|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online October 22, 2003
doi: 10.1242/10.1242/jcs.00764
Research Article |
Ottawa Health Research Institute, 501 Smyth Road, Ottawa, Ontario, Canada K1H 8L6 The University of Ottawa Center for Neuromuscular Disease, Ottawa, Ontario, Canada K1H 8M5 Department of Cellular and Molecular Medicine, and Department of Medicine, University of Ottawa, Ottawa, Ontario, Canada K1H 8M5
* Author for correspondence (e-mail: rkothary{at}ohri.ca)
Accepted 10 July 2003
| Summary |
|---|
|
|
|---|
Key words: Plakin, Cytoskeleton, Microfilaments, Nucleus, Focal adhesions
| Introduction |
|---|
|
|
|---|
Analysis of the cytoskeleton in dt mice has shown that intermediate filaments and microtubules are disorganized in the axons of sensory neurons (Bernier and Kothary, 1998
; Dalpé et al., 1998
; Yang et al., 1999
). An abnormal cytoarchitecture is also observed in the muscle of dt mice, having a reduction in sarcomere length, a thickened z-disk and an abnormal clustering of the mitochondria (Dalpé et al., 1999
). These studies led to the conclusion that the neuronal and muscle isoforms of Bpag1 play a role in maintaining cytoskeletal organization.
The family of proteins in which Bpag1 is included, termed plakins, comprises cytoskeleton binding proteins that are expressed as alternative splice forms (Fuchs and Karakesisoglou, 2001
; Fuchs and Yang, 1999
; Klymkowsky, 1999
). To date, there have been at least five predominant isoforms of Bpag1 identified. One of these is the epithelial isoform, Bpag1e, which consists of a globular N-terminal end (referred to as the plakin domain because it is conserved among the various plakins), a central coiled-coil domain and a C-terminal intermediate filament binding domain (IFBD). Bpag1e (also known as BP230) is encoded by a 9 kb transcript. Nonepithelial Bpag1 has also been identified in the form of two major neuronal (Bpag1a1 and Bpag1a2) and two major muscle (Bpag1b1 and Bpag1b2) isoforms (Leung et al., 2001
). All Bpag1 isoforms share one region in common the plakin domain. Apart from the presence of the plakin domain, the nonepithelial forms of Bpag1 are distinct from Bpag1e.
The neuronal and muscle Bpag1 isoforms share a functional actin binding domain (ABD) upstream of the conserved plakin domain (Brown et al., 1995
; Yang et al., 1996
). This ABD is composed of two classical calponin homology domains, CH1 and CH2, which are similar to those described in
-actinin, ß-spectrin and dystrophin (Dubreuil et al., 1990
; Koenig et al., 1987
; Noegel et al., 1987
; Witke et al., 1986
). In addition to the ABD and the plakin domain, the neuronal and muscle Bpag1 isoforms are characterized by a spectrin repeatcontaining rod domain, putative calcium-regulated EF-hands and a region that shares homology to the growth arrest specific protein 2 (GAS2) (Collavin et al., 1998
; Zucman-Rossi et al., 1996
). This GAS2 homology region includes a microtubule binding domain (MTBD) (Sun et al., 2001
). The predominantly neuronal-specific isoforms, Bpag1a1 and Bpag1a2, are encoded by 17 kb transcripts and predicted to be around 600 kDa (Leung et al., 2001
). The Bpag1 muscle transcripts are identical to their neuronal counterparts but have, in addition, a large exon harboring a second potential IFBD (referred to as IFBD2). These isoforms, Bpag1b1 and Bpag1b2, are encoded by 22 kb transcripts and predicted to be around 800 kDa (Leung et al., 2001
). Diversity is introduced by alternative splicing of exons A and A' at the 5' end of the neuronal and muscle transcripts (Brown et al., 1995
), resulting in unique N-terminal regions upstream of the ABD. In addition to these isoforms, a neuronal isoform lacking a complete ABD has been described (Bpag1n3) (Yang et al., 1999
), although more recent information on the structure of Bpag1 isoforms calls into question the overall structure of Bpag1n3 (Leung et al., 2001
).
The ability of the IFBD1 to associate with keratin, neurofilaments, desmin and peripherin (Dalpé et al., 1999
; Leung et al., 1999a
; Yang et al., 1996
), together with the microtubule binding capability of the MTBD (Sun et al., 2001
) has been shown with fusion proteins in cell transfection assays. Also, the potential of the ABD to bind actin filaments was shown using FLAG and green fluorescent protein (GFP) fusion proteins (Dalpé et al., 1999
; Yang et al., 1996
). Whether the IFBD2 can interact with various intermediate filaments remains to be determined. Collectively, the above studies suggest that endogenous Bpag1 proteins crosslink actin to microtubules in neurons and muscle, and possibly also to intermediate filaments, in the case of the muscle isoforms. However, one aspect that remains unclear is the role of the isoform-specific N-terminal sequences encoded by the alternatively spliced exons A and A'. Also, the need for multiple Bpag1 isoforms and the subcellular localization of endogenous nonepithelial Bpag1 has not been addressed in detail.
In the present study, we have used an isoform-specific antibody against the A' unique region of Bpag1a/b2 to localize the endogenous protein in cultured C2C12 myoblasts. The localization of the endogenous Bpag1a/b2 along stress fibers, but not at their tips, corresponded well with the localization of Bpag1 isoform 2 N-terminal fusion proteins. Unexpectedly, the results with the A' and two Bpag1e antibodies, and with plakin domain-containing fusion proteins, showed that Bpag1 localizes predominantly to the nucleus in C2C12 cells. Furthermore, fusion protein analysis in C2C12 cells showed that the nature of the isoform-specific unique region upstream from the ABD has a major impact both on the way the ABD interacts with the actin cytoskeleton and with the role of the plakin domain region in localizing the protein to the nucleus. These results, in combination with recent results with various plectin isoforms in keratinocytes (Andra et al., 2003
), indicate that unique N-terminal regions are necessary for regulating the localization and function of plakin proteins.
| Materials and Methods |
|---|
|
|
|---|
|
RT-PCR
For cDNA production, equal amounts of total C2C12 and mouse skin RNA was reverse-transcribed in a standard reaction with MuLV reverse transcriptase (Invitrogen). Semiquantitative PCR was performed using 25 cycles in a thermocycler, with the following primer pairs being used: CTACATGTACGTGGAGGAGCA and CATCGTTTGCACCAATGCC for A-ABD; GAGGGCTGTGCTTCGGATAG and CATCGTTTGCACCAATGCC for A'-ABD; GGGTATTTATCTCGAACTCTC and CCCTACTGGGAAGATAGT for IFBD1; GCCAGAGGCTTCTGCTCTATG and GTGACAAAGTAGAGGCTTCGC for IFBD2; CTATCTCTTCGAAGACTTGTC and CAGTTTGGAGACTCCCAGCAG for MTBD; and CCGTCAGGCAGCTCATAGCTCTTC and CTGAACCCTAAGGCCAACCGT for actin. Either a water control for the PCR, or an RT reaction using C2C12 RNA without the MuLV reverse transcriptase (to check for genomic DNA contamination), were performed as controls. All reactions were run on the same gel and exposures shown are all identical, except for the actin bands, which are shown with a reduced exposure time.
Cell culture
Cos-1 and C2C12 cells (ATCC) were cultured in Dulbecco's modified Eagle's medium (DMEM; Cellgro) + 10% fetal bovine serum (FBS) (Gibco/BRL) in plastic culture dishes, and maintained at 37°C in 5% CO2. The cells were seeded onto round glass coverslips in 12-well plates for microscopic analysis. When C2C12 cells were treated with cytochalasin D or nocodazole, the culture media was replaced with media containing the drug one hour before processing for immunocytochemistry. A control with equivalent dilutions of the vehicle for both (DMSO) was also done for comparison.
Bpag1 antibodies
Antisera were produced using synthetic peptide conjugates injected into New Zealand White Rabbits (Washington Biotechnology). The peptide sequence chosen was from the N-terminal unique region of Bpag1 isoform 2 (Fig. 1A). The antiserum was affinity purified against the immunizing peptide, and characterized by detection of the GFP-fusion proteins containing the N-terminal regions of Bpag1 isoform 1 and Bpag1 isoform 2 in Cos-1 cells by immunofluorescence and on immunoblots. Affinity-purified antibody was pre-absorbed with the immunizing peptide as a control for the immunocytochemistry. Anti-Bpag1e antibodies recognizing the C-terminal half of the human Bpag1e isoform were also used (Santa Cruz Biotechnology, and a kind gift from Takashi Hashimoto, Kurume University School of Medicine).
Immunoblot analysis and immunoprecipitation assays
Cell culture lysates were typically collected in RIPA buffer (50 mM Tris-HCl, pH 7.4, 1% NP-40, 150 mM NaCl, 1 mM EDTA and 1% glycerol) containing 1 mM PMSF, 0.01 mg/ml aprotonin, 0.01 mg/ml pepstatin, 0.01 mg/ml leupeptin and 10 mM Na2VO4 on ice. Samples were analyzed by SDS-PAGE on standard 10% polyacrylamide gels according to Laemmli (Laemmli, 1970
), and transferred semi-dry onto a PVDF membrane (Millipore).
Immunoprecipitations against the FLAG epitope were performed with an anti-FLAG polyclonal antibody (Sigma) using lysates from Cos-1 cells that were co-expressing GFP- and FLAG-tagged N-terminal constructs. Lysates were incubated with the polyclonal anti-FLAG antibody for 1 hour at 4°C, following which Protein GSepharose beads (Sigma) were added for an overnight incubation at 4°C. The beads were subsequently washed with RIPA buffer repeatedly, resuspended in sample buffer, boiled, and the supernatant was analyzed by SDS-PAGE. A fraction of each lysate collected was set aside and used for input controls.
Anti-GFP polyclonal (Invitrogen), anti-FLAG monoclonal (M2; Sigma) and anti-FLAG polyclonal antibodies were used according to the manufacturer's instructions.
Immunocytochemistry
Cultured cells were rinsed twice in phosphate-buffered saline (PBS), fixed in 4% paraformaldehyde (J.B. EM Services) for 5-10 minutes, and then rinsed twice for 10 minutes in PBS. The cells were permeabilized and blocked in a solution of 0.4% Triton X-100 and 10% goat serum in PBS for 30 minutes. Samples were then incubated with the first primary antibody in staining buffer [0.04% Triton X-100 with 3.3 mg/ml of bovine serum albumin (Sigma) in PBS] overnight at 4°C. The cells were washed twice for 10 minutes in PBS, followed by incubation with the secondary antibody diluted in staining buffer for 1 hour. Rhodamine-phalloidin (Molecular Probes) was included with the secondary antibody when counter-staining for the actin cytoskeleton. When double-staining using a second primary antibody, the staining procedure was repeated following three washes in PBS for 10 minutes each. After completion of the antibody incubations, the cells were washed three times for 10 minutes, and then mounted in Slowfade Light (Molecular Probes).
The anti-tubulin monoclonal (E7 supernatant) antibody was obtained from the Developmental Studies Hybridoma Bank under the auspices of the NICHD (University of Iowa). Also used were antipaxillin (clone 349; Transduction Laboratories) and anti-FLAG (M5 or rabbit polyclonal; Sigma). GFP signal was observed without staining. Cells were observed using either a Zeiss Axioplan equipped with epifluorescence illumination, or with a Zeiss LSM 410 invert laser-scanning microscope. Digital images were captured using AxioVision 2.05 (Zeiss) or LSM software (Zeiss), and processed with Adobe Photoshop and Adobe Illustrator.
Where quantifications of the observed staining patterns are given from transient transfections, the percentage was obtained from counting cells on at least three coverslips from two or more separate transfections. A minimum of 100 cells from each coverslip was counted. Quantifications of endogenous Bpag1 staining are from a minimum of two separately stained coverslips, with at least 100 cells being counted from each.
| Results |
|---|
|
|
|---|
Bpag1a/b2 localizes to the nucleus and actin stress fibers, but not to focal adhesion sites, in C2C12 myoblasts
Polyclonal antisera against a peptide derived from the sequence in the Bpag1 isoform 2 N-terminal unique exon (A') (Brown et al., 1995
) were produced in rabbits (sequence shown in Fig. 1A). The antisera and affinity-purified antibody recognized the N-terminal region of Bpag1 isoform 2, but not Bpag1 isoform 1, as determined by immunoblot analysis of GFP-fusion proteins (Fig. 2A). The isoform 2 fusion protein, but not the isoform 1 fusion protein, was also detected by this antibody with immunofluorescence in Cos-1 cells expressing the fusion proteins (data not shown). Preabsorption of the antibody with the immunizing peptide eliminated any specific staining of the endogenous protein observed by immunofluorescence (Fig. 2B).
|
Undifferentiated C2C12 myoblasts were used to analyze the subcellular localization of endogenous Bpag1a/b2. The most consistent filamentous staining detected with the A' antibody was a pattern localized in the central area of approximately 5-10% of cells (Fig. 2C). This pattern was typically observed in all of the cells in small clusters away from the center of the coverslips, suggesting that the filamentous localization may be most prominent in cells that are in the process of proliferation and migration, and/or cells with only limited contact with other myoblasts. Some cells also exhibited very bright perinuclear staining (Fig. 2C), although this was less consistent. The filamentous pattern of the A' antibody co-aligned perfectly with the central actin stress fibers of the myoblasts (Fig. 2C,D and Fig. 3A,B). However, A' staining did not co-align with peripheral stress fibers (Fig. 2C,D). Further analysis by confocal microscopy also showed that the Bpag1a/b2 protein co-aligned along varying lengths of the actin stress fibers (Fig. 3A-C).
|
Although filamentous staining was observed only in a small subset of the C2C12 cells, all cells contained varying intensities of staining in the nuclei. In optical sections through the nuclei, staining was noted in all cells imaged in a pattern surrounding the nucleoli (Fig. 3D-F, the same cells as in Fig. 3A-C). This resulted in a `Swiss cheese' pattern of staining in the nuclei. Perinuclear staining was observed in many of the cells (arrows in Fig. 3D). When double-stained using an antibody against the focal contact protein paxillin and the A' antibody, the two signals were always mutually exclusive (Fig. 3G-I). Thus, Bpag1a/b2 is localized to nuclei in all C2C12 myoblast cells, and to centrally located actin stress fibers in a small subset of the cells; it is excluded from focal adhesion sites.
Bpag1a/b2 staining is not dependent on microtubules
To address whether the Bpag1a/b2 protein functions as a crosslinker between actin stress fibers and microtubules, we assessed the pattern of A' staining after disruption of either microfilaments or microtubules in C2C12 cells. To determine whether microfilament disruption would cause a mislocalization of Bpag1a/b2, we used a concentration of cytochalasin D that would disrupt many, but not all, of the actin stress fibers in all of the C2C12 cells. Thus, clusters of cells with some A' staining could be found, and some of the cells within these clusters lacked intact stress fibers. In cells that contained intact actin stress fibers, some co-aligning A' staining could still be observed (Fig. 4A,B, arrows), but no filamentous pattern was observed with the A' antibody in cells that lacked intact stress fibers.
|
Following treatment with nocodazole, which causes microtubule depolymerization, the filamentous pattern of A' staining was retained in C2C12 cells that lacked intact microtubules (Fig. 4C,D). Thus, the localization of Bpag1a/b2 to central stress fibers is not dependent on the presence of intact microtubules. We cannot, however, rule out a role for Bpag1 crosslinking actin filaments and microtubules at certain points along the stress fibers.
Bpag1e antibodies detect protein in the nuclei of C2C12 myoblasts
Bpag1e transcripts are present in C2C12 myoblasts, albeit at low levels (Fig. 1B). We therefore expected that Bpag1e protein would also be produced by the myoblasts. However, Bpag1e is normally located at hemidesmosomes in epithelial cell types and, because such structures have not been reported to be present in C2C12 cells, we wondered whether Bpag1e would be present at the other type of adhesive structure namely, focal contact sites. In a very few myoblasts (<1%), Bpag1e staining was noted in a pattern that corresponded well with focal contact sites, as determined by paxillin doublestaining (Fig. 5A-C). The Bpag1e staining, however, localized with only a subset of the focal contact sites, and overlapped only partially with the paxillin staining.
|
Interestingly, an antibody produced against a peptide from the C-terminal half of human Bpag1e and a human patient serum containing antibody that detects the C-terminal half of human Bpag1e (Ishiko et al., 1993
) produced staining in the nuclei of all C2C12 myoblasts (Fig. 5). Notably, the pattern of staining in the nucleus was consistent with that produced by the A' antibody, with staining being weak or absent in the nucleoli, thus producing a Swiss-cheese pattern of staining in most of the nuclei. Thus, although Bpag1e was observed to localize at adhesion structures as expected, the predominant staining produced with Bpag1e antibodies was nuclear.
Bpag1 N-terminal fusion proteins localize differently and have different effects on microfilament organization
Fusion protein expression plasmids containing the sequence for the N-terminal unique exon of Bpag1 isoform 1 (Nterm1) or Bpag1 isoform 2 (Nterm2) followed by the common ABD, or the ABD alone (Fig. 1C) were assessed in C2C12 cells. These fusion proteins had either GFP or FLAG tagged to the N-terminus (Fig. 1C). N-terminal FLAG tag fusion proteins containing the isoform 1 or 2 unique regions, the ABD, and the plakin domain (Nterm1long and Nterm2long), or the C-terminal half of the plakin domain alone, were also studied (see below). Proteins of the expected sizes for all the expression constructs were detected by immunoblot (Fig. 1C). Because the results for both FLAG and GFP fusion proteins were essentially identical, only the FLAG fusion protein results are shown.
As expected, all of the Bpag1 N-terminal fusion proteins containing the ABD colocalized to the actin cytoskeleton (Figs 6, 9). Expression of the ABD fusion proteins lead to coalignment with the actin stress fibers, as visualized with rhodamine-phalloidin (Fig. 6A-D). In cells expressing the Nterm1 fusion proteins, the staining of the FLAG tag (Fig. 6E-H) and the GFP signal (not shown) displayed a punctate pattern corresponding to aggregated actin cytoskeleton. The collapse of the actin filaments into aggregates may represent a dominant-negative effect. In addition, some of the Nterm1-expressing cells also contained fusion protein colocalizing with thickened filaments. Actin filaments of normal thickness that were observed in these cells did not typically have any co-aligning Nterm1 fusion protein. By contrast, cells expressing the Nterm2 fusion proteins had a normal actin filament network when observed with the FLAG or GFP, and rhodamine-phalloidin labels (Fig. 6I-L and data not shown).
|
|
In about half (48%) of the cells expressing the FLAG-Nterm2, many of the actin stress fibers became thickly bundled and no longer appeared as straight stress fibers (insets in Fig. 6I-K). In GFP-Nterm2-expressing cells, a similar result was obtained, with about one-third (35%) of the cells exhibiting thickly bundled stress fibers. In cells that contained fusion protein co-aligning with normal appearing stress fibers, the Nterm2 fusion proteins localized to the stress fibers differently than the fusion proteins containing only the ABD. Although the ABD and Nterm2 fusion proteins both aligned along most of the length of the stress fibers, the Nterm2 proteins never localized to the ends of the stress fibers (lefthand insets in Fig. 6I-K; arrows in Fig. 6L). The ABD fusion proteins consistently gave a strong signal at the end of the fibers (insets in Fig. 6A-C; arrow in Fig. 6D). Thus, the addition of the N-terminal unique sequence from the Bpag1 isoform 2 prevents targeting of the ABD to actin at the tips of stress fibers.
To confirm that the ABD was localizing to focal contact sites, and that the Nterm2 fusion proteins were excluded from these sites, we labeled FLAG fusion proteinexpressing cells with FLAG and paxillin antibodies (Fig. 7). Cells expressing the FLAG-ABD displayed FLAG staining that colocalized with paxillin staining, as assessed by confocal microscopy (Fig. 7A,B). In cells transfected with the FLAG-Nterm2, only fiber-like staining that was excluded from contact sites was observed with the FLAG antibody (Fig. 7C,D). In addition, although the FLAG-ABD-expressing cells typically displayed extensive paxillin and FLAG staining along the periphery of the cells (arrows in Fig. 7A,B), this type of staining was never seen in FLAG-Nterm2 transfected cells. Thus, it appears that the ABD may localize with focal contact components only if the isoform 2 N-terminus is absent.
|
Bpag1 N-terminal fusion proteins self-associate, but require the upstream unique regions to do so
To explain the actin bundling and aggregation effects observed with Nterm1- and Nterm2-transfected cells, we tested whether these fusion proteins were self-associating. The bundling of actin filaments by a plakin ABD has previously been shown with plectin, and probably occurs via dimerization of the N-terminus (Fontao et al., 2001
). The same study also showed by yeast two-hybrid assay that the N-terminal region of nonepithelial Bpag1 self-associates. However, this selfassociation was shown with only the isoform 2 N-terminal region. We have extended this observation using our FLAG and GFP constructs to determine whether one tagged construct would pull-down the other in an immunoprecipitation assay. Following co-expression of the GFP- and FLAG-Nterm1 or GFP- and FLAG-Nterm2 fusion proteins in Cos-1 cells, the anti-FLAG antibody co-immunoprecipitated the co-expressed GFP-tagged fusion protein from the cell lysate (Fig. 8). However, following co-expression of the GFP-Nterm2 with the FLAG-ABD, the GFP-tagged fusion protein was not coimmunoprecipitated (Fig. 8B, lane 6). The FLAG-Nterm1 and GFP-Nterm2 also associated with each other, whereas the GFP- and FLAG-ABD fusion proteins did not associate with each other (data not shown). These results indicate that the N-terminal regions of neuronal or muscle Bpag1 can dimerize, or potentially multimerize. This would provide a mechanism for bundling microfilaments, as previously shown for plectin (Fontao et al., 2001
), and as observed in this study.
|
The fusion proteins we used that lacked an N-terminal unique region (GFP- and FLAG-ABD) did not allow for dimerization of the N-terminus, which is consistent with their inability to bundle microfilaments (Fig. 6 and data not shown). Although this may indicate that the ABD region requires an upstream region (provided by either the A or A' unique regions) in order to dimerize, we cannot exclude the possibility that both the GFP and the FLAG tags interfered with the ability of the ABD region to dimerize.
The plakin domain is involved in nuclear localization of Bpag1
Addition of the plakin domain to the Nterm1 fusion protein (Nterm1long) did not alter its localization pattern. The Nterm1long fusion protein localized with actin aggregates, just as the Nterm1 fusion protein did (Fig. 9A-C). By contrast, the presence of the plakin domain at the end of Nterm2 (Nterm2long) did have dramatic consequences. The Nterm2long fusion protein, in a pattern consistent with the A' antibody localization, localized to both actin stress fibers and to the nucleus (Fig. 9D-F). An absence of staining was also noted at the ends of the stress fibers with this fusion protein. The majority of Nterm2long-expressing cells, however, contained no obvious stress fiber localization of the protein, and 44% of the expressing myoblasts contained no cytoplasmic localization of the fusion protein at all. Rather, the predominant localization of this fusion protein, observed in almost all expressing myoblasts (99%), was nuclear (Fig. 9G,H), with 56% of the cells also containing cytoplasmic staining that ranged from being filamentous to diffuse. This contrasts sharply with the shorter Nterm2 fusion protein, which did not localize to the nucleus, and always associated with stress fibers or aberrantly bundled actin cables (see Fig. 6I-L). The nuclear pattern of staining was identical to that observed with Bpag1 antibodies in producing a Swisscheese pattern of staining. These results suggested that the addition of the plakin domain caused localization of the protein to the nucleus, and that this localization was influenced by the unique N-terminal sequences.
To examine whether the plakin domain could localize to the nucleus on its own, the C-terminal half of this domain, which contains a putative classical nuclear localization signal (NLS) region [KRRR or PVKRRRI; predicted by PSORTII (http://psort.nibb.ac.jp/)], was expressed as a FLAG-tagged fusion protein (plakinCterm; Fig. 9I). This fusion protein is approximately 69 kDa (see Fig. 1C), and thus is too large to passively localize to the nucleus. Similar to the endogenous Bpag1 proteins and the Nterm2long fusion protein, the plakinCterm protein produced a Swiss-cheese pattern of staining in the nuclei of expressing myoblasts. The plakinCterm protein localized to the nuclei of all expressing myoblasts, and appeared to be exclusively nuclear in 86% of the cells, with additional cytoplasmic staining in the remaining cells.
Within the plakin domain, only the one sequence in the C-terminal half of the domain was predicted to constitute an NLS. If this sequence is of functional significance, it should be conserved between species. Indeed, the PVKRRRI/M motif is conserved between mouse and human Bpag1 (Fig. 10A). This motif is also similar in MACF, but is altered in two other plakins, plectin and periplakin. To demonstrate this motif conclusively as an NLS, we performed two types of experiments. In the first, we used site-directed mutagenesis to alter the NLS within the context of the Nterm2long fusion protein. In the second, we tagged the PVKRRRI peptide sequence (the putative NLS) onto the N-terminal end of the ABD to assess whether it could relocate the ABD fusion protein into the nucleus.
|
A mutated Nterm2long fusion protein had the PVKRRRI changed to PVKAARI (Nterm2long
NLS; Fig. 10B). This change of two amino acids (out of a 1634 amino acid sequence) completely prevented the fusion protein from localizing to the nucleus (Fig. 10D,G). In 100% of transfected cells, staining of the mutant fusion protein appeared to be only cytoplasmic, with obvious stress fiber coalignment in most of the cells (Fig. 10D). This was in sharp contrast to the wild-type Nterm2long fusion protein (Fig. 10C,G).
The addition of the putative NLS to the ABD fusion protein (referred to as FLAG-NLS-ABD; Fig. 10B) also had a dramatic effect. Although only a minority (25%) of the FLAG-ABD-transfected cells contained a light staining in the nucleus (probably due to passive diffusion of this small fusion protein), 57% of the FLAG-NLS-ABD-transfected cells contained strong staining in the nucleus (Fig. 10E-G). In all, 12% of the cells had the fusion protein exclusively in the nucleus, whereas the FLAG-ABD fusion protein was never exclusively nuclear. FLAG-NLS-ABD localization in the cytoplasm appeared diffuse in some cells, but still showed nice co-alignment with stress-fibers in most, indicating that the addition of the NLS before the ABD did not have a major impact on the actin binding ability of the fusion protein.
| Discussion |
|---|
|
|
|---|
The N-terminal organization of other plakin proteins, including plectin and MACF (Acf7), is strikingly similar to that of muscle and neuronal Bpag1 in that they all contain unique sequences just upstream of an ABD (Bernier et al., 1996
; Fuchs et al., 1999
; Karakesisoglou et al., 2000
; Leung et al., 1999b
). The N-terminal unique regions in plectin were hypothesized to optimize its function in a cell-dependent manner. The possibility of differential subcellular localization and function of plectin isoforms containing different N-terminal sequences has recently been addressed within a single cell type, keratinocytes (Andra et al., 2003
). It was shown that alternate N-terminal sequences could determine the localization of plectin isoforms to either hemidesmosomes or to microtubules. Other work has shown that the N-terminus of plectin is able to bundle microfilaments (Fontao et al., 2001
). That plectin may be an important regulator of actin filament dynamics has been shown with cells cultured from plectin null mice, which contain normal microtubule and intermediate filament networks but have aberrant actin stress fiber organization (Andra et al., 1998
). Thus, regulation of plakin protein binding to actin filament, microtubules and adhesion structures via unique N-termini may be an important general feature in determining the function of plakin proteins.
A Bpag1 isoform that co-aligns with actin stress fibers
In C2C12 myoblasts, endogenous Bpag1a/b2 aligned along stretches of actin filaments (Figs 2, 3). The only filamentous pattern of staining observed was along the actin stress fibers. Although microtubules crossed through the area of A' staining in some cells, and strong perinuclear staining in some cells colocalizes with at least some tubulin and intermediate filament staining (not shown), the A' staining was not dependent on the presence of microtubules, as assessed in nocodazole-treated cells (Fig. 4). Also, it is clear that although the A' staining aligned the entire length of some stress fibers, microtubules and intermediate filaments do not normally run in parallel to actin stress fibers. Therefore, although the endogenous Bpag1a/b2 may cross-link microfilaments to microtubules and/or intermediate filaments at restricted points, or in selective situations, its main function may be to help bundle and maintain the integrity of the actin stress fibers. Alternatively, it may interact with other actin filament associated proteins involved in structural or signaling roles.
At the ends of actin stress fibers, it is unlikely that Bpag1a/b2 helps attach the fibers to focal adhesion proteins, given that the isoform 2 unique region excludes Bpag1 from focal contact sites (Figs 6, 7). This makes Bpag1a/b2 distinct from Bpag1e, which has been shown to play a role in anchoring intermediate filaments to membrane adhesion plaques or hemidesmosomes. Other plakins with a similar ABD may localize to focal adhesion sites if using a region upstream from the ABD that does not exclude them from the focal adhesion sites. In this regard, different splice variants of another N-terminal ABD-containing protein, filamin-B, are localized along actin stress fibers either at the focal adhesion sites, or along the length of the fiber excluding the tips (van der Flier et al., 2002
). In contrast to Bpag1, the localization of filamin-B either towards or away from the focal adhesion sites was determined by a hinge region in the C-terminal half of the protein.
Bpag1 localizes to the nucleus
Although we initially expected that Bpag1 antibody staining would produce a staining pattern that was consistent with localization predominantly to cytoskeletal structures, the most prevalent staining with the isoform 2 (A') antibody and with Bpag1e antibodies was nuclear (Fig. 3D-F; Fig. 5). The pattern of nuclear staining was consistent between the antibodies, with the staining being weak or absent in nucleoli. Because the Bpag1e isoform and the longer Bpag1a and Bpag1b isoforms have only the plakin domain in common to their structures (Fig. 1A), we hypothesized that this domain might be involved in the nuclear localization of Bpag1. Indeed, this seems to be true based on the localization of plakin domain-containing fusion proteins (see below).
In epithelial cells, Bpag1e localizes to hemidesmosomes via its plakin domain. This is dependent on binding of N-terminal regions of the plakin domain to hemidesmosomal proteins, BP180 or ß4 integrin (Hopkinson and Jones, 2000
; Koster et al., 2003
). Other than its involvement in targeting to hemidesmosomes, little else is known about the function of the plakin domain. Binding of the N-terminal half of Bpag1e to ERBIN has been described (Favre et al., 2001
), suggesting a link to Erb-B2 receptor signaling, although little has been shown regarding this.
The plakin domain is highly conserved among plakin family members, and if this domain targets proteins to the nucleus, other plakin proteins may also localize to the nucleus. In the case of plectin, the most extensively studied plakin, nuclear localization appears to be limited to an association with the nuclear lamina (Wiche, 1998
). Consistent with this, the NLS in the plakin domain identified in this paper is not conserved in plectin (Fig. 10A), although nuclear localization of plectin may occur via a C-terminal NLS (Nikolic et al., 1996
). At least one other plakin protein, periplakin, has recently been reported to be present within the nucleus (van den Heuvel et al., 2002
). This was observed both with a periplakin antibody and a fulllength periplakin fusion protein. The authors predicted that the nuclear localization may be dependent on a putative NLS outside of the plakin domain, in a region similar to plectin's putative C-terminal NLS, but the region of periplakin responsible for nuclear localization was not examined. Like plectin, however, the NLS in the Bpag1 plakin domain is not conserved in periplakin (Fig. 10A), making it likely that a periplakin NLS would indeed be outside of the plakin domain.
There are several possibilities to explain why a large structural protein would localize to the nucleus. First, it may be sequestered there, and translocate into the cytoplasm to associate with cytoskeletal elements (e.g. actin filaments or focal contacts) when needed. Second, as has been hinted at for periplakin (van den Heuvel et al., 2002
), Bpag1 may play a functional role in the nucleus by associating with other proteins that reside in the nucleus either transiently or over the longterm. Third, Bpag1 may play a structural role in the nucleus. We are currently examining the possibility that Bpag1 interacts with nuclear proteins to address its nuclear localization.
Modulation of Bpag1 ABD localization via unique N-termini
Bpag1 N-terminal fusion proteins differing only in the unique sequence upstream from the ABD have drastically different effects on the actin cytoskeleton when expressed in C2C12 cells. Although overexpression of the Bpag1 isoform 2 N-terminus resulted in a bundling of the microfilaments, overexpression of the Bpag1 isoform 1 N-terminus resulted in an aggregation of the microfilaments (Fig. 6). There is no doubt that the aggregation effect of the isoform 1 fusion proteins was an artifact of overexpressing only the N-terminal region of this protein and may not reflect the function of the endogenous protein. However, the bundling effect and localization of the isoform 2 N-terminal fusion protein was very consistent with the localization of the corresponding endogenous protein. The endogenous isoform 1 protein may associate primarily with nonactin cytoskeletal structures, or it may interact with actin differently in the context of the rest of the protein. This aspect remains to be studied as specific antibodies become available.
The unique N-terminal regions of Bpag1 isoforms 1 and 2 also had differential effects on the localization of fusion proteins harboring the ABD and the plakin domain. Although the Nterm1long fusion protein still localized with actin aggregates, the Nterm2long fusion protein localized predominantly to the nucleus, as well as to actin stress fibers (Fig. 9). The lack of localization of the Nterm1long to the nucleus may be due to a strong affinity of this fusion protein to actin, which would, in turn, keep it associated with actin aggregates, thus preventing it from translocating into the nucleus.
Within the plakin domain, we identified a functional NLS (PVKRRRI), which may be largely responsible for the localization of Bpag1a/b2 and Bpag1e to the nucleus. Mutation of this NLS in the Bpag1a/b2 N-terminus prevented its localization to the nucleus. The addition of the NLS sequence before the ABD in the FLAG-ABD fusion protein caused the translocation of the fusion protein to the nucleus in a majority of the cells, although it did not prevent the actin binding ability of this fusion protein (Fig. 10). Outside of the plakin domain, the only putative NLS sequences in Bpag1a or Bpag1b reside either within the ABD region, which does not localize strongly to the nucleus (Figs 6, 7), or at the C-terminus. Although the C-terminal region alone localizes predominantly to microtubules, it can also localize to the nucleus (Sun et al., 2001
), suggesting that this region may also contribute to the nuclear localization of the endogenous Bpag1a/b2. Notably, the class of NLS identified in this study may be utilized by other large proteins to localize to the nucleus, as it is nearly identical to a putative NLS (PLKRRRV) in the N-terminal region of the predominantly nuclear protein Ki-67 (359 kDa) (Schluter et al., 1993).
In summary, the ability of the Bpag1 isoform 2 N-terminus to bundle microfilaments, possibly via dimerization, and the localization of the Nterm2 and the endogenous protein along the length of actin stress fibers, indicates that Bpag1a/b2 plays a role in regulating actin filament dynamics. Furthermore, this function is determined by the N-terminal unique region, as it was required for appropriate localization of the ABD. That the N-terminus can probably determine the role of an endogenous Bpag1 was indicated by the fact that the localization of Bpag1a/b2 correlated with that of the corresponding N-terminal fusion protein (Nterm2long) in myoblast cells. Surprisingly, the predominant localization of the Bpag1 isoforms observed in this study was in the nucleus. The various localizations of plakin proteins to the cytoskeleton, adhesion structures, organelles, and the nucleus suggests that differences in the structures of individual isoforms may play a role in guiding different isoforms to different structures. Along with recent results with plectin in keratinocytes (Andra et al., 2003
), our data presented here indicates that regulation of localization and function by N-terminal unique sequences may be a common theme in the plakin protein family.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Andra, K., Nikolic, B., Stocher, M., Drenckhahn, D. and Wiche, G. (1998). Not just scaffolding: plectin regulates actin dynamics in cultured cells. Genes Dev. 12, 3442-3451.
Andra, K., Kornacker, I., Jorgl, A., Zorer, M., Spazierer, D., Fuchs, P., Fischer, I. and Wiche, G. (2003). Plectin-isoform-specific rescue of hemidesmosomal defects in plectin (/) keratinocytes. J. Invest. Dermatol. 120, 189-197.[CrossRef][Medline]
Bernier, G. and Kothary, R. (1998). Prenatal onset of axonopathy in Dystonia musculorum mice. Dev. Genet. 22, 160-168.[CrossRef][Medline]
Bernier, G., Brown, A., Dalpé, G., de Repentigny, Y., Mathieu, M. and Kothary, R. (1995). Dystonin expression in the developing nervous system predominates in the neurons that degenerate in dystonia musculorum mutant mice. Mol. Cell. Neurosci. 6, 509-520.[CrossRef][Medline]
Bernier, G., Mathieu, M., de Repentigny, Y., Vidal, S. M. and Kothary, R. (1996). Cloning and characterization of mouse ACF7, a novel member of the dystonin subfamily of actin binding proteins. Genomics 38, 19-29.[CrossRef][Medline]
Brown, A., Bernier, G., Mathieu, M., Rossant, J. and Kothary, R. (1995). The mouse dystonia musculorum gene is a neural isoform of bullous pemphigoid antigen 1. Nat. Genet. 10, 301-306.[CrossRef][Medline]
Collavin, L., Buzzai, M., Saccone, S., Bernard, L., Federico, C., DellaValle, G., Brancolini, C. and Schneider, C. (1998). cDNA characterization and chromosome mapping of the human GAS2 gene. Genomics 48, 265-269.[CrossRef][Medline]
Dalpé, G., Leclerc, N., Vallee, A., Messer, A., Mathieu, M., de Repentigny, Y. and Kothary, R. (1998). Dystonin is essential for maintaining neuronal cytoskeleton organization. Mol. Cell. Neurosci. 10, 243-257.
Dalpé, G., Mathieu, M., Comtois, A., Zhu, E., Wasiak, S., de Repentigny, Y., Leclerc, N. and Kothary, R. (1999). Dystonin-deficient mice exhibit an intrinsic muscle weakness and an instability of skeletal muscle cytoarchitecture. Dev. Biol. 210, 367-380.[CrossRef][Medline]
Dubreuil, R. R., Byers, T. J., Stewart, C. T. and Kiehart, D. P. (1990). A beta-spectrin isoform from Drosophila (beta H) is similar in size to vertebrate dystrophin. J. Cell Biol. 111, 1849-1858.
Duchen, L. W. and Strich, S. J. (1964). Clinical and pathological studies of an hereditary neuropathy in mice. Brain 87, 367-378.
Duchen, L. W., Falconer, D. S. and Strich, S. J. (1963). Dystonia Musculorum. A hereditary neuropathy of mice affecting mainly sensory pathways. J. Physiol. 165, 7-9.
Favre, B., Fontao, L., Koster, J., Shafaatian, R., Jaunin, F., Saurat, J. H., Sonnenberg, A. and Borradori, L. (2001). The hemidesmosomal proteins bullous pemphigoid antigen 1 and the integrin beta 4 subunit bind to ERBIN. J. Biol. Chem. 276, 32427-32436.
Fontao, L., Geerts, D., Kuikman, I., Koster, J., Kramer, D. and Sonnenberg, A. (2001). The interaction of plectin with actin: evidence for cross-linking of actin filaments by dimerization of the actin-binding domain of plectin. J. Cell Sci. 114, 2065-2076.
Fuchs, E. and Yang, Y. (1999). Crossroads on cytoskeletal highways. Cell 98, 547-550.[CrossRef][Medline]
Fuchs, E. and Karakesisoglou, I. (2001). Bridging cytoskeletal intersections. Genes Dev. 15, 1-14.
Fuchs, P., Zorer, M., Rezniczek, G. A., Spazierer, D., Oehler, S., Castanon, M. J., Hauptmann, R. and Wiche, G. (1999). Unusual 5' transcript complexity of plectin isoforms: novel tissue-specific exons modulate actin binding activity. Hum. Mol. Genet. 8, 2461-2472.
Guo, L., Degenstein, L., Dowling, J., Yu, Q. C., Wollmann, R., Perman, B. and Fuchs, E. (1995). Gene targeting of BPAG1: abnormalities in mechanical strength and cell migration in stratified epithelia and neurologic degeneration. Cell 81, 233-243.[CrossRef][Medline]
Hopkinson, S. B. and Jones, J. C. (2000). The N terminus of the transmembrane protein BP180 interacts with the N-terminal domain of BP230, thereby mediating keratin cytoskeleton anchorage to the cell surface at the site of the hemidesmosome. Mol. Biol. Cell 11, 277-286.
Ishiko, A., Shimizu, H., Kikuchi, A., Ebihara, T., Hashimoto, T. and Nishikawa, T. (1993). Human autoantibodies against the 230-kD bullous pemphigoid antigen (BPAG1) bind only to the intracellular domain of the hemidesmosome, whereas those against the 180-kD bullous pemphigoid antigen (BPAG2) bind along the plasma membrane of the hemidesmosome in normal human and swine skin. J. Clin. Invest. 91, 1608-1615.
Jones, J. C., Asmuth, J., Baker, S. E., Langhofer, M., Roth, S. I. and Hopkinson, S. B. (1994). Hemidesmosomes: extracellular matrix/intermediate filament connectors. Exp. Cell Res. 213, 1-11.[CrossRef][Medline]
Karakesisoglou, I., Yang, Y. and Fuchs, E. (2000). An epidermal plakin that integrates actin and microtubule networks at cellular junctions. J. Cell Biol. 149, 195-208.
Klymkowsky, M. W. (1999). Weaving a tangled web: the interconnected cytoskeleton. Nat. Cell Biol. 1, E121-123.[CrossRef][Medline]
Koenig, M., Hoffman, E. P., Bertelson, C. J., Monaco, A. P., Feener, C. and Kunkel, L. M. (1987). Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell 50, 509-517.[CrossRef][Medline]
Koster, J., Geerts, D., Favre, B., Borradori, L. and Sonnenberg, A. (2003). Analysis of the interactions between BP180, BP230, plectin and the integrin alpha6beta4 important for hemidesmosome assembly. J. Cell Sci. 116, 387-399.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.[CrossRef][Medline]
Leung, C. L., Sun, D. and Liem, R. K. (1999a). The intermediate filament protein peripherin is the specific interaction partner of mouse BPAG1-n (dystonin) in neurons. J. Cell Biol. 144, 435-446.
Leung, C. L., Sun, D., Zheng, M., Knowles, D. R. and Liem, R. K. (1999b). Microtubule actin cross-linking factor (MACF): a hybrid of dystonin and dystrophin that can interact with the actin and microtubule cytoskeletons. J. Cell Biol. 147, 1275-1286.
Leung, C. L., Zheng, M., Prater, S. M. and Liem, R. K. (2001). The BPAG1 locus: alternative splicing produces multiple isoforms with distinct cytoskeletal linker domains, including predominant isoforms in neurons and muscles. J. Cell Biol. 154, 691-698.
Mueller, S., Klaus-Kovtun, V. and Stanley, J. R. (1989). A 230-kD basic protein is the major bullous pemphigoid antigen. J. Invest. Dermatol. 92, 33-38.[CrossRef][Medline]
Mutasim, D. F., Takahashi, Y., Labib, R. S., Anhalt, G. J., Patel, H. P. and Diaz, L. A. (1985). A pool of bullous pemphigoid antigen(s) is intracellular and associated with the basal cell cytoskeleton-hemidesmosome complex. J. Invest. Dermatol. 84, 47-53.[CrossRef][Medline]
Nikolic, B., MacNulty, E., Mir, B. and Wiche, G. (1996). Basic amino acid residue cluster within nuclear targeting sequence motif is essential for cytoplasmic plectin-vimentin network junctions. J. Cell Biol. 134, 1455-1467.
Noegel, A., Witke, W. and Schleicher, M. (1987). Calcium-sensitive nonmuscle alpha-actinin contains EF-hand structures and highly conserved regions. FEBS Lett. 221, 391-396.[CrossRef][Medline]
Schulter, C., Duchrow, M., Wohlenberg, C., Becker, M. H. G., Key, G., Flad, H.-D. and Gerdes, J. (1993). The cell proliferation-associated antigen of antibody Ki-67: A very large, ubiquitous nuclear protein with numerous repeated elements, representing a new kind of cell cycle-maintaining proteins. J. Cell Biol. 123, 513-522.
Stanley, J. R., Tanaka, T., Mueller, S., Klaus-Kovtun, V. and Roop, D. (1988). Isolation of complementary DNA for bullous pemphigoid antigen by use of patients' autoantibodies. J. Clin. Invest. 82, 1864-1870.
Sun, D., Leung, C. L. and Liem, R. K. (2001). Characterization of the microtubule binding domain of microtubule actin crosslinking factor (MACF): identification of a novel group of microtubule associated proteins. J. Cell Sci. 114, 161-172.[Abstract]
van den Heuvel, A. P., de Vries-Smits, A. M., van Weeren, P. C., Dijkers, P. F., de Bruyn, K. M., Riedl, J. A. and Burgering, B. M. (2002). Binding of protein kinase B to the plakin family member periplakin. J. Cell Sci. 115, 3957-3966.
van der Flier, A., Kuikman, I., Kramer, D., Geerts, D., Kreft, M., Takafuta, T., Shapiro, S. S. and Sonnenberg, A. (2002). Different splice variants of filamin-B affect myogenesis, subcellular distribution, and determine binding to integrin [beta] subunits. J. Cell Biol. 156, 361-376.
Wiche, G. (1998). Role of plectin in cytoskeleton organization and dynamics. J. Cell Sci. 111, 2477-2486.[Abstract]
Witke, W., Schleicher, M., Lottspeich, F. and Noegel, A. (1986). Studies on the transcription, translation, and structure of alpha-actinin in Dictyostelium discoideum. J. Cell Biol. 103, 969-975.
Yang, Y., Dowling, J., Yu, Q. C., Kouklis, P., Cleveland, D. W. and Fuchs, E. (1996). An essential cytoskeletal linker protein connecting actin microfilaments to intermediate filaments. Cell 86, 655-665.[CrossRef][Medline]
Yang, Y., Bauer, C., Strasser, G., Wollman, R., Julien, J. P. and Fuchs, E. (1999). Integrators of the cytoskeleton that stabilize microtubules. Cell 98, 229-238.[CrossRef][Medline]
Zucman-Rossi, J., Legoix, P. and Thomas, G. (1996). Identification of new members of the Gas2 and Ras families in the 22q12 chromosome region. Genomics 38, 247-254.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||