß4 in the trailing edge and in the main body of the cell. As revealed by confocal microscopy at the level of adhesion and 1 µm above (data not shown) and by a sagittal section, the
6ß4-D6.1A complexes forming after PMA treatment were found intracellularly (Fig. 7C). Evidence for cell migration (traces left behind by
6ß4-containing filipodia) (data not shown). Unlike Progressor cells, extension of lamellae could already be seen 2 hours after PMA treatment in 804G cells, at which time the leading lamellae were still mainly devoid of
6ß4.
|
It was also of interest to see whether
6ß4 and D6.1A would re-distribute in PMA-treated BSp73AS cells expressing either
6ß4 or D6.1A. PMA-induced morphological changes of BSp73AS-D6.1A and BSp73AS-ß4 cells were less pronounced than of BSp73AS-db cells. Yet, it appeared that D6.1A was enriched intracellularly after PMA treatment even in the absence of
6ß4. BSp73AS-ß4 cells developed thin filipodia, which were transiently stained by B5.5. During the recovery period
6ß4 was mainly detected intracellularly. Notably, even 12 hours after PMA treatment,
6ß4 did not become enriched in filipodia, protrusions or lamellae as it was seen in Progressor, BSp73ASML and BSp73AS-db cells (data not shown).
Thus, PKC stimulation induced changes in morphology and was accompanied by a redistribution of
6ß4 and of
6ß4-D6.1A `complexes'. The redistribtion of
6ß4-D6.1A `complexes' started with a transient and co-ordinated `internalization' of the molecules. Internalization was also seen in BSp73AS-ß4 and BSp73AS-D6.1A cells and PMA-induced internalization was not restricted to
6ß4 and D6.1A, i.e. CD9 also became internalized. However, re-expression of
6ß4 in the leading lamella was only seen in metastasizing lines and BSp73AS-db cells and was accompanied by co-localization with D6.1A.
D6.1 interferes with functional activity of
6ß4
If our hypothesis holds true that the
6ß4-tetraspanin complex is involved in cell motility, blockade of D6.1A could possibly interfere with adhesive and migratory functions of
6ß4.
It has already been shown that expression of ß4 on BSp73AS cells hardly influenced binding to and migration on Ln5. The same was true for BSp73AS-D6.1A cells (data not shown). Yet, BSp73AS-db cells adhered significantly more strongly to Ln5 than to BSA. Because BSp73AS-db cells express
3 at a slightly increased level as compared to BSp73AS, we first determined whether the increased Ln5 binding could be
3 mediated. Ln5-binding of BSp73ASML, BSp73AS-db, and also of AS-ß4 and AS-D6.1 was slightly reduced in the presence of anti-
3. Yet, even in the presence of anti-
3, an increased percentage of BSp73AS-db adhered to Ln5-coated wells. Furthermore, B5.5 and D6.1, neither of which influenced adhesion of BSp73AS-ß4 and BSp73AS-D6.1A cells to plastic or Ln5, significantly inhibited adhesion of BSp73AS-db cells to Ln5. The same pattern of inhibition of adhesion, though less pronounced, was seen with BSp73ASML and Progressor cells (Fig. 8A). No uniform pattern of adhesion/inhibition of adhesion was seen in PMA-treated cells, which might be due to alteration in expression/configuration of additional adhesion molecules by PKC activation and also to the transient internalization of D6.1A and
6ß4 (data not shown).
|
|
B5.5 had only a minor influence on migration of BSp73AS-ß4 cells (Fig. 3C and Table 1) and D6.1 hardly influenced migration of BSp73AS-D6.1A cells on Ln5-coated plates. Instead, migration of BSp73AS-db and Progressor cells was clearly improved in the presence of B5.5 or, more pronounced, D6.1. Notably, the effect was not seen during the first 24 hours (Tables 2 and 4). Increased migration was not due to an increase in proliferative activity, i.e. [3H]thymidine incorporation in BSp73AS-ß4, BSp73AS-D6.1A, BSp73AS-db, BSp73ASML and Progressor cells did not differ significantly when cells were cultured for 8 hours in the presence or absence of B5.5 or D6.1 (data not shown). PMA treatment, which also had no major impact on tumor cell proliferation (data not shown), strongly supported migration of BSp73AS-db and Progressor cells, while exerting a weaker, though significant effect on BSp73AS, BSp73AS-ß4 and BSp73AS-D6.1A cells. It should be mentioned that BSp73AS-db and Progressor readily spread all over the area initially protected by the cover slide (6 mm diameter), whereas BSp73AS, BSp73AS-ß4 and BSp73AS-D6.1A cells moved more slowly and stepwise (Table 3, Fig. 8B).
|
|
The PMA-induced increased motility of BSp73AS-db cells and metastasizing tumors was in line with the microscopically observed changes in cell shape and the redistribution of
6ß4 and D6.1A. The observation that co-expression of
6ß4 and D6.1A strongly supported migration on Ln5 supported our concept of the linked activity of the two molecules. Thus, it appeared worthwhile to ask whether co-expression of the two molecules might support metastasis formation.
Co-expression of
6ß4 and D6.1A supports liver metastasis formation
The
6ß4 integrin may be important for the early metastatic spread of pancreatic adenocarcinoma (Hermanek, 1998
; Vogelmann et al., 1999
) and metastastic spread of pancreatic tumors is most pronounced when cells settle in the peritoneal cavity (Z'graggen et al., 2001
). One possible explanation could be that in the stimulatory surrounding of the peritoneal cavity the tetraspanin-induced redistribution of
6ß4 accounts for increased metastatic capacity. This hypothesis was tested using BSp73AS tumor clones that differ only in the expression of
6ß4 and D6.1A.
BSp73AS, BSp73AS-ß4, BSp73AS-D6.1A and BSp73AS-db were injected intraperitoneally (Table 4). BSp73AS or BSp73AS-ß4 grew only locally and developed small amounts of non-hemorrhagic ascitic fluid. BSp73AS-D6.1A cells also formed solid nodules in the peritoneal cavity, but developed hemorrhagic ascitic fluid, though only a small amount. Importantly, eight out of 10 rats showed lung metastases and four out of 10 rats liver metastases, 1 rat in each group developed metastases in the kidney and the spleen. The intraperitoneal growth of BSp73AS-db cells differed from the other lines in as much as the tumor formed miliar nodules and massively infiltrated the pancreatic gland. Animals developed high amounts (up to 30 ml) of hemorrhagic ascitic fluid and a massive infiltration of the diaphragm such that tumor cell-containing pleural effusions were generated in 10 out of 12 rats. Lung metastases were only seen in 1 rat, but 11 out of 12 rats developed multiple liver metastases. Thus,
6ß4 by itself does not contribute to tumor progression, whereas the D6.1A tetraspanin supports metastasis formation. However, association of the two molecules increases the metastatic potential (miliary metastases) and is accompanied by a preferential settlement in pancreatic gland and liver.
| Discussion |
|---|
|
|
|---|
6ß4 integrin has repeatedly been reported to be involved in tumor progression. Depending on the tumor type, down- or upregulation has been described (reviewed by Mercurio and Rabinovitz, 2001
6ß4. We had noted high expression of a molecule recognized by the mAb B5.5 exclusively on metastasizing, as opposed to non-metastasizing, tumors of the rat (Claas et al., 1996
6ß4. Transfection of a non-metastasizing line, which is devoid of ß4, with the ß4 cDNA led to expression of the
6ß4 heterodimer, but this did not transfer the metastatic phenotype. However, liver metastases were abundantly observed when the non-metastasizing line co-expressed after cDNA transfection
6ß4 and the tetraspanin D6.1A. Hence, we assume that it is an association between
6ß4 and tetraspanins rather than
6ß4 by itself that supports metastasis formation.
The
6ß4 integrin was purified by affinity chromatography. Two bands of 130 and 200 kDa emerged and were subjected to trypsin digestion. The 200 kDa band represented the ß4 integrin (Feltri et al., 1997
). While human pancreatic and colon carcinoma lines mostly express the ß4C variant isoform (Aplin et al., 1996
; Fornaro and Languino, 1997
), the three metastatic rat lines expressed the ß4A chain. Functional differences between these splice variants are not yet known.
The 130 kDA band showed a high degree of homology to the murine and human
6 integrin. Because the rat
6 cDNA was unknown at the time, the molecule was cloned and sequenced. When a non-metastasizing line, which expresses
6ß1, was transfected with the ß4 cDNA, the cell line readily expressed
6ß4, i.e. cells were stained by the B5.5 mAb, which confirmed the identity of the molecule as
6ß4. A preferential association of
6 with ß4 as compared to ß1 has already been described (Shaw et al., 1996
). Our data confirm this association.
Expression of
6ß4 in BSp73AS cells was accompanied by a change in cell shape. The epitheloid cells became spindle shaped and formed extremely long and very thin filipodia when seeded on substrates. Changes in cell shape were accompanied by the formation of strong actin bundles. Double staining for
6ß4 and the actin cytoskeleton revealed co-localization of these 2 molecules mainly in spikes and filipodia (data not shown). Although in epithelial cells
6ß4 was described not to associate with the actin cytoskeleton (Fontao et al., 1997
; Grassi et al., 1999
), such an association has been seen in, for example, transfected fibroblasts (Rabinovitz et al., 1997).
Although expression of
6ß4 in BSp73AS cells had a bearing on cell shape and actin bundle formation, it hardly influenced adhesion to/migration on Ln5 and did not support metastasis formation. Therefore, we speculated that additional molecules expressed by metastasizing lines may associate with
6ß4 and modulate its activity. Antibody-cross-linking experiments with four molecules, which are highly expressed on metastasizing, but not on non-metastasizing lines, provided evidence for an association of
6ß4 with a CD44 variant isoform and with D6.1A. The
6ß4 hardly co-localized with EpCAM (D5.7A) and not with the uPAR-related C4.4A molecule. Because of the close relationship between tetraspanins D6.1A and CD9 (Claas et al., 1998
) and because CD9 was described as associating with
6ß4 (Baudoux et al., 2000
), we also evaluated whether in the metastasizing rat tumor lines
6ß4 may co-localize with CD9. This has not been the case. Although co-localization does not necessarily imply complex formation, co-immunoprecipitation after lysis in mild detergents confirmed the findings in as much as part of D6.1A was precipitated with anti-ß4 and B5.5 as well as with A2.6. D6.1A was also precipitated with anti-CD9 and vice versa. But, neither anti-ß4-nor B5.5-precipitates contained CD9. The apparent selectivity of the
6ß4-D6.1A co-localization and the fact that tetraspanins are known to modulate the functional activity of integrins (Shaw et al., 1997
) (reviewed by Mercurio and Rabinovitz, 2001
), tempted us to focus on potential consequences of the co-localisation of
6ß4 and D6.1A.
As already mentioned,
6ß4 can associate with the tetraspanin CD151, and CD151 associates with
6ß4 within hemidesmosomes (Sterk et al., 2000
). This has not been the case for the co-localization of the rat
6ß4 with D6.1A. Neither BSp73ASML nor Progressor cells form hemidesmosomes when grown on plastic, expression of
6ß4 is not polarized and the relative amount of co-precipitating
6ß4/D6.1A is not altered after PKC treatment (data not shown). In the bladder carcinoma line 804G, which forms hemidesmosomes and secretes Ln5 (Riddelle et al., 1991
), expression of
6ß4 is polarized. Hemidesmosomes did not contain D6.1A and co-localization/co-immunoprecipitation of
6ß4 and D6.1A was only seen after disintegration of hemidesmosomes by PMA treatment (M. Herlevsen, PhD Thesis, University of Karlsruhe, Germany, 2001). Furthermore, even in BSp73ASML and Progressor cells only part of D6.1A and
6ß4 co-immunoprecipitated and only using a mild detergent. This is in line with the observation that particularly after cross-linking of
6ß4 on the metastasizing lines only part of D6.1A co-clustered with
6ß4 (data not shown). Though an artefact was excluded by appropriate controls, these features strongly argue against a direct association between D6.1A and
6ß4. Because the association of
6ß4 with D6.1A was destroyed by strong detergents and since tetraspanins are known to form multimolecular tetraspanin webs (Charrin et al., 2001
; Claas et al., 2001
; Hemler, 2001
; Levy et al., 1998
; Maecker et al., 1997
), we speculate that (outside hemidesmosomes/after disruption of hemidesmosomes)
6ß4 may associate via a linker molecule with D6.1A. Work is in progress to identify such a linker protein; our studies so far only excluded CD9 as a potential candidate. As outlined above, a considerable amount of D6.1A was recovered in anti-CD9 precipitates and D6.1A also co-localized with CD9 (data not shown). However, CD9 apparently is not the linker between D6.1A and
6ß4 because CD9 failed to co-precipitate with ß4/
6ß4. Because, in contrast, D6.1A co-precipitates with CD9 as well as with
6ß4/ß4, it is tempting to speculate that D6.1A may be found in distinct, non-overlapping membrane protein complexes. Irrespective of this open question, it is important to note that it is the association between
6ß4 and D6.1A that has a bearing on cell adhesion, migration and metastasis formation. This assumption derives from the observation that (i) BSp73AS cells also express the
3ß1 integrin and the tetraspanins CD9 and CD151, but (ii)
6ß4 expression on BSp73AS cells hardly influenced adhesion and migration and had no impact on metastasis formation. Hence, even if D6.1A does not directly associate with
6ß4, current evidence point towards the interaction between these 2 molecules being important for induced cell motility.
A higher percentage of BSp73AS-db cells adhered to Ln5-coated than to uncoated plates. Importantly, binding to Ln5 was inhibited by B5.5 and D6.1 when cells expressed both, but not when cells expressed either
6ß4 or D6.1A. It should be noted that binding to BSA and to a commercially available Ln preparation, which contains unknown amounts of Ln5, was not inhibited (Claas et al., 1998
) (data not shown). Antibody-mediated inhibition of binding was probably not due to blocking of an ECM binding site, because B5.5 should have blocked such an ECM binding domain independent of whether the cells expressed
6ß4 or
6ß4 plus D6.1A. Furthermore, tetraspanins apparently do not possess binding sites for ECM proteins. Therefore, we interpret the findings in the sense that (i) both antibodies interfere with the organization of a tetraspanin web including
6ß4 and D6.1A and (ii) binding of
6ß4 to Ln5 in cells not forming hemidesmosomes may depend on the formation of such tetraspanin webs.
Whereas D6.1 and B5.5 inhibited adhesion, the antibodies supported migration of double-, but not of single-positive cells on Ln5, albeit weakly. One possible explanation could be that the two phenomena, inhibition of binding and support of migration, are linked such that weakening of adhesion results in pronounced migration. We consider an alternative explanation as more likely. Cross-linking of the molecules via the antibody could well support internalization, which for PMA treatment has been shown to induce a migratory phenotype. The fact that the most dramatic changes in the migratory capacity were seen when
6ß4-positive plus D6.1A-positive cells were treated with PMA supports the interpretation. After PKC stimulation both molecules were first enriched at the trail of the cell. Thereafter, they largely disappeared from the cell surface and were later seen in lamellipodia. Importantly, expression of
6ß4 in lamellipodia was only seen after PMA treatment and only in cells expressing both
6ß4 and D6.1A. Thus, PKC stimulation and, probably, antibody cross-linking induces transient internalization of the
6ß4-tetraspanin complex, which could well interfere with adhesion and support cell motility. Whether the internalized complexes are re-expressed or whether new complexes are formed at the leading lamella remains to be explored.
There is increasing evidence that
6ß4 outside hemidesmosomes is involved in actin rearrangement and cell migration (Maniero et al., 1996
; Mercurio and Rabinovitz, 2001
; Odintsova et al., 2000
; Rabinovitz and Mercurio, 1997
; O'Connor et al., 2000
) and thereby influences invasiveness (Daemi et al., 2000
; Gambaletta et al., 2000
; Shaw et al., 1997
). Considering the BSp73AS-db line, our data would certainly support the induction of the migratory phenotype by an association of
6ß4/the
6ß4-D6.1A complex with the actin cytoskeleton. Although we did not observe actin bundle formation in PMA-treated Progressor cells, there has been a redistribution of actin filaments after PMA treatment, which has been similar to the redistribution of
6ß4 and D6.1A. Because Progressor cells also gained in motility and internalized the
6ß4-D6.1A complex after PMA treatment, it remains to be explored whether actin bundle formation is essential for a gain in cell motility. Independent of this open question, our findings support the idea that a concerted activity of the two molecules is important for tumor cell motility.
An increase in tumor cell motility by the D6.1A-
6ß4 `complex' was also supported by the finding of miliar metastasis formation of BSp73AS-db cells after intraperitoneal seeding. There is evidence that the intraperitoneal seeding of pancreatic adenocarcinoma cells is decisive for early metastatic progression (Z'graggen et al., 2001
). In fact, the metastasizing subline BSp73ASML, expressing both
6ß4 and D6.1A, was derived from the ascitic fluid of a rat with a pancreatic adenocarcinoma, whereas the non-metastasizing subline BSp73AS was derived from the locally growing tumor (Matzku et al., 1983
). Neither BSp73AS nor BSp73AS-ß4 (
6ß4+) cells displayed metastatic growth when implanted intraperitoneally. However, BSp73AS-D6.1A (D6.1A+) cells readily metastasized to the lung. Thus, expression of the tetraspanin triggered tumor cell spreading via the lymphatic route. Co-expression of
6ß4 (BSp73AS-db) additionally supported tumor cell dissemination as was apparent by the formation of miliary nodules in the peritoneal cavity and the massive infiltration of the diaphragm. Co-expression of
6ß4 also played a decisive role with respect to the organ preference as evidenced by the reduction in lung metastasis and the massive infiltration of the pancreatic gland and the liver. Because, firstly, in vitro co-localization of
6ß4 and D6.1A was strongly influenced by PKC activation and, secondly, metastasis formation depended on the intraperitoneal application of the tumor cells (i.e. neither pancreatic gland nor liver metastases were seen after subcutaneous tumor cell implantation; data not shown), we hypothesize that the intraperitoneal microenvironment supports metastasis formation by initiating co-localization and transient internalization of
6ß4 and D6.1A. We propose, therefore, that it is not
6ß4 by itself but
6ß4 in association with tetraspanins that facilitates tumor cell motility and, as a consequence, metastasis formation. Transition into a motile state/increased metastasizing capacity can be induced by PKC activation, which supports a
6ß4-tetraspanin complex formation, transient internalization of the complexes and, later on, expression at the leading front of the tumor cell.
| Acknowledgments |
|---|
6 and ß4 cDNA by Dr L. Feltri, Institute San Rafaelo, Milano, Italy. We also want to thank Prof. Dr J. Jones, Northwestern University Medical School, Chicago, USA, for the kind gift of 804G cells. We are most grateful to Dr M. Schnölzer, German Cancer Research Center for mass spectrometry, Dr Spring, German Cancer Research Center, for help of with confocal microscopy and G. Devitt for correction of the English. | Footnotes |
|---|
| References |
|---|
|
|
|---|
Aplin, J. D., Dawson, S. and Seif, M. W. (1996). Abnormal expression of integrin alpha 6 beta 4 in cervical intraepithelial neoplasia. Br. J. Cancer 74, 240-245.[Medline]
Baudoux, B., Castanares-Zapatero, D., Leclercq-Smekens, M., Berna, N. and Poumay, Y. (2000). The tetraspanin CD9 associates with the integrin alpha6beta4 in cultures human epidermal keratinocytes and is involved in cell motility. Eur. J. Cell Biol. 79, 41-51.[CrossRef][Medline]
Belkin, A. M. and Stepp, M. A. (1999). Integrins as receptors for laminin. Microsc. Res. Tech. 51, 280-301.
Berditchevski, F. and Odintsova, E. (1999). Characterization of integrin-tetraspanin adhesion complexes: role of tetraspanins in integrin signaling. J. Cell Biol. 146, 477-492.
Borradori, L. and Sonnenberg, A. (1999). Structure and function of hemidesmosomes: more than simple adhesion complexes. J. Invest. Dermatol. 112, 411-418.[CrossRef][Medline]
Bretscher, M. S. (1992). Circulating integrins:
5ß1,
6ß4 and Mac-1, but not
3ß1,
4ß1 or LFA-1 EMBO J. 11, 405-410.[Medline]
Charrin, S., LeNaour, F., Oualid, M., Billard, M., Faure, G., Hanash, S. M., Boucheix, C. and Rubinstein, E. (2001). The major cd9 and cd81 molecular partner. identification and characterization of the complexes. J. Biol. Chem. 276, 14329-14337.
Chomzynski, P. and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156-159.[Medline]
Claas, C., Herrmann, K., Matzku, M., Möller, P. and Zöller, M. (1996). Developmentally regulated expression of metastasis-associated antigens in the rat. Cell Growth Diff. 7, 663-678.[Abstract]
Claas, C., Seiter, S., Claas, A., Savelyeva, L., Schwab, M. and Zöller, M. (1998). Identification of the rat homologue of CO-029, a metastasis-associated tetraspan molecule. J. Cell Biol. 141, 267-280.
Claas, C., Stipp, C. S. and Hemler, M. E. (2001). Evaluation of prototype transmembrane 4 superfamily protein complexes and their relation to lipid rafts. J. Biol. Chem. 276, 7974-7984.
Daemi, N., Thomasset, N., Lissitzky, J. C., Dumortier, J., Jacquier, M. F., Pourreyron, C., Rousselle, P., Chayvialle, J. A. and Remy, L. (2000). Anti-beta4 integrin antibodies enhance migratory and invasive abilities of human colon adenocarcinoma cells and their MMP-2 expression. Int. J. Cancer 85, 850-856.[CrossRef][Medline]
DeMelker, A. A. and Sonnenberg, A. (1999). Integrins: alternative splicing as a mechanism to regulate ligand binding and integrin signaling events. BioEssays 21, 499-509.[CrossRef][Medline]
Domanico, S. Z., Pelletier, A. J., Havran, W. L. and Quaranta, V. (1997). Integrin alpha6A beta1 induces CD81-dependent cell-motility without engaging the extracellular matrix migration substrate. Mol. Biol. Cell 8, 2253-2265.
Dowling, J., Yu, Q. C. and Fuchs, E. (1996). ß4 integrin is required for hemidesmosome formation, cell adhesion and cell survival J. Cell Biol. 134, 559-572.
Falk-Marzillier, J., Domanico, S. Z., Pelletier, A., Mullen, L. and Quaranta, V. (1998). Characterization of a tight molecular complex between integrin alpha 6 beta 4 and laminin-5 extracellular matrix. Biochem. Biphys. Res. Commun. 251, 49-55.[CrossRef][Medline]
Feltri, M. L., Arona, M., Scherer, S. S. and Wrabetz, L. (1997). Cloning and sequence of the cDNA encoding the beta 4 integrin subunit in rat peripheral nerve. Gene 186, 299-304.[CrossRef][Medline]
Fitter, S., Sincock, P. M., Joliffe, C. N. and Ashman, L. K. (1999). Transmembrane 4 superfamily protein CD151 (PETA-3) associates with beta1 and alpha IIb beta3 integrins in haematopoietic cell lines and modulates cell-cell adhesion. Biochem. J. 338, 61-70.[CrossRef][Medline]
Fontao, L., Dirrig, S., Owaribe, K., Kedinger, M. and Launay, J. F. (1997). Polarized expression of HD1: relationship with the cytoskeleton in cultured human colonic carcinoma cells. Exp. Cell. Res. 231, 319-327.[CrossRef][Medline]
Fornaro, M. and Languino, L. R. (1997). Alternatively spliced variants: a new view of the integrin cytoplasmic domain. Matrix Biol. 16, 185-193.[CrossRef][Medline]
Friedl, P., Brocker, E. B. and Zanker, K. S. (1998). Integrins, cell matrix interactions and cell migration strategies: fundamental differences in leukocytes and tumor cells. Cell Adhes. Commun. 6, 225-236.[Medline]
Gaietta, G., Redelmeier, T. E., Jackson, M. R., Tamura, R. N. and Quaranta, V. (1994). Quantitative measurement of
6ß1 and
6ß4 integrin internalization under cross-linking conditions: a possible role for the
6 cytoplasmic domains. J. Cell. Sci. 107, 3339-3349.[Abstract]
Gambaletta, D., Marchetti, A., Benedetti, L., Mercurion, A. M., Sacchi, A. and Falcioni, R. (2000). Cooperative signaling between alpha(6)beta(4) integrin and ErbB-2 receptor is required to promote phosphatidylinositol 3-kinase-dependent invasion. J. Biol. Chem. 275, 10604-10610.
Grassi, M., Moens, G., Rousselle, P., Thiery, J. P. and Jouanneau, J. (1999). The SFL activity secreted by metastatic carcinoma cells is related to laminin 5 and mediates cell scattering in an integrin-independent manner. J. Cell. Sci. 112, 2511-2520.[Abstract]
Günthert, U., Hofman, M., Rudy, W., Reber, S., Zöller, M., Haußmann, I., Matzku, S., Wenzel, A., Ponta, H. and Herrlich, P. (1991). A new variant of glycoprotein CD44 confers metastatic potential to rat carcinoma cells. Cell 65, 13-24.[CrossRef][Medline]
Hemler, M. E. (2001). Specific tetraspanin functions. J. Cell Biol. 155, 1103-1108.
Hermanek, P. (1998). Pathology and biology of pancreatic ductal adenocarcinoma. Langenbecks Arch. Surg. 383, 116-120.[Medline]
Hintermann, E., Bilban, M., Sharabi, A. and Quaranta, V. (2001). Inhibitory role of alpha6 beta4-associated erbB-2 and phosphoinositide 3-kinase in keratinocyte haptotactic migration dependent on alpha3 beta1 integrin. J. Cell Biol. 153, 465-478.
Horvath, G., Serru, V., Clay, D., Billard, M., Boucheix, C. and Rubinstein, E. (1998). CD19 is linked to the integrin-associated tetraspans CD9, CD81, and CD82. J. Biol. Chem. 273, 30537-30543.
Indig, F. E., Diaz-Gonzales, F. and Ginsberg, M. H. (1997). Analysis of the tetraspanin CD9-integrin alphaIIbbeta3 (GPIIb-IIIa) complex in pletelet membranes and transfected cells. Biochem. J. 327, 291-298.[Medline]
Jones, J. C., Hopkinson, S. B. and Goldfinger, L. E. (1998). Structure and assembly of hemidesmosomes. BioEssays 20, 488-494.[CrossRef][Medline]
Jones, P. H., Bishop, L. A. and Watt, F. M. (1996). Functional significance of CD9 association with beta1 integrins in human epidermal keratinocytes. Cell Adhes. Commun. 4, 297-305.[Medline]
Kariya, Y., Ishida, K., Tsubota, Y., Nakashima, Y., Hirosaki, T., Ogawa, T. and Miyazaki, K. (2002). Efficient expression system of human recombinant laminin-5. J. Biochem. (Tokyo) 132, 607-612.
Lee, E. C., Lotz, M. M., Steele, G. D. and Mercurio, A. M. (1992). The integrin alpha 6 beta 4 is a laminin receptor. J. Cell Biol. 117, 671-678.
Levy, S., Todd, S. C. and Maecker, H. T. (1998). CD81 (TAPA-1): a molcule involved in signal transduction and cell adhesion in the immune system. Ann. Rev. Immunol. 16, 89-109.[CrossRef][Medline]
Lozahic, S., Christiansen, D., Manie, S., Gerlier, D., Billard, M., Boucheix, C. and Rubinstein, E. (2000). CD46 (membrane cofactor protein) associates with multiple beta1 integrins and tetraspans. Eur. J. Immunol. 30, 900-907.[CrossRef][Medline]
MacDonald, N. J. and Steeg, P. S. (1997). Molecular basis of tumour metastasis. Cancer Surv. 16, 175-199.
Maecker, H. T., Todd, S. C. and Levy, S. (1997). The tetraspanin superfamily: molecular facilitators. FASEB J. 11, 428-442.[Abstract]
Maniero, F., Pepe, A., Yeon, M., Ren, Y. and Giancotti, F. G. (1996). The intracellular functions of alpha6beta4 integrin are regulated by EGF. J. Cell Biol. 134, 241-253.
Mannion, B. A., Berditchevski, F., Kraeft, S. K., Chen, L. B. and Hemler, M. E. (1996). Transmembrane-4 superfamily proteins CD81 (TAPA-1), CD82, CD63, and CD53 specifically associate with integrin
4ß1 (CD49d/CD29). J. Immunol. 157, 2039-2047.[Abstract]
Mareel, M. M., VanRoy, F. M. and Bracke, M. E. (1993). How and when do tumor cells metastasize? Crit. Rev. Oncol. 4, 559-594.
Matzku, S., Komitowski, D., Miltenberger, M. and Zöller, M. (1983). Characterization of BSp73, a spontaneous rat tumour and its in vivo selected variants showing different metastasizing capacity. Invasion Metast. 3, 109-123.[Medline]
Matzku, S., Wenzel, A., Liu, S. and Zöller, M. (1989). Antigenic differences between metastatic and non-metastatic rat tumour variants characterized by monoclonal antibodies. Cancer Res. 49, 1294-1299.
Mercurio, A. M. and Rabinovitz, I. (2001). Towards a mechanistic understanding of tumor invasion lessons from the alpha6 beta4 integrin. Semin. Cancer Biol. 11, 129-141.[CrossRef][Medline]
Nath, D., Slocombe, P. M., Webster, A., Stephens, P. E., Docherty, A. J. and Murphy, G. (2000). Meltrin gamma(ADAM-9) mediates cellular adhesion through alpha(6)beta(1)integrin, leading to a marked induction of fibroblast cell motility. J. Cell Sci. 113, 2319-2328.[Abstract]
Ng, T., Shima, D., Squire, A., Bastiaens, P. I. H., Gschmeissner, S., Humphries, M. J. and Parker, P. J. (1999). PKCa regulates ß1 integrin-dependent cell motility through association and control of integrin traffic. EMBO J. 18, 3909-3923.[CrossRef][Medline]
Nguyen, B. P., Gil, S. G. and Carter, W. G. (2000). Deposition of laminin 5 by keratinocytes regulates integrin adhesion and signaling. J. Biol. Chem. 275, 31896-31907.
Niessen, C. M., Hulsman, E. H., Oomen, L. C., Kuikman, I. and Sonnenberg, A. (1997). A minimal region on the integrin beta4 subunit that is critical to its localization in hemidesmosomes regulates the distribution of HD1/plectin in COS-7 cells. J. Cell. Sci. 110, 1705-1716.[Abstract]
Nievers, M. G., Schaapveld, R. Q., Oomen, L. C., Fontao, L., Geerts, D. and Sonnenberg, A. (1998). Ligand-independent role of the beta 4 integrin subunit in the formation of hemidesmosomes. J. Cell Sci. 111, 1659-1672.[Abstract]
O'Connor, K. L., Nguyen, B. K. and Mercurio, A. M. (2000). RhoA function in lamellae formation and migration is regulated by the alpha6 beta4 integrin and cAMP metabolism. J. Cell Biol. 148, 253-258.
Odintsova, E., Sugiura, T. and Berditchevski, F. (2000). Attenuation of EGF receptor signaling by a metastasis suppressor, the tetraspanin CD82/KAI-1. Curr. Biol. 10, 1009-1012.[CrossRef][Medline]
Penas, P. F., Garzia-Diez, A., Sanchez-Madrid, F. and Yanez-Mo, M. (2000). Tetraspanins are localized at motility-related structures and involved in normal human keratinocyte wound healing migration. J. Invest. Dermatol. 114, 1126-1135.[CrossRef][Medline]
Poste, G. and Fidler, I. J. (1980). The pathogenesis of cancer metastasis. Nature 283, 139-146.[CrossRef][Medline]
Rabinovitz, I., Toker, A. and Mercurio, A. M. (1999). Protein kinase C-dependent mobilization of the alpha6beta4 integrin from hemodesmosomes and ist association with actin-rich cell protrusions drive the chemotactic migration of carcinoma cells. J. Cell Biol. 146, 1147-1160.
Rabinovitz, I. and Mercurio, A. M. (1997). The interin
6ß4 functions in carcinoma cell migration on laminin-1 by mediating the formation and stabilization of actin-containing motility structures. J. Cell Biol. 139, 1873-1884.
Reisser, D., Olsson, N. O. and Martin, F. (1993). In vivo and in vitro reactivity of rat spleen cells against regressor and progressor colon-cancer cell variants. Int. J. Cancer 53, 651-656.[Medline]
Riddelle, K. S., Green, K. J. and Jones, J. C. (1991). Formation of hemidesomosomes in vitro by a transformed rat bladder cell line. J. Cell Biol. 112, 159-168.
Rigot, V., Lehmann, M., Andre, F., Daemi, N., Marvaldi, J. and Luis, J. (1998). Integrin ligation and PKC activation are required for migration of colon carcinoma cells. J. Cell. Sci. 111, 3119-3127.[Abstract]
Rösel, M., Claas, C., Herlevsen, M., Seiter, S. and Zöller, M. (1998). Identification of a new phosphatidyl-inositol anchored member of the family of plasminogen activators as metastasis-associated molecule. Oncogene 17, 1989-2002.[CrossRef][Medline]
Rubinstein, E., Poindessous-Jazat, V., LeNaour, F., Billard, M. and Boucheix, C. (1997). CD9, but not other tetraspans, associate with the beta1 integrin precursor. Eur. J. Immunol. 27, 1919-1927.[Medline]
Scherberich, A., Moog, S., Haan-Archipoff, G., Azorsa, D. O., Lanza, F. and Beretz, A. (1998). Tetraspanin CD9 is associated with vary late-acting integrins in human vascular smooth muscle cells and modulates collagen matrix reorganization. Arterioscler. Thromb. Vasc. Biol. 18, 1691-1697.
Serru, V., LeNaour, F., Billard, M., Azorsa, D. O., Lanza, F., Boucheix, C. and Rubinstein, E. (1999). Selective tetraspan-integrin complexes (CD81/alpha4beta1, CD151/alpha3beta1, CD151/alpha6beta1) under conditions disrupting tetraspan interactions. Biochem. J. 340, 103-111.[CrossRef][Medline]
Shaw, L. M., Chao, C., Wewer, U. M. and Mercurio, A. M. (1996). Function of the integrin alpha 6 beta 1 in metastatic breast carcinoma cells assessed by expression of a dominant-negative receptor. Cancer Res. 56, 959-563.
Shaw, L. M., Rabinovitz, I., Wang, H. H., Toker, A. and Mercurio, A. M. (1997). Activation of phosphoinositide 3-OH kinase by the alpha6 beta4 integrin promotes carcinoma invasion. Cell 91, 949-960.[CrossRef][Medline]
Sincock, P. M., Fitter, S., Parton, R. G., Berndt, M. C., Gamble, J. R. and Ashman, L. K. (1999). PETA-3/CD151, a member of the transmembrane 4 superfamily, is localised to the plasma membrane and endocytotic system of endothelial cells, associates with multiple integrins and modulates cell function. J. Cell. Sci. 112, 833-844.[Abstract]
Stahl, S., Weitzman, S. and Jones, J. C. (1997). The role of laminin-5 and its receptor in mammary epithelial cell branching morphogenesis. J. Cell. Sci. 110, 55-63.[Abstract]
Sterk, L. M. T., Geuijen, C. A. W., Oomen, L. C. J. M., Cafat, J., Janssen, H. and Sonneberg, A. (2000). The tetraspanin molecule CD151, a novel constituent of hemidesmosomes, associates with the integrin
6ß4 and may regulate the spatial organization of hemidesmosomes. J. Cell Biol. 149, 969-982.
Sugiura, T. and Berditchevski, F. (1999). Function of alpha3beta1-tetraspanin protein complexes in tumor cell invasion. Evidence for the role of the complexes in production of matrix metalloproteinase 2 (MMP-2). J. Cell Biol. 146, 1375-1389.
Testa, J. E., Brooks, P. C., Lin, J. M. and Quigle, J. P. (1999). Eukaryotic expression cloning with an antimetastatic monoclonal antibody identifies a tetraspanin (PETA-3/CD151) as an effector of human tumor cell migration and metastasis. Cancer Res. 59, 3812-3820.
Tiwari-Woodruff, S. K., Buznikov, A. G., Vu, T. Q., Micevych, P. E., Chen, K., Kornblum, H. I. and Bronstein, J. M. (2001). OSP/claudin-11 forms a complex with a novel member of the tetraspanin super family and beta1 integrin and regulates proliferation and migration of oligodendrocytes. J. Cell Biol. 153, 295-305.
Todres, E., Nardi, J. B. and Robertson, H. M. (2000). The tetraspanin superfamily in insects. Insect. Mol. Biol. 9, 581-590.[CrossRef][Medline]
Vogelmann, R., Kreuser, E. D., Adler, G. and Lutz, M. P. (1999). Integrin alpha6beta1 role in metastatic behavior of human pancreatic carcinoma cells. Int. J. Cancer 80, 791-795.[CrossRef][Medline]
Würfel, J., Rösel, M., Seiter, S., Claas, C., Herlevsen, M., Weth, R. and Zöller, M. (1999). Metastasis association of the rat orthologue of the human epithelial glycoprotein antigen EGP314. Oncogene 18, 2323-2334.[CrossRef][Medline]
Yauch, R. L., Berditchevski, F., Harler, M. B., Reichner, J. and Hemler, M. E. (1998). Highly stoichiometric, stable, and specific association of integrin
3ß1 with CD151 provides a major link to phosphatidylinositol 4-kinase, and may regulate cell migration. Mol. Biol. Cell 9, 2751-2765.
Yauch, R. L., Kazarov, A. R., Desai, B., Lee, R. T. and Hemler, M. E. (2000). Direct extracellular contact between integrin alpha(3)beta(1) and TM4SF protein CD151. J. Biol. Chem. 275, 9230-9238.
Z'graggen, K., Centeno, B. A., Fernandez-delCastillo, C., Jimenez, R. E., Werner, J. and Warshaw, A. L. (2001). Biological implications of tumor cells in blood and bone marrow of pancreatic cancer patients. Surgery 129, 537-546.[CrossRef][Medline]
Zöller, M. (1998). Metastasierung als physiologisches Programm. Nova Acta Leopoldina 78, 55-102.
Zutter, M. M., Sun, H. and Santoro, S. A. (1998). Altered integrin expression and the malignant phenotype: the contribution of multiple integrated integrin receptors. J. Mammary Gland Biol. Neoplasia 3, 191-200.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
D. Xu, C. Sharma, and M. E. Hemler Tetraspanin12 regulates ADAM10-dependent cleavage of amyloid precursor protein FASEB J, November 1, 2009; 23(11): 3674 - 3681. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yoshimura, K. F. Meckel, L. S. Laird, C. Y. Chia, J.-J. Park, K. L. Olino, R. Tsunedomi, T. Harada, N. Iizuka, S. Hazama, et al. Integrin {alpha}2 Mediates Selective Metastasis to the Liver Cancer Res., September 15, 2009; 69(18): 7320 - 7328. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Jarikji, L. D. Horb, F. Shariff, C. A. Mandato, K. W. Y. Cho, and M. E. Horb The tetraspanin Tm4sf3 is localized to the ventral pancreas and regulates fusion of the dorsal and ventral pancreatic buds Development, June 1, 2009; 136(11): 1791 - 1800. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gesierich, I. Berezovskiy, E. Ryschich, and M. Zoller Systemic Induction of the Angiogenesis Switch by the Tetraspanin D6.1A/CO-029. Cancer Res., July 15, 2006; 66(14): 7083 - 7094. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Le Naour, M. Andre, C. Greco, M. Billard, B. Sordat, J.-F. Emile, F. Lanza, C. Boucheix, and E. Rubinstein Profiling of the Tetraspanin Web of Human Colon Cancer Cells Mol. Cell. Proteomics, May 1, 2006; 5(5): 845 - 857. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gesierich, C. Paret, D. Hildebrand, J. Weitz, K. Zgraggen, F. H. Schmitz-Winnenthal, V. Horejsi, O. Yoshie, D. Herlyn, L. K. Ashman, et al. Colocalization of the Tetraspanins, CO-029 and CD151, with Integrins in Human Pancreatic Adenocarcinoma: Impact on Cell Motility Clin. Cancer Res., April 15, 2005; 11(8): 2840 - 2852. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-O. Yoon, S. Shin, and A. M. Mercurio Hypoxia Stimulates Carcinoma Invasion by Stabilizing Microtubules and Promoting the Rab11 Trafficking of the {alpha}6{beta}4 Integrin Cancer Res., April 1, 2005; 65(7): 2761 - 2769. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lu, K. I. Izvolsky, J. Qian, and W. V. Cardoso Identification of FGF10 Targets in the Embryonic Lung Epithelium during Bud Morphogenesis J. Biol. Chem., February 11, 2005; 280(6): 4834 - 4841. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||