|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 11 December 2002
doi: 10.1242/jcs.00224
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |

1 Instituto de Investigaciones Biomédicas "Alberto Sols"
(CSIC-UAM), Arturo Duperier, 4, 28029 Madrid, Spain
2 Centro Nacional de Investigaciones Oncológicas, Melchor
Fernández Almagro, 4, 28029 Madrid, Spain
* Present address: Laboratory of Mammalian Cell Biology and Development, The
Rockefeller University. 1230 York Avenue, Box 300. New York, NY 10021,
USA
Author for correspondence (e-mail:
acano{at}iib.uam.es)
Accepted 14 October 2002
| Summary |
|---|
|
|
|---|
Key words: Slug, E-cadherin, Epithelial to mesenchymal transition (EMT)
| Introduction |
|---|
|
|
|---|
EF-1) and SIP-1 (ZEB-2), have
been recently characterized as transcriptional repressors of
E-cadherin acting through interaction with specific E-boxes of the
proximal promoter (Cano et al.,
2000
The zinc finger factor Snail belongs to the Snail superfamily of
transcriptional repressors (Hemavathy et
al., 2000
; Nieto,
2002
), in which other relevant members are found, such as Slug.
Mouse Snail and Slug share a high degree of homology both at the N-terminal
region, with the SNAG transactivation domain, and the C-terminal region
containing four and five zinc fingers, respectively
(Manzanares et al., 2001
).
However, they differ in the intermediate P-S rich region, with Slug members
containing a specific 29 amino-acid sequence, called the Slug domain
(Manzanares et al., 2001
).
Gain- and loss-of-function studies have indeed established the role of Slug in
triggering EMTs in defined regions of the chick and Xenopus embryos
(Nieto et al., 1994
;
Carl et al., 1999
;
La Bonne and Bronner-Fraser,
2000
; Del Barrio and Nieto,
2002
). These evidences suggest that Slug could also participate in
the repression of E-cadherin expression. However, other observations
have not supported such a repressor role for Slug, since overexpression of
Slug in rat bladder carcinoma cells was not able to repress
E-cadherin but instead induced desmosome dissociation
(Savagner et al., 1997
) and
our previous analysis in a collection of mouse epidermal keratinocyte cell
lines did not show any correlation between E-cadherin and
Slug expression profiles (Cano et
al., 2000
). These apparent discrepancies can either indicate
intrinsic functional differences between Slug and Snail factors in relation to
E-cadherin regulation or reflect the specific contribution of different
cellular contexts in which both factors could act as repressors.
In order to get further insights into the function of Slug and Snail factors in relation to E-cadherin expression, we have analyzed the potential role of Slug as a repressor in parallel to Snail using the prototypic epithelial cell system of MDCK cells. Here we show that stable expression of Slug in MDCK cells leads to a full EMT associated with the complete repression of E-cadherin expression, increased expression of mesenchymal markers and acquisition of a highly migratory behaviour. The phenotypic effects induced by ectopic Slug expression in MDCK cells are apparently independent of the endogenous Snail expression as no significant changes in Snail mRNA levels or in Snail promoter activity were detected in MDCK-Slug transfected cells. Binding analysis indicates that Slug binds specifically to the E-boxes of the E-pal repressor element of the mouse E-cadherin promoter although, interestingly, with lower affinity than Snail and E47 repressors. These results indicate that Slug and Snail are functionally equivalent as E-cadherin repressors and that both factors can contribute to EMTs and/or the maintenance of the mesenchymal/migratory phenotype depending of their relative concentrations and/or the specific cellular and tissue context.
| Materials and Methods |
|---|
|
|
|---|
The complete cDNA sequence of mouse Slug was obtained by
introducing the UGA stop codon from the previously described mSlug
cDNA (Sefton et al., 1998
) by
PCR and was subcloned into the pcDNA3 expression vector (Invitrogen) under the
control of the cytomegalovirus promoter. To obtain the GST-mSlug fusion
construct, the 843 bp coding sequence of mSlug was restriction
excised from the pcDNA3 construct and subcloned into the pGEX4T1 vector
(Pharmacia Biotech) in frame with the gluthatione-S-transferase (GST) protein.
Similarly, the full cDNA sequence of mouse Snail
(Cano et al., 2000
) was cloned
in the pGEX4T1 vector. The sequences of the fusion constructs were verified by
automatic sequencing from both ends using several internal oligonucleotides
covering the full sequence. The generation of GST-mE47 construct has been
recently described (Perez-Moreno et al.,
2001
). Production and purification of the recombinant GST-fusion
proteins was carried out following standard procedures.
Generation of anti-Slug and anti-Snail sera
Polyclonal antibodies against GST-Snail and GST-Slug recombinant proteins
were generated by injection into rabbits following standard procedures. The
sera obtained from both kinds of injection were purified by affinity
chromatography using the corresponding recombinant proteins linked to
sepharose CNBr-columns (Pharmacia Biotech.).
Stable transfections
MDCK-II cells, grown in DMEM medium (Gibco BRL) in the presence of 10% FBS,
10 mM glutamine and antibiotics were transfected with 3 µg of
pcDNA3-mSlug or control pcDNA3 vector as recently described
(Cano et al., 2000
;
Perez-Moreno et al., 2001
)
using the Lipofectamine Plus reagent (Gibco BRL). Stable transfectants were
generated after selection with 400 µg/ml G418 during three to four weeks.
Four independent clones were isolated from pcDNA3-Slug, one of which
was further subcloned by limited dilution, and six independent clones were
isolated from control pcDNA3 transfections. The generation of
MDCK-Snail cells has been previously reported
(Cano et al., 2000
).
RT-PCR analysis
Total RNA was isolated from the different cell lines, and RT-PCR analyses
were carried out as previously described
(Cano et al., 2000
;
Perez-Moreno et al., 2001
).
Mouse and canine PCR products were obtained after 30-35 cycles of
amplification with an annealing temperature of 60-65°C. Primer sequences
were as follows. For mouse Slug, forward: 5'
CGCGAATTCCCGCCCGCAGCCACC 3'; reverse: 5'
ACTCTCGAGCTAGTGTCAATGGGCGAC 3' (amplifies a fragment of 843 bp). For
canine E-cadherin (sequence kindly provided by Y. Chen, Harvard
Medical School), forward: 5' GGAATCCTTGGAGGGATCCTC 3'; reverse:
5' GTCGTCCTCGCCACCGCCGTACAT 3' (amplifies a fragment of 560 bp).
For canine Snail, forward: 5' CCCAAGCCCAGCCGATGAG 3';
reverse: 5' CTTGGCCACGGAGAGCCC 3' (amplifies a fragment of 200
bp). For mouse and canine glyceraldehyde-3-phosphate dehydrogenase
(GADPH), forward: 5' TGAAGGTCGGTGTGAACGGATTTGGC 3'; reverse:
5' CATGTAGGCCATGAGGTCCACCAC 3' (amplifies a fragment of 900
bp).
E-cadherin and Snail promoter analysis
The mouse E-cadherin promoter sequences (-178 to +92) in its
wild-type and mutant Epal (mEpal) version were excised by XbaI
restriction from the chloramphenicol acetyltransferase (CAT) reporter
gene (Behrens et al., 1991
) and
cloned into the NheI site of pGL2 vector (Invitrogen) fused to a
firefly Luciferase reporter gene (-178 wild-type and mEpal-luciferase
constructs, respectively). A 900 bp fragment of the mouse Snail
5' upstream sequences (containing nucleotides 8 to 905 of the reported
proximal sequences of the mouse Snail gene)
(Jiang et al., 1997
) was
amplified by PCR from a 5 kb genomic clone (a gift of T. Gridley, Jackson
Laboratories, USA) using specific oligonucleotides linked to BamHI
and KpnI restriction sites and cloned into the same restriction sites
in the pXP1 vector fused to the Luciferase reporter gene. A mutation
into an E-box element located at the -221 position of the mouse Snail
gene (Jiang et al., 1997
) was
introduced by three cycles of PCR-directed mutagenesis using specific primers
carrying the specific mutations (5' CACCTG 3' to 5'
TGCCTG 3'). To determine the activity of the E-cadherin
and Snail promoters, cells were transiently transfected in 24 well
plates with 200 ng of the wild-type or mutant reporter constructs and 20 ng of
TK-Renilla construct (Promega) as a control for transfection efficiency. Where
indicated, cotransfections were carried out in the presence of the indicated
amounts of pcDNA3-Slug and pcDNA3-Snail vectors. Luciferase
and renilla activities were measured using the Dual-Luciferase Reporter assay
kit (Promega) and normalized to the wild-type promoter activity detected in
mock-transfected cells. Alternatively, MDCK-mock and MDCK-mSlug cells
were transiently transfected in P-60 dishes with 5 µg of the -178 wt
construct or the mE-pal construct, fused to the CAT reporter gene
(Behrens et al., 1991
) and 2
µg of CMV-luciferase construct as a control for transfection
efficiency. CAT and luciferase assays were performed as previously described
(Faraldo et al., 1997
;
Rodrigo et al., 1999
), with
the activity normalized to that of the wild-type promoter detected in
MDCK-mock cells.
Electrophoretic mobility band-shift assays (EMSA)
Band-shift assays with the 32P-labeled wild-type E-pal probe
were carried out with recombinant GST-Slug, GST-Snail and/or GST-E47 protein.
Briefly, the incubation buffer used was: 20 mM Hepes pH 7.9, 100 mM KCl, 2 mM
MgCl2, 0.5 mM EDTA, 1 mM DTT, 0.4 mM ZnSO4, 40 µM
ZnCl2 and 10% glycerol. Incubations were performed for 30 minutes
at room temperature. The indicated amounts of the different recombinant GST
fusion or GST control proteins were used in the absence or presence of the
indicated competitors. As an irrelevant competitor poly(dI-dC) (Amersham) was
utilized. For supershift assays, 5 µg of rat monoclonal anti-mouse Slug
(Liu and Jessell, 1998
)
(Hybridoma bank, Iowa University), rabbit polyclonal anti-Snail antibody or
the corresponding control IgGs were added to the reaction buffer and incubated
for 15 minutes at room temperature before addition of the labeled probe.
Sequences of the oligonucleotides used as probes and/or competitors were:
wild-type E-pal, 5' GGCTGCCACCTGCAGGTGCGTCCC 3' (E-boxes
indicated in bold) and mutant E-pal, 5'
GGCTGCCACCTTTAGGTGCGTCCC 3' (mutated nucleotides
underlined).
Capillary electrophoresis mobility shift assay (CEMSA)
DNA-protein binding affinities were calculated by capillary electrophoresis
using 5' fluorescent modified oligonucleoties (6-FAM oligos) (obtained
from Isogen) as recently described (Fraga
et al., 2002
). A neutral coating capillary (Beckman Coulter S.A.)
(32.5 cm x 75 µm, effective length 20 cm) was used in a P/ACE MDQ
capillary electrophoresis system (Beckman Coulter S.A.) connected to a Karat
Software® data-processing station. The running buffer (40 mM Trisborate,
0.95 mM EDTA, pH 8.0) was chosen to provide a low current when working at high
voltage (30 kV, 923 V/cm) in order to maintain the stability of protein-DNA
complexes during separation. Laser-induced fluorescence (LIF) was detected by
excitation at 488 nm (3-mW Argon ion laser), and emissions were collected
through a 520 nm emission filter (Beckman Coulter S.A.). Samples were injected
under low pressure (0.2 psi) for 2 seconds and the run temperature was
maintained at 20°C. The run was performed at 30 kV voltage with reverse
polarity. Before each run, the capillary was conditioned by washing with
running buffer for 2 minutes. Buffers and running solutions were filtered
through 0.2 µm pore-size filters. Three replicates of each concentration
were prepared and each was run twice. Binding reactions were performed in a
modification of the binding buffer previously described
(Wade et al., 1999
).
Increasing amounts of all proteins were added to 6-FAM-labeled DNAs in binding
buffer (10 mM Tris HCl, pH 8.0, 3 mM MgCl2, 50 mM NaCl, 0.4 mM
ZnSO4, 40 µM ZnCl2, 0.1 mM EDTA, 0.1% NP-40, 2 mM
DTT, 5% glycerol and 0.4 mg/ml BSA) and incubated overnight at 4°C.
Binding affinities were quantified by Scatchard analyses using GraFit 3.1
software. In brief, the saturation of the oligonucleotide
(R=[complex]/([complex]+[protein])) was plotted against increasing quantities
of each protein. The concentration required for 50% saturation of binding
(R1/2) was then calculated, seeking the best fit of the data to
different binding models/curves.
Immunofluorescence and western blot analysis
Cells grown to confluence on coverslips were fixed in methanol (-20°C,
30 seconds) and stained for the various epithelial and mesenchymal markers as
previously described (Cano et al.,
2000
; Perez-Moreno et al.,
2001
). For F-actin staining, cells were fixed in 3.7%
formaldehyde-0.1% Triton X-100 (30 minutes at room temperature), followed by
incubation with FITC-phalloidin (Sigma Chemical Co.) for 30 minutes at room
temperature and washed (4x) in excess PBS. Slides were mounted on
Mowiol, and the preparations were visualized using a Zeiss Axiophot microscope
equipped with epifluorescence. For detection of mSlug protein in MDCK
transfectant cells, rabbit polyclonal anti-mouse Slug was used (1:50). Western
blot analyses were carried out on whole-cell extracts with the indicated
antibodies as previously described (Cano et
al., 2000
; Perez-Moreno et
al., 2001
). The antibodies used included: rat monoclonal
anti-E-cadherin ECCD-2 (1:100) (provided by M. Takeichi, Kyoto University,
Japan), mouse monoclonal anti-ß-catenin (1:200) and mouse monoclonal
anti-plakoglobin (1:500) (Transduction Lab.) and mouse monoclonal
anti-vimentin (1:200) (Dako). Mouse monoclonal anti-
-tubulin (1:2000)
(Sigma Chemical Co.) was used as a loading control. Western blot analysis of
purified recombinant proteins was carried out with anti-GST (Sigma Chemical
Co.) and anti-E47 (E2A.V18) (Santa Cruz Biotech.) polyclonal antibodies.
Migration assays
The migratory/motility behavior of transfectant cells was analyzed by the
wound assay. Monolayers of confluent cultures were lightly scratched with a
Gilson pipette tip and, after washing to remove detached cells, the cultures
were observed at timely intervals as previously described
(Cano et al., 2000
;
Perez-Moreno et al.,
2001
).
| Results |
|---|
|
|
|---|
|
|
The specific binding affinities of the different GST-fusion factors for the
E-pal element were analyzed by quantitative capillary electrophoresis mobility
shift assays (CEMSA) (Fraga et al.,
2002
). The integrity of the different fusion proteins used was
analyzed by western blot using anti-GST or anti-E47 antibodies
(Fig. 3D). All of the
GST-fusion proteins exhibited a high integrity, although the presence of
intact GST protein could also be detected in all samples
(Fig. 3D; data not shown). The
relative amount of intact GST-fusion proteins (containing the DNA-binding
domain at the C-terminal region in all cases) present in each preparation was
estimated (by comparison with standard protein loadings) and used for
calculation of the actual concentration of intact proteins used in the
subsequent capillary electrophoresis assays
(Fig. 3A-C). At 1 nM
concentration, GST-Snail protein exhibited a main electrophoretic mobility
complex eluting at 5 minutes 4 seconds and a very minor peak that was slightly
retarded; GST-Slug protein showed almost no binding activity, and GST-E47
showed a slower eluting complex (at 5 minutes 8 seconds) of lower intensity
than the GST-Snail complex (Fig.
3A). Control GST protein did not exhibit any binding to the 6-FAM
E-pal probe (Fig. 3A, upper
panel), and no binding of the various GST-fusion factors was obtained with the
6-FAM mutant E-pal oligonucleotide (data not shown). At 1 µM concentration,
the three GST-fusion factors exhibited saturating binding to the 6-FAM
wild-type E-pal probe, generating complexes of different sizes as estimated
from their specific elution profiles (Fig.
3B). Interestingly, at saturating concentrations GST-Slug
generated several complexes of apparent sizes larger than the main one
generated by GST-Snail, and GST-E47 also generated two large complexes of
similar intensity (Fig. 3B).
These results are in close agreement with the results obtained in the EMSA
assays showed in Fig. 1 and
Fig. 2. Nevertheless, it should
be noted that the capillary electrophoresis assay is optimized for resolution
of DNA samples and, therefore, the size of the different DNA-protein complexes
can not be accurately estimated (Fraga et
al., 2002
). Kinetic assays performed with the capillary
electrophoresis system allowed quantitative determination of the binding
affinities for the different GST-fusion factors from the R1/2
parameter (concentration required for 50% saturation of binding)
(Fraga et al., 2002
). As shown
in Fig. 3C, the estimated
R1/2 for GST-Snail (5.4±0.08x10-10 M) is
two orders of magnitude higher than the R1/2 for GST-Slug
(2.2±3.73x10-8 M) and one order of magnitude higher
than the R1/2 for GST-E47 (6.07±0.82x10-9
M).
|
Taken together, the results of the band-shift analyses indicate that the
binding affinity of the three analyzed factors for the E-pal element is:
GST-Snail>GST-E47>GST-Slug. The relative binding affinity of the three
factors deduced from the band-shift assays is also in agreement with our
recent in vivo binding analysis for the E-pal element using the one-hybrid
approach, in which out of 130 isolated clones, 49% corresponded to Snail, 32%
to E47 and one single clone to Slug (Cano
et al., 2000
; Perez-Moreno et
al., 2001
). Although a different representation of the three
factors in the NIH3T3 library used for the one-hybrid analysis can not be
excluded, this possibility seems unlikely since similar levels of
Snail and Slug mRNA were observed in NIH3T3 cells (data not
shown). These results, therefore, support the idea that the in vitro binding
affinities of the recombinant factors detected in the band shift assays
reflect the relative affinities of the different factors in vivo.
Slug represses E-cadherin promoter and induces EMT upon
stable expression in MDCK cells
The ability of Slug to bind to the E-pal element prompted us to analyze its
effect on the E-cadherin promoter activity. Transient transfection
assays in the prototypic epithelial cell line MDCK in the presence of
pcDNA3-Slug showed that Slug is able to repress the
E-cadherin promoter activity in a dose-dependent manner, with a 50%
inhibition achieved in the presence of 240 ng
(Fig. 4A). Comparative analysis
of the effect of Snail on the activity of the E-cadherin promoter,
inducing 70% repression at 50 ng in this cell line
(Fig. 4A), suggested a lower
repressor activity of Slug on the mouse E-cadherin promoter. Similar
results were obtained with the epidermal keratinocyte PDV cells, where Slug
induces only a 30-40% inhibition of the E-cadherin promoter activity
at concentrations (250-500 ng) at which Snail induces 60-80% inhibition (data
not shown) (Cano et al., 2000
).
Although a different efficiency in expression of Snail and Slug vectors after
transient transfection can not be formally excluded, the above results suggest
that Slug might exhibit a lower repression activity than Snail on the mouse
E-cadherin promoter. This suggestion would also be in agreement with
the lowest binding affinity of Slug for the E-pal element demonstrated in the
binding assays.
|
To gain further insights into the role of Slug in the regulation of
E-cadherin expression, gain-of-function studies were performed in
MDCK cells. Cells were stably transfected with pcDNA3 (mock) or
pcDNA3-Slug (Slu) vectors. Although no changes were observed
in the morphology of MDCK-mock transfectants, a dramatic conversion to a
fibroblastic phenotype was observed in four independent clones and three
subclones isolated after transfection with the Slug expression
vector. The results obtained for four of the selected clones are shown in
Fig. 5 and compared to
control-mock and MDCK-Snail cells, as recently described
(Cano et al., 2000
). The
Slug-transfected cells apparently lost all epithelial characteristics
and acquired a spindle appearance (Fig.
5b-e), similar to Snail-transfected cells
(Fig. 5f). This phenotypic
change was associated with a loss of E-cadherin expression
(Fig. 5h-k), apparent loss and
redistribution of other epithelial markers such as plakoglobin (data not
shown) and increased organization of the mesenchymal markers fibronectin
(Fig. 5n-q) and vimentin
(Fig. 5t-w). The overall
changes observed in the different markers in the Slug-transfectants
are very similar to those recently described for MDCK-Snail cells
(Cano et al., 2000
) and are
shown in Fig. 5 (panels l, r
and x) for comparison. The qualitative changes in the various markers observed
in the different Slug-transfectant clones by immunofluorescence were
confirmed by western blot analysis of whole-cell extracts
(Fig. 6A). This analysis
confirmed the absence of E-cadherin and an increase in levels of vimentin and
fibronectin in the Slug-transfected cells
(Fig. 6A) (data not shown), as
previously reported in MDCK-Snail and MDCK-E47-transfected
cells (Cano et al., 2000
;
Perez-Moreno et al., 2001
). In
addition, inmunoblot analysis of plakoglobin and ß-catenin in
MDCK-Slug cells (Fig.
6A) showed reduced expression of the two catenins in most clones,
a differential feature compared with MDCK-Snail cells and
MDCK-E47, where no changes in plakoglobin levels were observed
(Cano et al., 2000
;
Perez-Moreno et al., 2001
).
Analysis of E-cadherin expression by RT-PCR showed a complete absence
of endogenous E-cadherin transcripts in
MDCK-Slug-transfected cells (Fig.
6B). Since neither mSlug monoclonal nor polyclonal antibodies are
useful for western blot detection, expression of exogenous mouse Slug
mRNA transcripts was analyzed by RT-PCR. This analysis showed the expression
of mSlug transcripts at various levels in the different Slug
clones by RT-PCR (Fig. 6B). In
addition, ectopic expression of the Slug protein could be observed in the
nuclei of the transfected cells (Fig.
6Cb,c, compare with mock cells shown in panel a). The repression
of E-cadherin expression in the Slug transfectants was
further analyzed at the promoter level. As shown in
Fig. 4B, the activity of the
exogenous wild-type E-cadherin promoter was fully suppressed or
reduced to 10% of the activity detected in MDCK-mock cells, as exemplified
here for two independent MDCK-Slug clones. By contrast, the activity
of the mutant E-pal construct was very similar in both MDCK-Slug and
mock cells, indicating that Slug repression of the E-cadherin
promoter is mediated through the E-pal element. The activity of the exogenous
E-cadherin promoter constructs in MDCK-Slug transfectants is
also very similar to that exhibited by MDCK-Snail cells
(Fig. 4B).
|
|
The apparent similarity in the phenotype and molecular markers exhibited by
the Slug and Snail transfectants raised the possibility that
the effects observed in Slug-overexpressing cells could be due to
increased expression of endogenous Snail rather than the direct effect of
exogenous Slug. To investigate this specific point, the expression of
endogenous Snail mRNA in different Slug-clones was analyzed
by RT-PCR, using specific primers for canine Snail. As previously
reported (Comijn et al.,
2001
), low levels of endogenous Snail mRNA were detected
in control MDCK-mock cells, and no significant changes were observed in the
Snail mRNA levels in the different MDCK-Slug clones
(Fig. 6B) (variations from 0.7-
to 1.2-fold of the level found in mock cells were estimated from the
semiquantitative RT-PCR analysis). To further investigate the potential
influence of Slug in the regulation of Snail expression, the activity
of a Snail promoter construct carrying 900 bp of the 5'
upstream region of the mouse Snail gene
(Jiang et al., 1997
) was
analyzed in MDCK-mock and selected Slug-transfected cell lines. As
shown in Fig. 6D, this promoter
construction exhibited a similar activity both in MDCK-mock and
Slug-transfectant cells as well as in MDCK-Snail cells.
Indeed, the slight variations in the Snail promoter activity observed
in the different MDCK-Slug clones are very similar to the relative
levels of endogenous Snail mRNA detected by RT-PCR (compare
Fig. 6D with 6B, dSna
panel). Interestingly, mutation of a proximal E-box located at -221 position
of the mouse Snail gene (Jiang et
al., 1997
) reduced the activity of the Snail promoter to
about 50% in most of the analyzed cell lines
(Fig. 6D, grey bars),
suggesting a contribution of this E-box in the regulation of Snail
expression. The results obtained in the RT-PCR analysis and Snail
promoter studies strongly suggest that Slug overexpression does not contribute
significantly to the regulation of Snail expression, at least in MDCK
cells. Taken together, the above results indicate that stable overexpression
of Slug in MDCK cells leads to the full repression of E-cadherin
expression and to induction of a dramatic EMT, apparently independently from
the level of endogenous Snail expression.
Slug expression induces a highly migratory behaviour
The process of EMT induced by overexpression of Slug in MDCK cells prompted
the analyses of the migratory/motility properties of control and
Slug-transfected cells in wound-culture assays. The results obtained
with two of the selected Slug clones are shown in
Fig. 7A, where it can be
clearly observed that MDCK-Slug cells exhibited a highly migratory
behaviour, beginning to enter the wound in a random fashion 6 hours
post-incision (Fig. 7Ae,h).
Approximately, 80-90% of the wound surface was colonized by Slug expressing
cells 9 hours after the wound was made
(Fig. 7Af,i), whereas at this
time the mock-transfected cells had started to colonize the wound by coherent
unidirectional migration (Fig.
7Ac). The migratory ability of MDCK-Slug cells in the
wound assays is similar to or even higher than that of MDCK-Snail
cells, which require about 15 hours to completely heal the wound
(Cano et al., 2000
), and
similar to the behaviour of the recently described MDCK-E47
transfectants (Perez-Moreno et al.,
2001
) in this kind of assay. The organization of the actin
cytoskeleton in Slug-transfectant cells is also compatible with its
high migratory behavior. F-actin is organized in abundant stress fibres and
lamellipodia-like structures in Slug-transfectants
(Fig. 7Bb,c), in contrast to
the cortical F-actin organization present in MDCK-mock cells
(Fig. 7Ba). These studies also
show that F-actin organization of MDCK-Slug transfectants is similar
although not identical to that of MDCK-Snail cells, which exhibit a
higher abundance of membrane protrusions and lamellipodia-like structures
(Fig. 7Bd). The high migratory
behaviour exhibited by Slug and Snail transfectants as
compared to control mock cells cannot be attributed to their proliferation
potential. In fact, both MCDK-Snail and -Slug transfectants
exhibit a lower proliferation potential than control MDCK cells, with
duplication times of 16-18 hours for Slug and Snail
transfectants and 12 hours for mock cells.
|
| Discussion |
|---|
|
|
|---|
We provide here evidence for the repressor effect of Slug on the mouse
E-cadherin promoter, and we have analyzed its relative contribution
to this event compared with Snail and E47 repressors. The gain-of-function
studies performed on the epithelial MDCK cell line indicate that
overexpression of Slug fully represses endogenous E-cadherin
expression and induces a dramatic EMT with all the leading characteristics of
the process: increased expression and organization of mesenchymal markers and
a high motility and migratory behaviour. The Slug-induced repression of
E-cadherin in MDCK cells is exerted at the transcriptional level and
dependent on the integrity of the two E-boxes of the E-pal element of the
mouse promoter, as confirmed by the analysis of mRNA levels, promoter activity
and band-shift assays. All these data support the idea that when overexpressed
Slug can behave as a potent repressor of E-cadherin in epithelial
cells. These data are also in agreement with a recent report indicating that
Slug is a repressor of E-cadherin in breast carcinoma cell lines
(Hajra et al., 2002
).
Moreover, our present studies clearly show that Slug is able to induce a
complete EMT and provide additional information about the potential relative
contribution of Snail and Slug to the downregulation of E-cadherin.
Our quantitative binding studies with recombinant GST-fusion proteins clearly
indicate that although both zinc factors are able to bind specifically to the
E-boxes of the E-pal element, the affinity of Snail protein for this DNA
element is two orders of magnitude higher than that of Slug. Indeed, of the
three independent repressors of E-cadherin analyzed here (Snail, Slug
and E47), Slug showed the lowest binding affinity for the E-pal element
(Fig. 3). The binding assays
also indicate that Slug binds preferentially to the E-pal element in a
multimeric form, whereas Snail does it as a monomer (Figs
2 and
3). This differential behaviour
can reside in the divergent intermediate P-S-rich region of both factors; the
specific 29 amino-acid Slug domain could favour oligomerization of Slug.
Alternatively, or complementarily, the whole conformation of both factors can
influence the differential oligomerization and/or binding properties of both
factors, a fact that here could not be anticipated on the basis of their
similar zinc-finger-binding domains.
It should be noted that the E-cadherin promoter from different
species contains several E-boxes with differential localization. The human
promoter contains three E-boxes at -79, -30 and +22 nt position
(Hennig et al., 1995
;
Giroldi et al., 1997
;
Batlle et al., 2000
), the mouse
promoter contains two adjacent E-boxes at -86 and -80, inside the E-pal
element, and the proximal E-box at -31, but lacks the downstream E-box at +22
(Behrens et al., 1991
;
Rodrigo et al., 1999
), whereas
the canine promoter has been reported to be similar to the human promoter at
the -79 and -30 E-boxes (Comijn et al.,
2001
). In this context, it is worth mentioning that the proximal
-30 E-box of the mouse E-cadherin promoter did not show specific
binding for either Snail of Slug, although it effectively binds to E12/E47 and
other bHLH factors (L. Holt and A.C., unpublished). Therefore, the full
repression of endogenous E-cadherin observed in MDCK-Slug
and MDCK-Snail cells strongly suggest that the -79 E-box would be
sufficient to mediate repression of the endogenous promoter by both Snail
family factors, at least in canine cells. These observations, and our previous
studies, also support the suggestion that the repression exerted by Slug and
Snail on the mouse E-cadherin promoter is mainly driven through the
E-boxes of the E-pal element. In agreement with the lowest binding affinity
for the E-pal exhibited by Slug, transient transfection assays suggest that
Slug may have a reduced repressor activity compared with Snail in MDCK and
mouse keratinocyte cells. These results seem to differ from those recently
reported for breast carcinoma cells, in which Snail and Slug showed similar
repressor activities (Hajra et al.,
2002
), and may be due to differences in the sensitivity of the
transfection assays, in expression efficiencies of the Snail and Slug
constructs or to the cell systems analyzed. Hajra et al. also suggest that
Slug is a more likely in vivo repressor of E-cadherin in breast
carcinomas. The specific organization of the E-boxes in the mouse and human
E-cadherin promoters could provide additional clues for differential
repressor mechanisms for Snail and Slug factors in both species. Although
further studies are required to clarify this specific issue our present
results suggest that the relative concentrations of Snail and Slug, as well as
that of other repressors and potential coregulators, is indeed important for
their participation as E-cadherin repressors in a determined cellular
context. This proposal is also supported by our previous analysis of
Snail and Slug expression in several mouse epidermal
keratinocyte cells showing no correlation between Slug and
E-cadherin expression. In fact, some of the keratinocyte cell lines
exhibit high levels of endogenous Slug expression while maintaining
elevated expression of E-cadherin and high promoter activity, and
only those which expressed Snail showed repression of
E-cadherin and low promoter activity
(Faraldo et al., 1997
;
Cano et al., 2000
). In
addition, our recent studies in human breast cancer biopsies in fact indicate
a strong correlation between Snail expression, reduced
E-cadherin expression and invasive grade of the tumours
(Blanco et al., 2002
),
supporting a direct role for Snail as an E-cadherin repressor in in
vivo tumour progression of breast carcinomas.
The present evidence from the recently characterized E-cadherin
repressors (Snail, Slug, E12/E47, SIP1, ZEB-1) indicates that all of them are
able to participate in the downregulation of E-cadherin expression in
many different cell systems. The specific role of each factor, or their
potential co-operation, in specific cellular contexts or in different types of
carcinomas is not yet fully understood. In addition, the relative contribution
of epigenetic mechanisms, mainly promoter hypermethylation, and trans-acting
repressors in E-cadherin downregulation during tumour progression is
presently unknown. It is plausible that both kinds of mechanism can operate in
a coordinated fashion in defined cellular or tumour contexts, in a modified
version of the two-hit hypothesis for tumour suppressors, as discussed
recently for breast carcinomas in an elegant work
(Cheng et al., 2001
).
One important aspect to be considered when discussing E-cadherin
downregulation in tumour progression is the fact that in most carcinomas this
is a transient and dynamic event. Dynamic expression is supported by the
frequently observed re-expression of E-cadherin in secondary metastatic foci
and even in some lymph node metastasis
(Takeichi, 1993
;
Gamallo et al., 1996
;
Christofori and Semb, 1999
;
Graff et al., 2000
). Dynamic
regulation of E-cadherin expression is a tightly regulated process during
embryonic development in which E-cadherin is lost when EMTs occur but is
re-expressed in the reverse situation: the establishment of epithelial
lineages from mesoderm layers (Takeichi,
1995
; Huber et al.,
1996
). In this context, it is tempting to speculate on the
potential of the different E-cadherin repressors at different stages
of the metastatic cascade. The initial invasion stage probably requires a
rapid and effective repression of E-cadherin, which can be accounted
for by the presence of repressors with high binding affinity for E-boxes of
the promoter, like Snail. However, maintenance of the dedifferentiated and
motile phenotype during the subsequent migration of invaded tumour cells can
be achieved by weaker but more widely expressed repressors, such as Slug, or
the formerly described repressors E12/47, ZEB-1, and SIP-1
(Perez-Moreno et al., 2001
;
Grooteclaes and Frisch, 2000
;
Comijn et al., 2001
). In
relation to Snail, Slug and E47, the expression pattern of the three factors
in mouse development strongly supports the above hypothesis, as Snail
is specifically expressed at the EMTs areas whereas Slug and
E12/E47 are excluded from them but present in the already migratory
cells (Sefton et al., 1998
;
Cano et al., 2000
;
Perez-Moreno et al., 2001
).
The binding affinity data of the three factors for the E-pal element presented
here also support the suggestion that Snail will predominate in the binding of
the E-boxes of the E-cadherin promoter over Slug, and even E12/E47
factors. Although further experimental work is needed to test the above
hypothesis, in particular, the analysis of the different repressors in human
tumour biopsies, our present results strengthens our previous notion that
similar mechanisms and molecules can be operating in EMTs and in the
maintenance of the mesenchymal phenotype during development and in tumour
progression.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Batlle, E., Sancho, E., Franci, C., Dominguez, D., Monfar, M., Baulida, J. and Garcia de Herreros, A. (2000). The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nat. Cell Biol. 2, 84-89.[CrossRef][Medline]
Behrens, J., Frixen, U., Schipper, J., Weidner, M. and Birchmeier, W. (1992). Cell adhesion in invasion and metastasis. Semin. Cell Biol. 3, 169-178.[Medline]
Behrens, J., Lowrick, O., Klein-Hitpass, L. and Birchmeier,
W. (1991). The E-cadherin promoter: functional analysis of a
G.C-rich region and an epithelial cell-specific palindromic regulatory
element. Proc. Natl. Acad. Sci. USA
88,11495
-11499.
Bellairs, R. (1987). Developmental and evolutionary aspects of neural crest. New York: Wiley.
Birchmeier, W. and Behrens, J. (1994). Cadherin expression in carcinomas: role in the formation of cell junctions and the prevention of invasiveness. Biochim. Biophys. Acta 1198,11 -26.[Medline]
Blanco, M. J., Moreno-Bueno, G., Sarrio, D., Locascio, A., Cano, A., Palacios, J. and Nieto, M. A. (2002). Correlation of Snail expression with histological grade and lymph node status in breast carcinomas. Oncogene 21,3241 -3246.[CrossRef][Medline]
Burdsal, C. A., Damsky, C. H. and Pedersen, R. A. (1993). The role of E-cadherin and integrins in mesoderm differentiation and migration at the mammalian primitive streak. Development 118,829 -844.[Abstract]
Cano, A., Perez-Moreno, M. A., Rodrigo, I., Locascio, A., Blanco, M. J., del Barrio, M. G., Portillo, F. and Nieto, M. A. (2000). The transcription factor Snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat. Cell Biol. 2,76 -83.[CrossRef][Medline]
Carl, T. F., Dufton, C., Hanken, J. and Klymkowsky, M. W. (1999). Inhibition of neural crest migration in Xenopus using antisense slug RNA. Dev. Biol. 213,101 -115.[CrossRef][Medline]
Carver, E. A., Jiang, R., Lan, Y., Oram, K. F. and Gridley,
T. (2001). The mouse snail gene encodes a key regulator of
the epithelial-mesenchymal transition. Mol. Cell.
Biol. 21,8184
-8188.
Cheng, C. W., Wu, P. E., Yu, J. C., Huang, C. S., Yue, C. T., Wu, C. W. and Shen, C. Y. (2001). Mechanisms of inactivation of E-cadherin in breast carcinoma: modification of the two-hit hypothesis of tumor suppressor gene. Oncogene 20,3814 -3823.[CrossRef][Medline]
Christofori, G. and Semb, H. (1999). The role of the cell-adhesion molecule E-cadherin as a tumour-suppressor gene. Trends Biochem. Sci. 24,73 -76.[CrossRef][Medline]
Comijn, J., Berx, G., Vermassen, P., Verschueren, K., van Grunsven, L., Bruyneel, E., Mareel, M., Huylebroeck, D. and van Roy, F. (2001). The two-handed E box binding zinc finger protein SIP1 downregulates E-cadherin and induces invasion. Mol. Cell 7,1267 -1278.[CrossRef][Medline]
Del Barrio, M. G. and Nieto, M. A. (2002).
Overexpression of Snail family members highlights their ability to promote
chick neural crest formation. Development
129,1583
-1593.
Faraldo, M. L., Rodrigo, I., Behrens, J., Birchmeier, W. and Cano, A. (1997). Analysis of the E-cadherin and P-cadherin promoters in murine keratinocyte cell lines from different stages of mouse skin carcinogenesis. Mol. Carcinog. 20, 33-47.[CrossRef][Medline]
Fraga, M. F., Ballestar, E. and Esteller, M. (2002). Quantification of DNA-protein binding affinities by capillary electrophoresis mobility shift assays in electrosmotic flow-lacking neutral capillaries with laser induced fluorescence. Electrophoresis (in press).
Gamallo, C., Palacios, J., Benito, N., Limeres, M. A., Pizarro, A., Suárez, A., Pastrana, F., Cano, A. and Calero, F. (1996). Expression of E-Cadherin in 230 infiltrating ductal breast carcinoma: Relationship to clinicopathological features. Int. J. Oncol. 9,1207 -1212.
Giroldi, L. A., Bringuier, P. P., de Weijert, M., Jansen, C., van Bokhoven, A. and Schalken, J. A. (1997). Role of E boxes in the repression of E-cadherin expression. Biochem. Biophys. Res. Commun. 241,453 -458.[CrossRef][Medline]
Graff, J. R., Gabrielson, E., Fujii, H., Baylin, S. B. and
Herman, J. G. (2000). Methylation patterns of the E-cadherin
5' CpG island are unstable and reflect the dynamic, heterogeneous loss
of E-cadherin expression during metastatic progression. J. Biol.
Chem. 275,2727
-2732.
Grooteclaes, M. L. and Frisch, S. M. (2000). Evidence for a function of CtBP in epithelial gene regulation and anoikis. Oncogene 19,3823 -3828.[CrossRef][Medline]
Hajra, K. M., Ji, X. and Fearon, E. R. (1999). Extinction of E-cadherin expression in breast cancer via a dominant repression pathway acting on proximal promoter elements. Oncogene 18,7274 -7279.[CrossRef][Medline]
Hajra, K. M., Chen, D. Y. and Fearon, E. R.
(2002). The SLUG zinc-finger protein represses E-cadherin in
breast cancer. Cancer Res.
62,1613
-1618.
Hemavathy, K., Ashraf, S. I. and Ip, Y. T. (2000). Snail/slug family of repressors: slowly going into the fast lane of development and cancer. Gene 257, 1-12.[CrossRef][Medline]
Hennig, G., Behrens, J., Truss, M., Frisch, S., Reichmann, E. and Birchmeier, W. (1995). Progression of carcinoma cells is associated with alterations in chromatin structure and factor binding at the E-cadherin promoter in vivo. Oncogene 11,475 -484.[Medline]
Hennig, G., Lowrick, O., Birchmeier, W. and Behrens, J.
(1996). Mechanisms identified in the transcriptional control of
epithelial gene expression. J. Biol. Chem.
271,595
-602.
Huber, O., Bierkamp, C. and Kemler, R. (1996). Cadherins and catenins in development. Curr. Opin. Cell Biol. 8,685 -691.[CrossRef][Medline]
Jiang, R., Copeland, N. G., Gilbert, D. J., Jenkins, N. A. and Gridley, T. (1997). Genomic organization and chromosomal localization of the mouse snail (Sna) gene. Mamm. Genome 8,686 -688.[CrossRef][Medline]
Jiang, R., Lan, Y., Norton, C. R., Sundberg, J. P. and Gridley, T. (1998). The Slug gene is not essential for mesoderm or neural crest development in mice. Dev. Biol. 198,277 -285.[Medline]
LaBonne, C. and Bronner-Fraser, M. (2000). Snail-related transcriptional repressors are required in Xenopus for both the induction of the neural crest and its subsequent migration. Dev. Biol. 221,195 -205.[CrossRef][Medline]
Liu, J. P. and Jessell, T. M. (1998). A role for rho