|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 11 December 2002
doi: 10.1242/jcs.00251
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |

Department of Biology, CB3280 University of North Carolina, Chapel Hill,
NC 27599-3280, USA
* Present address: Department of Molecular, Cellular, and Developmental Biology,
University of California at Santa Barbara, Santa Barbara, CA 93106, USA
Author for correspondence (e-mail:
kerry_bloom{at}unc.edu)
Accepted 31 October 2002
| Summary |
|---|
|
|
|---|
Key words: Dicentric chromosome, Microtubules, Homology search, Recombination, Single-strand annealing
| Introduction |
|---|
|
|
|---|
|
Resolution of a conditional dicentric chromosome is accompanied by the
deletion of one centromere and the intervening DNA. These events were
initially thought to result from gene conversion (GC) accompanied by crossover
(Jager and Philippsen, 1989
).
However, other studies of direct repeat recombination have shown that
deletions commonly occur without generating the circular product predicted to
form through a crossover event
(Fishman-Lobell et al., 1992
).
Moreover, many deletion events are dependent on RAD1 and
RAD10 (Klein, 1988
;
Schiestl and Prakash, 1990
;
Ivanov and Haber, 1995
). The
Rad1 and Rad10 proteins form a structure-specific endonuclease that generates
5' single-stranded ends (Siede et
al., 1993
). These genes function in a recombination pathway known
as single-strand annealing (SSA) (Sugawara
and Haber, 1992
; Sung et al.,
1993
; Ivanov and Haber,
1995
). The recognition of SSA as a major pathway for direct repeat
recombination suggests that this mechanism plays a role in the repair of a
dicentric chromosome.
Previous studies have shown that recombination frequency is primarily
governed by the degree of sequence homology rather than the location of the
recombining sequences within the genome
(Haber and Leung, 1996
). This
implies the existence of a homology search mechanism as part of the
recombination process. The integration of E. coli lacO and tetO
sequences into chromosomes of yeast strains encoding lac repressor-GFP and tet
repressor-GFP fusion proteins has recently provided visual evidence of
long-distance interactions between like sequences
(Aragon-Alcaide and Strunnikov,
2000
). Such interactions may represent a constitutive homology
search process. The mechanisms that bring homologous sequences into close
association are unknown. Efficient meiotic recombination in the fission yeast
Schizosaccharomyces pombe requires microtubule-dependent oscillatory
nuclear movements (Chickashige et al., 1994;
Ding et al., 1998
;
Yamamoto et al., 1999
). It has
been suggested that such movements promote the alignment of homologous
chromosomes. Microtubule-driven nuclear movements could similarly promote the
association and recombination of homologous sequences during the vegetative
cycle.
In this study we show a requirement for RAD1 in the repair of a dicentric chromosome, which is consistent with recombination via SSA. Dicentric chromosome repair also exhibits a requirement for RAD52; however we show that this process can occur via RAD52-independent SSA in cells containing the adaptation-defective cdc5-ad allele of the yeast polo kinase and the DNA damage checkpoint gene RAD9. Dicentric cdc5-ad rad52 mutant cells additionally experience an extended arrest that is characterized by microtubule and ATP-dependent nuclear oscillations. Finally, recombinational repair of a dicentric chromosome containing direct and inverted centromere repeats, as well as spontaneous recombination events between his3 heteroalleles, also show a dependency on microtubule function. These latter findings suggest that microtubule-dependent processes play a general role in recombination. We discuss ways in which nuclear movements might contribute to chromosome repair.
| Materials and Methods |
|---|
|
|
|---|
ade2 ade3::GalHO
lys5 trp1 leu2 his3 ura3 can1 cyh2 his4
::URA3GALCEN3); KBY3002
(KBY3009 with rad1::KANr); KBY3010 (KBY3009 with
rad52::LEU2); KBY3006 (KBY3002 with rad52::LEU2); KBY3003
(KBY3009 with rad9::TRP1); KBY3011, identical to KBY3009 except that
it contains the cdc5-ad point mutation (L251T); KBY3012 (KBY3011 with
rad1::KANr); KBY3034 (KBY3011 with rad52::LEU2);
KBY3014 (KBY3012 with rad52::LEU2); KBY3015 (KBY3034 with
rad52::LEU2); KBY3031 (KBY3039 with dhc1::LEU2 and
rad52::TRP1); KBY3039 (KBY3011 with
HTB1-GFP-KANr); KBY3037 (KBY3039 with
rad52::LEU2); KBY3038 (KBY3009 with
HTB1-GFP-KANr); KBY3040 (KBY3038 with
rad52::LEU2); and KBY5004 (J178-1D MAT a, ade1, met 14, ura3-52,
leu2-3, 112, his3-11, 15, H2B-GFP-KANr). KBY5004 was
transformed with a GAL-MPS1 construct on a 2 µm plasmid to
generate a cell population arrested in mitosis by MPS1
overexpression. Strains were constructed by one step gene replacement
(Rothstein, 1991
Histone 2B-GFP fusion constructs and image acquisition
Yeast strains were transformed with an integrating PCR fragment generated
with oligos HTB2#1:
gggctgttaccaaatactcctcctctactcaagccgcagcagcagtcagcagcagcaatgagtaaaggagaagaa,
HT2BN#2: tcatatctggacaagtaacagaaccctaatgttactggcggcgttagtatcg and the plasmid
pKanMX2-GFP (K.B., unpublished), which contains the green fluorescence protein
coding region and the G418 resistance marker. Cells were added to the surface
of a gelatin slab formed on the surface of a microscope slide. Slabs contained
25% gelatin, 2% glucose, 0.5% casamino acids, 50 µg/ml tryptophan, 50
µg/ml adenine and 16.5 µg/ml uracil (YCAUT). Coverslips were sealed to
slides with Valap (1:1:1 vaseline:lanolin:paraffin). A flow chamber was
constructed by attaching a coverslip to a microscope slide with petroleum
jelly to observe the effects of microtubule and ATP inhibitors on nuclear
dynamics. The coverslip was precoated with a 1 mg/ml solution of poly-L-lysine
to facilitate cell attachment. Filling and rinsing of the chamber was
accomplished by adding liquid to one end and simultaneously withdrawing liquid
from the opposite end with a filter paper wick. Microscopic observations were
made at room temperature (22°C). The microscopy system and GFP
fluorescence imaging have previously described
(Shaw et al., 1997a
), with the
exception that observations in the current study were made using a
100x/1.4 NA Plan Apo objective. Metamorph software (Universal Imaging)
was used to control shutters, focusing and image acquisition. Five z-axis
fluorescence images separated by 0.75 µm were collected for each time point
and converted to a single 3D image using Metamorph software. A single
differential interference contrast image was collected at the medial
z-step.
Quantification of nuclear oscillations
Hydroxyurea (HU)-arrested cells were obtained by growing KBY5004 to log
phase and transferring cells to YPD supplemented with 40 µg/ml adenine and
200 mM HU. A MPS1-arrested population was obtained by growing KBY5004
cells containing a GAL-MPS1 expression plasmid overnight in
adenine-supplemented sucrose media lacking uracil to maintain the plasmid
(Lauze et al., 1995
). Cells
were grown to log phase and switched to galactose media lacking uracil for 6
hours to promote overexpression of Mps1. Large budded cells were filmed on
YCAUT glucose + 25% gelatin slabs for 2 hours. Images were acquired every 2
minutes with an exposure time of 250 milliseconds. Images of dicentric
cdc5-ad rad52, dicentric cdc5-ad and dicentric
Rad52 cells were obtained with the same exposure and time intervals
described above following 6 hours of exposure to YCAUT glucose media. A cell
was scored as oscillation + if during the time course it underwent at least
one cycle of nuclear movement from mother to bud to mother, such that at each
stage >50% of the nuclear material was in either the mother or bud.
Image analysis and calculation of dynamic parameters
Measurements of nuclear filaments were taken with Metamorph software.
Filaments were measured from the filament tip to the geometric center of the
nuclear mass. Length measurements were made in triplicate using appropriate
calibrations from a stage micrometer and corrected for specimen tilt angle
with a Microsoft Excel algorithm containing the formula c2=square
root (a2 + b2), where a is the measured distance taken
from the 3D image and b is the distance between the uppermost and lowest focal
planes in which the filament was visible. Growing and shortening rates were
calculated from a least squares fit of four or more data points. Criteria for
dynamic parameters were based on those used to quantify microtubule dynamics
(Tirnauer et al., 1999
).
Growth and shortening events were defined as a change in length sustained over
four time points having a correlation coefficient
0.85 and yielding a
total length change >0.6 µm. The proportion of time spent in growing,
shortening or paused phases was determined by measuring the amount of time
spent in a given phase for all filaments and dividing by total time.
Dynamicity (Toso et al., 1993
)
was calculated by dividing the sum of all filament length changes measured by
total observation time.
Recombination assay
The spontaneous his3 heteroallele recombination frequency of
strain HUWT was determined by tabulating the formation of HIS+
colonies on synthetic media lacking histidine
(Qiu et al., 1999
). Cells were
plated in triplicate on media with and without added benomyl for each
experiment. Cells were plated on media lacking uracil both in the presence and
absence of benomyl to correct for differences in the cell growth/viability
resulting from drug treatments.
| Results |
|---|
|
|
|---|
|
The DNA damage checkpoint gene RAD9 is required for efficient
utilization of some repair pathways
(Fasullo et al., 1998
). A
RAD9-dependent midanaphase delay has been observed in yeast cells
containing a dicentric chromosome, but loss of this gene does not adversely
affect strain viability (Table
1) (Yang et al.,
1997
). We examined the kinetics of CEN3 recombination in
a rad9 deletion strain and found them identical to the corresponding
wild-type strain (Fig. 1E,
compare with Fig. 1B). Our
findings suggest that dicentric chromosome repair events are completed rapidly
and do not require the additional time provided by the RAD9-dependent
cell cycle delay.
The cdc5-ad allele promotes RAD52-independent
SSA
Cells containing the cdc5-ad allele of the yeast polo-like kinase
experience an extended mitotic delay in response to an unrepaired DSB
(Toczyski et al., 1997
). We
considered that such a delay might allow us to detect
RAD52-independent SSA events by allowing additional time for
completion of repair prior to the end of mitosis. CEN3 recombination
induced by dicentric chromosome breakage occurred with the same kinetics
regardless of whether cells contained the cdc5-ad or CDC5
wild-type allele (Fig. 2A,
compare with Fig. 1B). However,
in contrast to the dicentric CDC5 rad52 strain
(Fig. 1C), CEN3
recombination was observed in the dicentric cdc5-ad rad52 strain
(Fig. 2B). No CEN3
recombination product was detected in a cdc5-ad rad1 rad52 deletion
strain (Fig. 2C), indicating
that this event occurs through SSA. We additionally showed that
RAD52-independent repair in a cdc5ad strain requires
RAD9 (Fig. 2D).
Analysis of populations derived from individual dicentric cdc5-ad
rad52 cells revealed that recombination occurred through a
RAD1-dependent mechanism in 19 of 20 clones (data not shown).
|
Dicentric cdc5ad rad52 cells exhibit nuclear oscillations
and dynamic alterations in nuclear morphology
Over the course of 24 hours following activation of the dicentric
chromosome in the cdc5-ad rad52 strain, 89% of the population
arrested as abnormally large budded cells, similar to the phenotype previously
reported for cdc5-ad cells containing unrepaired DNA damage
(Toczyski et al., 1997
). This
extended mitotic arrest was not observed in dicentric CDC5 cells,
dicentric cdc5-ad cells, dicentric rad52 cells, cdc5-ad
RAD52 cells or in cdc5-ad rad9 rad52 cells
(Table 2). These findings
indicate that the requirements for arrest include a source of DSBs (the
activated dicentric chromosome), the cdc5-ad allele, the presence of
RAD9 and deletion of RAD52, consistent with the original
characterization of the cdc5-ad allele
(Toczyski et al., 1997
). It
was previously shown that that the cell cycle arrest was generated by the
cdc13-1 allele (Toczyski et al.,
1997
). By contrast, cells containing a conditional dicentric
chromosome experience a midanaphase delay
(Yang et al., 1997
). To
determine if dicentric cdc5-ad rad52 cells also pause in midanaphase,
we replaced the endogenous HTB2 (histone 2B) gene with an
HTB2-GFP fusion construct. Images of 25 histone-GFP expressing
cdc5-ad rad52 cells were collected 2 hours after activation of the
dicentric chromosome. Nineteen of the 25 large-budded cells contained a
bilobed nucleus that straddled the bud neck (data not shown), which is
indicative of a midanaphase arrest (Yang
et al., 1997
).
|
Real-time observations of dicentric cdc5ad rad52 cells expressing HTB2-GFP revealed an extended period of oscillatory nuclear movements (Fig. 3). This behavior initiated with the retraction of the bud-proximal lobe of a bilobed nucleus, resulting in the formation of a single nuclear mass. In 52% of arrested cells, the nucleus oscillated between the mother cell and bud. This behavior was not observed in dicentric cdc5-ad RAD52 cells or in CDC5 rad52 cells (Table 3). Time-lapse images of cells collected at 15 minute intervals over a 24 hour period revealed that more than 90% of cells exhibited nuclear oscillations for at least 14 hours after activation of the dicentric chromosome. Nuclear oscillations were also accompanied by the extension and collapse of filamentous nuclear protrusions (Fig. 3). Approximately 1% of cells that remained arrested longer than 6 hours succeeding in completing nuclear division and cytokinesis (data not shown). The divided cells rebudded and proceeded through the next cell cycle with normal kinetics.
|
|
To determine if nuclear oscillations are a general feature of cells that
have experienced a mitotic arrest, we characterized nuclear movements
following exposure to hydroxyurea (HU) or elevated expression of
MPS1. Treatment with HU causes a DNA-damage-induced mitotic block.
Overexpression of MPS1, a protein involved in the spindle checkpoint
and spindle pole body duplication, also results in a mitotic arrest (reviewed
in Winey and Huneycutt, 2002
).
Nuclear oscillations were not observed in HU-arrested cells
(Table 3). Cells overexpressing
MPS1 did undergo nuclear oscillations, albeit less frequently than
dicentric cdc5ad rad52 cells
(Table 3). Our results indicate
that the sequestration of cells in a mitotic arrest state is not of itself
sufficient to promote nuclear oscillations.
Nuclear oscillations in dicentric cdc5ad rad52 cells are
microtubule- and ATP-dependent but do not require dynein
Microtubules are required for the oscillatory nuclear movements that occur
during meiotic prophase S. pombe
(Ding et al., 1998
). To
determine if nuclear oscillations in dicentric cdc5-ad rad52 cells
also depend on microtubules, we treated cells with media containing 100
µg/ml of the microtubule-destabilizing drug benomyl. Real-time observation
of 10 benomyl-treated cells over a period of 30 minutes to 1 hour revealed no
evidence of the nuclear movements seen in the untreated cells
(Fig. 4A-D). Some of the
benomyl-treated cells contained nuclear filaments, but no growth or shortening
of the filaments was observed and no new filaments formed during the period
when cells were exposed to the drug. This result demonstrates that nuclear
oscillations in dicentric cdc5-ad rad52 cells require
microtubules.
|
In addition to microtubules, meiotic nuclear oscillations in fission yeast
require the microtubule motor dynein
(Yamamoto et al., 1999
). In
budding yeast, dynein provides the major pulling force during anaphase and is
responsible for the nuclear oscillations observed prior to anaphase onset in
wild-type yeast cells (Yeh et al.,
2000
). Deletion of the gene encoding dynein heavy chain
(DHC1) reduces the viability of cells containing a dicentric
chromosome (Table 1). We
deleted DHC1 to determine if dynein is required for nuclear
oscillations in cdc5-ad rad52 cells. The nuclear dynamics of
dhc1 mutant cells were indistinguishable from cells containing a
functional copy of DHC1 (Fig.
4E-H). Thus, although we cannot rule out a role for dynein in
anaphase nuclear oscillations in dicentric cdc5-ad rad52 cells, it is
clearly not the only source of motility.
Because microtubule motors use ATP hydrolysis to generate movement, we
tested the ATP requirement for nuclear oscillations by treating dicentric
cdc5-ad rad52 cells with a solution containing 0.02% sodium azide and
1% deoxyglucose. To quantify the nuclear dynamics, length changes for
individual nuclear filaments were measured over time. A plot of length changes
for one nuclear filament in a cell treated with azide and deoxyglucose is
shown in Fig. 5. The
azide/deoxyglucose treatment resulted in the immediate cessation of both
nuclear oscillations and changes in nuclear morphology. Nuclear dynamics
resumed almost immediately upon removal of the azide and deoxyglucose. Growing
and shortening rates were calculated, and the percentage of total time that
filaments spent in growing, shortening or paused phases was determined (see
Materials and Methods). The dynamicity parameter, derived from studies of
microtubule dynamics, was also calculated as an overall measure of filament
growth and shortening (Toso et al.,
1993
). The results are shown in
Table 4. Depletion of ATP
resulted in a significant suppression of filament dynamics. The most notable
changes were the increase in pause time from 50% to over 90% of the total
time, and the decrease in dynamicity, with post-treatment values 13-fold lower
than the pre-treatment values. Interestingly, the rates of nuclear filament
formation and collapse in untreated cells (0.8 µm/minute) are similar to
rates of yeast cytoplasmic microtubule dynamics during anaphase
(Tirnauer et al., 1999
). Our
findings demonstrate that nuclear oscillations in dicentric cdc5-ad
rad52 cells require ATP, which is consistent with a possible role of
microtubule motors in this process.
|
|
Perturbation of microtubule function suppresses recombination between
non-centromere sequences
The association between nuclear movements and enhanced CEN repeat
recombination suggested that microtubules play a role in other recombination
events. We tested this by determining if the survival of cells containing an
inverted repeat dicentric chromosome was compromised by exposure to benomyl.
Inverted repeat dicentric chromosomes undergo RAD52-dependent
recombination between repeated sequences that flank the centromere region,
resulting in deletion of one of the CEN repeats
(Brock and Bloom, 1994
). A
reduction in the viability of an inverted dicentric strain following treatment
with benomyl would thus indicate a microtubule dependence for recombination
between non-centromeric sequences. A range of benomyl concentrations was
chosen that did not significantly inhibit cell cycle progression nor result in
detectible microtubule depolymerization (data not shown). As shown in
Fig. 6, a monocentric strain
exhibited only minor suppression of colony forming ability when plated on the
highest benomyl concentration (15 µg/ml). By contrast, the viability of
both inverted and direct repeat dicentric strains was significantly
compromised on plates containing 10-15 µg/ml of benomyl. These results
indicate that efficient recombinational repair of a dicentric chromosome
requires microtubules whether occurring through CEN repeat
recombination or by means of recombination between other repeated
sequences.
|
We further examined the potential role of microtubules in recombination by determining the effect of benomyl on the frequency of spontaneous recombination between two his3 heteroalleles flanking a copy of the URA3 gene (Table 5). Cells were plated on media containing concentrations of benomyl in the range of those used in the dicentric chromosome assay, and the his3 recombination frequency was compared with cells that had not been exposed to the drug. Recombination was suppressed 2.3-fold by 15 µg/ml benomyl. These findings indicate that microtubule-dependent processes enhance spontaneous recombination events in budding yeast, in addition to promoting recombination events associated with dicentric chromosome resolution and meiotic recombination in fission yeast.
|
| Discussion |
|---|
|
|
|---|
Centromere recombination was consistently detected prior to activation of
the dicentric chromosome in cdc5-ad rad52 cells
(Fig. 2B, lane 1). By contrast,
this was not observed with dicentric CDC5 RAD52 or cdc5-ad
RAD52 strains (Fig. 1B,
lane 1; Fig. 2A, lane 1). In
cells grown on galactose, transcriptional readthrough at the GALCEN
prevents the activation of the dicentric chromosome. However, it has been
shown that the conditional dicentric chromosome III is lost more frequently
than its monocentric counterpart on galactose
(Neff and Burke, 1992
). Thus a
functional kinetochore can form, albeit infrequently, even in the presence of
galactose. We suggest that the nuclear oscillations associated with the
cdc5-ad rad52 strain result in an increase in dicentric chromosome
breakage, leading to more frequent recombination on galactose. The reduced
functional capability of the conditional kinetochore on galactose does not
promote efficient dicentric chromosome breakage but may induce sufficient
tension on the chromosome to trigger the DNA damage response. The
DNA-damage-induced arrest in dicentric cdc5-ad rad52 cells results in
a prolonged mitotic arrest characterized by a sustained period of nuclear
oscillations. These oscillations could promote more frequent dicentric
chromosome breakage events than would normally occur in the presence of
galactose and as a consequence, more frequent CEN3 recombination.
Consistent with this, a small portion (<10%) of very large budded cells
with nuclear morphology identical to that in
Fig. 3R were found in
populations of dicentric cdc5-ad rad52 cells grown in galactose media
(data not shown). It is unlikely that this mechanism accounts for a
significant proportion of the recombination events that occur when dicentric
cells are grown on glucose, given the high efficiency of chromosome breakage
promoted by an activated GALCEN.
Live cell imaging of GFP-labeled nuclei following dicentric chromosome
activation in cdc5-ad rad52 cells allowed us to observe an extended
period of nuclear oscillations accompanied by the formation and collapse of
nuclear filaments (Figs
3,4,5).
The association of these nuclear movements with RAD52-independent
dicentric chromosome recombination suggests that this behavior might be
responsible for the CEN recombination events observed in these cells.
Microtubule-dependent oscillatory nuclear movements are also observed during
meiosis in fission yeast and are required for efficient meiotic recombination
(Chickashige et al., 1994; Ding et al.,
1998
; Yamamoto et al.,
1999
). It has been suggested that nuclear oscillations observed
during meiosis in S. pombe facilitate recombination by promoting the
alignment of homologous chromosomes
(Yamamoto et al., 1999
).
Although this exact mechanism is unlikely to explain enhanced recombination in
dicentric cdc5-ad rad52 cells, the contortions that the nucleus
undergoes during this process (Fig.
3) could increase the frequency of collisions between CEN
repeats located in the two halves of a broken dicentric chromosome. A previous
study revealed that recombination events promoted by the HO endonuclease occur
with similar frequency regardless of the location of the recombining sequences
within the genome, consistent with the idea that a homology search mechanism
may facilitate such events (Haber and
Leung, 1996
). It has also been demonstrated that increasing the
copy number of a sequence can increase the likelihood a sequence will undergo
recombination, suggesting that recombination is stimulated by increasing the
frequency with which sequences interact
(Melamed and Kupiec, 1992
).
Collision frequency may play a greater role in promoting recombinational
repair of a broken dicentric chromosome, where each half of the broken
chromosome is actively separated from the other, than it does in repair of
other types of DSBs.
Nuclear oscillations are not unique to dicentric cdc5-ad cells. We
have observed cells exhibiting this behavior as a consequence of MPS1
overexpression (Table 3), and
nuclear transits between the yeast mother cell and bud have previously been
reported in cdc13, cdc16, and cdc23 mutant cells following
their release from a mitotic arrest
(Palmer et al., 1989
). The
proteins encoded by CDC16 and CDC23 are part of the
anaphase-promoting complex (APC) that facilitates entry into and exit from
anaphase. The cdc13 arrest occurs through a RAD9-dependent
DNA damage response pathway that prevents progression into anaphase by
inhibiting the APC-dependent degradation of Pds1/Securin. Recent studies have
shown that a reduction in Pds1 levels at anaphase onset is required for
anaphase spindle stability (Jensen et al.,
2001
; Severin et al.,
2001
). Spindle instability could result in alterations in spindle
length and could account for the conversion of elongated/bilobed nuclei to
spherical structures observed in dicentric cdc5-ad rad52 cells (see
Fig. 3H-I). Interestingly, APC
complexes immunoprecipitated from cdc5-ad mutant cells exhibit a
reduced degree of ubiquitination activity
(Charles et al., 1998
).
Ubiquitination of Pds1 is a prerequisite for its degradation, and the
persistence of elevated levels of Pds1 in cdc5-ad mutant cells could
lead to spindle instability and contribute to nuclear oscillations. Future
experiments will be required to determine whether nuclear oscillations result
from spindle microtubule dynamics, cytoplasmic microtubule dynamics or a
combination of the two.
The association of microtubule-dependent nuclear oscillations with
CEN recombination raised the question of whether microtubules play a
role in recombination events involving other homologous repeats. To test this
hypothesis we examined the effect of low concentrations of benomyl on a
dicentric chromosome repair process that involves recombination between
non-centromere sequences (Fig.
6) and the effect of this drug on spontaneous recombination
between of a pair of his3 heteroalleles
(Table 5). We have observed
that concentrations of benomyl in the range used in our experiments suppress
the dynamic instability behavior of cytoplasmic microtubules and yeast
kinetochore movements during mitosis (K.B. and Chad Pearson, unpublished). The
growth and shortening of microtubules is responsible, at least in part, for
nuclear movements that occur throughout the cell cycle in budding yeast
(Shaw et al., 1997b
) and for
chromosome movements during mitosis
(Pearson et al., 2001
). Thus
it is likely that the significant reduction in viability of cells containing a
dicentric chromosome in response to exposure to benomyl is due to decreased
chromosome breakage resulting from suppressed microtubule dynamics. The
suppression of recombination revealed by the his3 assay system
indicates that microtubules may play a more general role in facilitating
efficient recombination. It is unlikely that this effect was the result of the
moderate decrease in growth rate that accompanied the benomyl treatments given
that previous studies have shown that cell cycle delays have either a positive
effect or no significant impact on DNA repair
(Weinert and Hartwell, 1988
;
Brock and Bloom, 1994
).
Previous studies have shown that spontaneous intrachromosomal recombination
occurs at a higher rate than spontaneous recombination between sequences
located on different chromosomes (Lichten
and Haber, 1989
;
Jinks-Robertson et al., 1993
).
This indicates that a collision-based homology search may not play a
significant role in this type of recombination. It is assumed from the similar
genetic requirements of recombination induced by agents that produce DSBs and
those required for spontaneous recombination that the latter events are
likewise promoted by DSBs. The source of these cryptic DSBs has not been
definitively identified. On the basis of our finding that low concentrations
of benomyl suppress recombination, we suggest that a portion of the DSBs
involved in these recombination events result from microtubule-generated
nuclear movements. Further, the modest effect of the drug treatments on this
process indicates that both dependent and microtubule-independent sources of
DSBs give rise to spontaneous recombination events.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Aragon-Alcaide, L. and Strunnikov, A. V. (2000). Functional dissection of in vivo interchromosome association in Saccharomyces cerevisiae. Nat. Cell. Biol. 2,812 -818.[CrossRef][Medline]
Brock, J. A. and Bloom, K. (1994). A chromosome breakage assay to monitor mitotic forces in budding yeast. J. Cell Sci. 107,891 -902.[Abstract]
Charles, J. F., Jaspersen, S. L., Tinker-Kulberg, R. L., Hwang, L., Szidon, A. and Morgan, D. O. (1998). The Polo-related kinase Cdc5 activates and is destroyed by the mitotic cyclin destruction machinery in S. cerevisiae. Curr. Biol. 8, 497-507.[CrossRef][Medline]
Chikashige, Y., Ding, D. Q., Funabiki, H., Haraguchi, T.,
Mashiko, S., Yanagida, M. and Hiraoka, Y. (1994).
Telomere-led premeiotic chromosome movement in fission yeast.
Science 264,270
-273.
Ding, D. Q., Chikashige, Y., Haraguchi, T. and Hiraoka, Y. (1998). Oscillatory nuclear movement in fission yeast meiotic prophase is driven by astral microtubules, as revealed by continuous observation of chromosomes and microtubules in living cells. J. Cell Sci. 111,701 -712.[Abstract]
Fasullo, M., Bennett, T., AhChing, P. and Koudelik, J.
(1998). The Saccharomyces cerevisiae RAD9 checkpoint
reduces the DNA damage-associated stimulation of directed translocations.
Mol. Cell. Biol. 18,1190
-1200.
Fishman-Lobell, J., Rudin, N. and Haber, J. E.
(1992). Two alternative pathways of double-strand break repair
that are kinetically separable and independently modulated. Mol.
Cell. Biol. 12,1292
-1303.
Galgoczy, D. J. and Toczyski, D. P. (2001).
Checkpoint adaptation precedes spontaneous and damage-induced genomic
instability in yeast. Mol. Cell. Biol.
21,1710
-1718.
Haber, J. E. and Leung, W. Y. (1996). Lack of
chromosome territoriality in yeast: promiscuous rejoining of broken chromosome
ends. Proc. Natl. Acad. Sci. USA
93,13949
-13954.
Hill, A. and Bloom, K. (1989). Acquisition and
processing of a conditional dicentric chromosome in Saccharomyces
cerevisiae. Mol. Cell. Biol.
9,1368
-1370.
Ivanov, E. L. and Haber, J. E. (1995).
RAD1 and RAD10, but not other excision repair genes, are
required for double-strand break-induced recombination in Saccharomyces
cerevisiae. Mol. Cell. Biol.
15,2245
-2251.
Jager, D. and Philippsen, P. (1989). Stabilization of dicentric chromosomes in Saccharomyces cerevisiae by telomere addition to broken ends or by centromere deletion. EMBO J. 8,247 -254.[Medline]
Jensen, S., Segal, M., Clarke, D. J. and Reed, S. I.
(2001). A novel role of the budding yeast separin Esp1 in
anaphase spindle elongation: evidence that proper spindle association of Esp1
is regulated by Pds1. J. Cell Biol.
152, 27-40.
Jinks-Robertson, S., Michelitch, M. and Ramcharan, S.
(1993). Substrate length requirements for efficient mitotic
recombination in Saccharomyces cerevisiae. Mol. Cell.
Biol. 13,3937
-3950.
Klein, H. (1988). Different types of
recombination events are controlled by the RAD1 and RAD52
genes of Saccharomyces cerevisiae. Genetics
120,367
-377.
Kramer, K. M., Brock, J. A., Bloom, K., Moore, J. K. and Haber,
J. E. (1994). Two different types of double-strand breaks in
Saccharomyces cerevisiae are repaired by similar
RAD52-independent, nonhomologous recombination events.
Mol. Cell. Biol. 14,1293
-1301.
Lauze, E., Stoelcker, B., Luca, F. C., Weiss, E., Schutz, A. R. and Winey, M. (1995). Yeast spindle pole body duplication gene MPS1 encodes an essential dual specificity protein kinase. EMBO J. 14,1655 -1663.[Medline]
Lichten, M. and Haber, J. E. (1989). Position
effects in ectopic and allelic mitotic recombination in Saccharomyces
cerevisiae. Genetics 123,261
-268.
Liefshitz, B., Parket, A., Maya, R. and Kupiec, M. (1995). The role of DNA repair genes in recombination between repeated sequences in yeast. Genetics 140,1199 -1211.[Abstract]
Melamed, C. and Kupiec, M. (1992). Effect of donor copy number on the rate of gene conversion in the yeast Saccharomyces cerevisiae. Mol. Gen. Genet. 235,97 -103.[CrossRef][Medline]
Neff, M. W. and Burke, D. J. (1992). A delay in
the Saccharomyces cerevisiae cell cycle that is induced by a
dicentric chromosome and dependent upon mitotic checkpoints. Mol.
Cell. Biol. 12,3857
-3864.
Palmer, R. E., Koval, M. and Koshland, D.
(1989). The dynamics of chromosome movement in the budding yeast
Saccharomyces cerevisiae. J. Cell. Biol.
109,3355
-3366.
Pearson, C. G., Maddox, P. S., Salmon, E. D. and Bloom, K.
(2001). Budding yeast chromosome structure and dynamics during
mitosis. J. Cell Biol.
152,1255
-1266.
Plessis, A., Perrin, A., Haber, J. E. and Dujon, B. (1992). Site-specific recombination determined by I-SceI, a mitochondrial group intron-encoded endonuclease expressed in the yeast nucleus. Genetics 130,451 -460.[Abstract]
Prado, F. and Aguilera, A. (1995). Role of reciprocal exchange, one-ended invasion crossover and single-strand annealing on inverted and direct repeat recombination in yeast: different requirements for the RAD1, RAD10, and RAD52 genes. Genetics 139,109 -123.[Abstract]
Qiu, J., Qian, Y., Chen, V., Guan, M. X. and Shen, B.
(1999). Human exonuclease 1 functionally complements its yeast
homologues in DNA recombination, RNA primer removal, and mutation avoidance.
J. Biol. Chem. 274,17893
-17900.
Rothstein, R. (1991). Targeting, disruption, replacement, and allele rescue: integrative DNA transformation in yeast. Meth. Enzymol. 194,281 -301.[CrossRef][Medline]
Schiestl, R. H. and Prakash, S. (1990). RAD10,
an excision repair gene of Saccharomyces cerevisiae, is involved in
the RAD1 pathway of mitotic recombination. Mol. Cell.
Biol. 10,2485
-2491.
Severin, F., Hyman, A. A. and Piatti, S.
(2001). Correct spindle elongation at the metaphase/anaphase
transition is an APC-dependent event in budding yeast. J. Cell
Biol. 155,711
-717.
Shaw, S. L., Yeh, E., Bloom, K. and Salmon, E. D. (1997a). Imaging green fluorescence protein fusion proteins in Saccharomyces cerevisiae. Curr. Biol. 7, 701-704.[CrossRef][Medline]
Shaw, S. L., Yeh, E., Maddox, P., Salmon, E. D. and Bloom,
K. (1997b). Astral microtubule dynamics in yeast: a
microtubule-based searching mechanism for spindle orientation and nuclear
migration into the bud. J. Cell Biol.
139,985
-994.
Siede, W., Friedberg, A. S. and Friedberg, E. C.
(1993). Evidence that the Rad1 and Rad10 proteins of
Saccharomyces cerevisiae participate as a complex in nucleotide
excision repair of UV radiation damage. J. Bacteriol.
175,6345
-6347.
Sugawara, N. and Haber, J. E. (1992).
Characterization of double-strand break-induced recombination: homology
requirements and single-stranded DNA formation. Mol. Cell.
Biol. 12,563
-575.
Sung, P., Reynolds, P., Prakash, L. and Prakash, S.
(1993). Purification and characterization of the
Saccharomyces cerevisiae RAD1/RAD10 endonuclease. J. Biol.
Chem. 268,26391
-26399.
Thomas, B. J. and Rothstein, R. (1989). Elevated recombination rates in transcriptionally active DNA. Cell 56,619 -630.[CrossRef][Medline]
Tirnauer, J. S, O'Toole, E., Berrueta, L., Bierer, B. E. and
Pellman, D. (1999). Yeast Bim1p promotes the G1-specific
dynamics of microtubules. J. Cell Biol.
145,993
-1007.
Toczyski, D. P., Galgoczy, D. J. and Hartwell, L. H. (1997). CDC5 and CKII control adaptation to the yeast DNA damage checkpoint. Cell 90,1097 -1106.[CrossRef][Medline]
Toso, R. J., Jordan, M. A., Farrell, K. W., Matsumoto, B. and Wilson, L. (1993). Kinetic stabilization of microtubule dynamic instability in vitro by vinblastine. Biochemistry 32,1285 -1293.[CrossRef][Medline]
Weinert, T. A. and Hartwell, L. H. (1988). The
RAD9 gene controls the cell cycle response to DNA damage in Saccharomyces
cerevisiae. Science 241,317
-322.
White, C. I. and Haber, J. E. (1990). Intermediates of recombination during mating type switching in Saccharomyces cerevisiae. EMBO J. 9, 663-673.[Medline]
Winey, M. and Huneycutt, B. J. (2002). Centrosomes and checkpoints: the MPS1 family of kinases. Oncogene 21,6161 -6169.[CrossRef][Medline]
Yamamoto, A., West, R. R., McIntosh, J. R. and Hiraoka, Y.
(1999). A cytoplasmic dynein heavy chain is required for
oscillatory nuclear movement of meiotic prophase and efficient meiotic
recombination in fission yeast. J. Cell Biol.
145,1233
-1249.
Yang, S. S., Yeh, E., Salmon, E. D. and Bloom, K.
(1997). Identification of a mid-anaphase checkpoint in budding
yeast. J. Cell Biol.
136,345
-354.
Yeh, E., Yang, C., Chin, E., Maddox, P., Salmon, E. D., Lew, D.
J. and Bloom, K. (2000). Dynamic positioning of mitotic
spindles in yeast: role of microtubule motors and cortical determinants.
Mol. Biol. Cell 11,3949
-3961.
This article has been cited by other articles:
![]() |
R. A. Haeusler, M. Pratt-Hyatt, P. D. Good, T. A. Gipson, and D. R. Engelke Clustering of yeast tRNA genes is mediated by specific association of condensin with tRNA gene transcription complexes Genes & Dev., August 15, 2008; 22(16): 2204 - 2214. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Bloom Microtubule composition: Cryptography of dynamic polymers PNAS, May 4, 2004; 101(18): 6839 - 6840. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||