|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 23 December 2002
doi: 10.1242/jcs.00267
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
Lung Epithelial Cell Biology Laboratories, Pulmonary and Critical Care Division, Department of Medicine, University of Pennsylvania School of Medicine, Philadelphia, PA 19104, USA
* Author for correspondence (e-mail: mfbeers{at}mail.med.upenn.edu)
Accepted 9 November 2002
| Summary |
|---|
|
|
|---|
Exon4) resulting in removal of a positionally conserved cysteine in
the C-terminal flanking propeptide. Based on a prior study showing that an
identical deletion in the rat isoform diverted mutant protein to stable
aggregates, we hypothesized that expression of the
Exon4 mutation would
result in disruption of intracellular trafficking of both mutant and wild-type
proSP-C. We tested this in vitro using fusion proteins of EGFP conjugated
either to wild-type SP-C (EGFP/hSP-C1-197) or to SP-C deleted of
Exon4 (EGFP/hSP-C
Exon4). Fluorescence microscopy showed that
EGFP/hSP-C1-197 transfected into A549 cells was expressed in a
punctuate pattern in CD63 (+) cytoplasmic vesicles, whereas
EGFP/hSP-C
Exon4 accumulated in ubiquitinated perinuclear
inclusions linked to the microtubule organizing center. A similar juxtanuclear
pattern was observed following transfection of SP-C cDNA lacking only cysteine
residues in the C-terminal propeptide encoded by Exon 4
(EGFP/hSP-CC120/121G). To evaluate whether mutant proSP-C could
function as a dominant negative, EGFP/hSP-C
Exon4 was
cotransfected with HA-tagged hSP-C1-197 and resulted in the
restriction of both forms to perinuclear compartments. Addition of
Na+ 4-phenylbutyrate, a facilitator of trafficking of other
misfolded proteins, attenuated the aggregation of
EGFP/hSP-C
Exon4. We conclude that c.460+1A>G mutation of
human SP-C results in disruption of disulfide-mediated folding encoded by Exon
4 leading to diversion of unprocessed proSP-C to aggresomes. The heterotypic
oligomerization of hSP-C1-197 and hSP-C
Exon4
provides a molecular mechanism for the dominant-negative effect observed in
vivo.
Key words: Surfactant Protein C, Interstitial lung disease, Protein trafficking, Aggresome, Conformational disease
| Introduction |
|---|
|
|
|---|
1
antitrypsin deficiency (Carrell and Lomas,
2002
Surfactant protein C (SP-C) is a 35 amino acid hydrophobic lung-specific
protein produced exclusively by alveolar type 2 cells
(Weaver and Conkright, 2001
;
Weaver, 1998
;
Solarin et al., 2001
). The
extreme hydrophobicity of the alveolar form (SP-C3.7) is due to a
23 amino acid, polyvaline domain. Modeling of its secondary structure and
biophysical analyses of purified SP-C3.7 indicate that in a lipid
environment, monomeric SP-C (positions 9-34) exists as a stable valyl-rich
helix oriented parallel to lipid acyl chains and able to span phospholipid
bilayers. In solution, monomeric SP-C transforms from
-helix to
ß-sheet aggregates reminiscent of amyloid fibril formation. Amyloid SP-C
fibrils were isolated from bronchoalveolar lavage of patients with alveolar
proteinosis demonstrating a propensity for this motif to undergo
conformational changes (Gustafsson et al.,
1999
; Johansson,
2001
; Kallberg et al.,
2001
).
Human SP-C (hSP-C1-197) is synthesized as a 197 amino acid
proprotein and proteolytically processed as an integral membrane protein to
the 3.7 kDa mature form that is subsequently transferred to the lumen of
lamellar bodies for secretion into the alveolar space with surfactant
phospholipids (Beers, 1998
;
Solarin et al., 2001
).
Complete biosynthesis requires four endoproteolytic cleavages of the SP-C
propeptide and depends upon oligomeric sorting and targeting to subcellular
processing compartments distal to the Golgi
(Beers and Lomax, 1995
;
Johnson et al., 2001
;
Vorbroker et al., 1995
;
Wang et al., 2002
). Studies
using both the rat and human isoforms have demonstrated that the mature SP-C
domain contained within the propeptide (residues 24-58) functions as a
signal-anchor sequence effecting endoplasmic reticulum (ER) translocation,
establishing a type II (NH2cytoplasm/COOHlumen) integral
membrane orientation, and facilitating homomeric association during sorting
(Russo et al., 1999
;
Keller et al., 1991
;
Wang et al., 2002
). The
NH2 flanking propeptide contains a functional targeting motif
(E11-T19) for direction to late compartments; deletion
or alteration of this region results in ER retention
(Johnson et al., 2001
).
Conversely, removal or alteration of one or more cysteine residues from the
COOH flanking propeptide results in mutant protein accumulation in a novel
juxtanuclear compartment, the aggresome
(Beers et al., 1998
;
Kabore et al., 2001
).
Although the SP-C null mouse is viable
(Glasser et al., 2001
), recent
reports in humans have shown heterozygous expression of over ten different
mutant proSP-C forms in association with an absence of mature SP-C and
interstitial lung disease (Nogee et al.,
2001
; Thomas et al.,
2002
; Nogee et al.,
2002
). The first SP-C mutation associated with interstitial lung
disease was described in a term infant and mother both heterozygous for a G to
A base substitution in the first codon of Intron 4
(Nogee et al., 2001
). This
mutation leads to abnormal splicing and a skip of Exon 4
(`hSP-C
Exon4') producing a foreshortened proSP-C lacking a
conserved cysteine residue in the flanking COOH propeptide. Since cysteines in
human proSP-C deleted by this mutation are positionally identical to a
cysteine residue in the COOH flanking propeptide of the rat isoform that is
essential for normal trafficking (Russo et
al., 1999
), we hypothesized that expression of the
hSP-C
Exon4 isoform would result in disruption of COOH
propeptide folding manifested in vitro by abnormal intracellular trafficking
of mutant proSP-C, aggresome formation, and disruption of biosynthesis of the
wild-type SP-C through creation of a dominant-negative effect.
To test this hypothesis, we expressed fusion proteins of EGFP and human
proSP-C mutants lacking conserved cysteine residues, including the
hSP-C
Exon4 mutation, and evaluated targeting and processing
of expressed proteins in a transfected alveolar epithelial cell line. We
report the first demonstration that expression of a clinically defined SP-C
mutation results in accumulation of unprocessed, aberrant protein forms in a
juxtanuclear compartment associated with components of the microtubule
organizing center (MTOC). In addition, co-expression of the
hSP-C
Exon4 variant with hSP-C1-197 is shown to
also disrupt trafficking of the wild-type isoform. Finally, the oral butyrate
analog, sodium 4-phenylbutyrate (4-PBA), which has been shown to promote
trafficking of other mutant proteins such as CFTR, corrected mutant proSP-C
juxtanuclear protein accumulation in vitro.
| Materials and Methods |
|---|
|
|
|---|
ProSP-C antiserum
A monospecific polyclonal rat proSP-C antiserum was produced from a
synthetic peptide antigen and has been previously characterized
(Beers et al., 1994
).
Anti-NPROSP-C (Met10 to Glu23) recognizes
proSP-C21 and all major intermediates but does not recognize mature
SP-C.
SP-C and EGFP/SP-C expression constructs
pcDNA3-hSP-C (6+)
A full-length human SP-C cDNA insert of 875 bp corresponding to the
published sequence of Warr et al. (Warr et
al., 1987
) was the generous gift of Philip Ballard. This insert
was subcloned into the pcDNA3 eukaryotic expression vector polylinker at the
EcoRI site as previously described for rat SP-C
(Beers et al., 1998
).
EGFP/hSP-C
A family of chimeric fusion proteins consisting of EGFP and wild-type human
SP-C (Met1 to Ile197) or SP-C cDNA either lacking Exon 4
or containing point mutations in cysteine residues in the COOH flanking
propeptide were generated by polymerase chain reaction (PCR)
(Fig. 1).
|
For EGFP/hSP-C1-197, pcDNA3-hSP-C (6+) served as template for a
two primer single PCR reaction. The primers used were: (forward)
5'-dTACAAGTCCGGAATGGATGTGGGCAGCAAAGAGGTCCTG; (reverse)
3'-dTCTAGATGCATGCTCGAGCG. Amplification reactions containing 0.2 µM
primers, 1.25 µM dNTP mixture, 1.5 µM MgCl2, 10 ng template,
and 2.5 U VentR DNA polymerase (New England Biolabs, Beverly, MA)
consisted of 30 cycles under previously published conditions
(Johnson et al., 2001
). An
in-frame fusion protein was made through introduction of a BspEI site
at the 5' end and an XhoI site at the 3' end for cloning
into pEGFP-C1.
For mutant EGFP/hSP-CC189G, a two primer single reaction PCR technique was also used with pcDNA3-hSP-C (6+) serving as template. The primers used were: (forward) 5'-dTCCGGAC-TCAGATCTATGGATGTGGGCAGCAAAGAGGTCCTG; (reverse) 3'-dTCCGGTGGATCCCTAGATGTAGTAGAGCGGCACCTCGCC-ACCCAGGGTGTTCAC. Amplification produced a purified PCR insert containing the desired point mutation at codon 189 and lacking the 3' untranslated region which was ligated into pEGFP-C1 following digestion with BamHI and BglII.
For construction of EGFP/hSP-CC121/122G, mutagenesis was
performed by overlap extension PCR with a two round, four-primer technique as
previously published (Russo et al.,
1999
). The primers are listed in
Table 1. Purified intermediate
segments (SP-C1-125X and SP-C117-197) generated in
separate PCR reactions using pcDNA3-hSP-C (6+) as the template with primers A
and B or primers C and D were fused with a second round of PCR using primers
complementary to the 5' -and 3' -ends (primers A and D,
respectively). The resulting mutant insert, hSP-CC121/122G
containing the 3' untranslated region was purified and ligated into
pEGFP-C1 after digestion with BglII and
BamHI.
|
For creation of EGFP/hSP-C
Exon4, deletion of exon 4 from
pcDNA-hSP-C (6+) was also achieved by overlap extension PCR with a two round,
four-primer technique. Exons 1-3 were amplified by single PCR using 2 primers:
(forward) dTACAAGTCCGGAATGGATGTGGGCAGCAAAGAGGTCCTG; (reverse)
dCTGCTGGTAGTCATACACCACGAGGCC. The other primary reaction amplified exon
5 through the 3' untranslated Poly A tail using a forward primer
containing complete overlap with the 3' end of the reverse primer used
to amplify Exon 3 (bold): (forward)
dGGCCTCGTGGTGTATGACTACCAGCAGATGGAATGCTCT CTGCAGGCCAAGCCC; (reverse):
dTCTAGATGCATGCTCGAGCG. The two overlapping primary products were fused by
SOEing PCR using (forward) dTACAAGTCCGGAATGGATGTGGGCAGCAAAGAGGTCCTG and
(reverse) dTCTAGATGCATGCTCGAGCG. Following digestion with
BspEI and XhoI, the
Exon4 insert was subcloned into
pEGFPC1.
A triple mutant lacking all three cysteines in the COOH domain (EGFP/SP-CC120/122/189G) was created by a single PCR performed using EGFP/hSP-CC121/122G as template with a primer set identical to that used to generate EGFP/hSP-CC189G.
Hemagglutinin-A-tagged wild-type proSP-C
By using pcDNA-hSP-C1-197 as a template, the hemagglutinin (HA)
tag (YPYDVPDYA) was added to the N-terminus of hSP-C1-197 by PCR.
The 5' (forward) primer was an 84mer and contained a KpnI site
(bold), a Kozak sequence, and the HA-coding sequence (underlined):
TCCGGACTCGGTACCATGGATTACCCATACGATGTTCCAGATTACGCTGCTGATGTGGGCAGCAAAGAGGTCCTGATGGAGAGC.
The 3' (reverse) primer was a 36mer that contained a BamHI site
(bold): CTATAGGGATCCGCCCTCTAGATGCATCCTCGACCC. The purified insert was
subcloned back into the pcDNA3 vector using digestion with KpnI and
BamHI.
All other procedures involving oligonucleotide and cDNA manipulations were
performed essentially as described (Ausbel
et al., 1995
). Automated DNA sequencing in both directions failed
to detect nucleotide mutations in wild-type or mutant SP-C constructs.
A549 cell line and transfection
The lung epithelial cell line A549 used in transfection studies was
originally obtained through the American Type Culture Collection (Manasas, VA)
and has been used in prior studies (Beers
et al., 1998
; Russo et al.,
1999
; Kabore et al.,
2001
). A549 cells grown to 50% confluence on glass coverslips were
transiently transfected with EGFP/SP-C constructs (10 µg/dish) or
co-transfected with two different constructs (5 µg/construct/dish) by
CaPO4 precipitation as previously described
(Russo et al., 1999
). Where
indicated, 4-PBA was added at the time of transfection and continued until
harvest.
Immunohistochemistry
For double label studies, immunostaining of permeabilized cells fixed by
immersion of coverslips in 4% paraformaldehyde was performed by incubation
with primary antisera for 1 hour at room temperature followed by either
secondary goat anti-mouse IgG monoclonal or secondary goat anti-rabbit IgG
polyclonal antisera (Kabore et al.,
2000
; Russo et al.,
1999
). Fluorescence images of air-dried and Mowiol mounted slides
were viewed on an Olympus I-70 inverted fluorescence microscope with filter
packages High Q fluorescein isothiocyanate for EGFP (excitation at 480 nm,
emission at 535/550 nm), and High Q TR for Texas Red (excitation at 560/555
nm, emission at 645/675 nm) obtained from Chroma Technology (Brattleboro, VT).
Image acquisition, processing, and overlay analysis were performed using
IMAGE1 software (Universal Imaging, West Chester, PA).
Polyacrylamide gel electrophoresis and immunoblotting
Cell pellets collected by scraping and centrifugation at 300
g were solubilized with 40 µl of solubilization buffer (50
mM Tris, 190 mM NaCl, 6 mM EDTA, 2% Triton X-100, 1 mM PMSF, pH 7.4).
Following centrifugation at 8000 g for 30 seconds to remove
nuclei, proteins were separated by electrophoresis on a 12% polyacrylamide gel
and transferred to nitrocellulose
(Laemmli, 1970
).
Immunoblotting of transferred samples was done using successive incubations with primary polyclonal GFP antisera (1:5000) for 1 hour and goat anti-rabbit horseradish peroxidase-conjugated secondary antibody (1:10,000) for 1 hour at room temperature. Bands were visualized by enhanced chemiluminescence using a commercially available kit (Amersham, Arlington Heights, IL).
| Results |
|---|
|
|
|---|
|
The vesicular compartment targeted by wild-type proSP-C was identified using double-label fluorescence microscopy. Transfected EGFP/hSP-C1-197 expression was spatially restricted to CD-63-positive compartments, a marker antigen associated with lamellar bodies and to multivesicular bodies of type 2 cells (Fig. 3). Furthermore, this compartment was Calnexin-negative, EEA1-negative, and failed to stain for ubiquitin (data not shown). Collectively, these data indicate that, in this model, proSP-C is directed to a lysosomal like organelle that shares antigen markers with lamellar bodies of type 2 cells.
|
Altered distribution of EGFP/hSP-C
Exon4 expressed
in lung epithelial cells
In contrast to wild-type human SP-C, EGFP fusion proteins containing the
SP-C
Exon4 mutant were expressed in a time frame similar to
that of wild-type proSP-C but were retained in proximal, juxtanuclear
compartments (Fig. 4C).
|
Western blotting of A549 cell lysates using an anti-EGFP antisera
demonstrated that the mutant proSP-C protein forms expressed by
EGFP/hSP-C
Exon4 represented steady-state accumulation of an
unprocessed, non-degraded fusion protein
(Fig. 4E). The anti-EGFP
antisera detected a major product of 27 kDa for cells transfected with EGFP
alone. When wild-type EGFP/hSP-C1-197 was introduced, lysates
contained two sets of anti-EGFP-positive bands. A doublet corresponding to the
primary translation product of the fusion protein (Mr
48,000) and an accompanying higher molecular weight form
(Mr 50,000) consistent with the known palmitoylated
isoform is seen. A second set of two smaller intermediates was also
identified; however, a band at 27 kDa (consistent with liberation of free
EGFP) was not found. This profile is consistent with the notion that human
SP-C-EGFP was palmitoylated and partially processed in this cell model by
proteolysis of the C-terminus but without proteolytic modification of the
NH2 propeptide. In contrast to wild-type proSP-C, expression of the
hSP-C
Exon4 mutant resulted in formation of a single product
representing a truncated primary translation product expressed without further
modification. Together, the immunocytochemistry and western blotting data
demonstrate that hSP-C
Exon4 accumulates in perinuclear
inclusions without processing or degradation.
Human SP-C
Exon4 is directed to aggresomes
Since the recognition of abnormal and misfolded proteins is mediated by
ubiquitin that promotes delivery of substrates to the 28S proteasome, we
performed immunocytochemical staining of transfected A549 cells to further
characterize the compartment. In contrast to wild-type SP-C, aggregates formed
following transfection with EGFP/hSP-C
Exon4 were
ubiquitinated (Fig. 5A-C).
Furthermore, this compartment was CD63 and calnexin-negative (not shown) but
in close approximation to tubulin-containing filaments, which suggested
localization near the microtubule-organizing center (MTOC)
(Fig. 5D-F). Taken together,
the data suggest that the expression of the hSP-C
Exon4
mutant results in accumulation of mutant forms in a compartment compatible
with aggresomes.
|
Alteration of EGFP/hSP-C expression is promoted by disruption of
disulfide-mediated folding
To examine the mechanism underlying the accumulation of
hSP-C
Exon4 in aggresome structures, we performed
site-directed mutagenesis to effect conservative substitution of Cys120 and
Cys121 encoded within the fourth exon of human SP-C. When coupled to EGFP,
subcellular expression patterns for the fusion protein were similar to those
seen with removal of the entire fourth exon
(Fig. 6C). As for
EGFP/hSP-C
Exon4, aggregate formation was accompanied by
colocalization with ubiquitin and
-tubulin (data not shown). Western
blotting demonstrated that all cysteine mutant SP-C isoforms were expressed as
single bands, which indicates that, as for SP-C
Exon4, COOH
propeptide mutations result in stable formation of unprocessed forms.
|
Human SP-C
Exon4 acts a dominant negative
Previously published in vitro evidence indicated that trafficking of SP-C
occurred via formation of oligomeric complexes
(Wang et al., 2002
). Because
cases of interstitial lung disease associated with heterozygous expression of
the hSP-C
Exon4 mutation also manifested a lack of detectable
mature SP-C (Nogee et al.,
2001
), we hypothesized that the mutant protein could act to
produce a dominant-negative effect by trapping wild-type protein in proximal
compartments. To study this interaction, cotransfection studies were performed
using EGFP/hSP-C
Exon4 and an HA-tagged wild-type human SP-C
expressed in the pcDNA3 vector (Fig.
7). Cotransfection of both tagged wild-type forms
(EGFP/SP-C1-197 and HA/SP-C1-197) resulted in
co-expression of each fusion protein in the same cytosolic vesicles
(Fig. 7A-C). In contrast, the
co-expression of EGFP/hSP-C
Exon4 and HA/SP-C1-197
was now associated with restriction of both forms to perinuclear compartments
(Fig. 7D-F). These results are
consistent with the notion that heteromeric sorting of
hSP-C
Exon4 mutants and wild-type SP-C can produce a
functional dominant negative to inhibit the trafficking of wild-type
protein.
|
Treatment with chemical chaperones alters intracellular distribution
of EGFP/hSP-C
Exon4
4-Phenylbutyric acid has been shown to facilitate the trafficking of mutant
508CFTR both in vitro and in vivo
(Rubenstein et al., 1997
;
Rubenstein and Zeitlin, 2000
).
To investigate whether 4-PBA could alter aggregation of mutant SP-C, A549
cells transfected with EGFP/hSP-C
Exon4 were treated with
increasing concentrations of 4-PBA for 48 hours. In contrast to cells treated
with saline alone, A549 cells expressing mutant
EGFP/hSP-C
Exon4 showed redirection of mutant fusion protein
to cytosolic vesicles (Fig. 8).
The in vitro pharmacological correction of juxtanuclear accumulation of mutant
SP-C in A549 epithelial cells occurred at a range of doses from 1 to 5 mM.
Doses greater than 5 mM were associated with cellular toxicity.
|
| Discussion |
|---|
|
|
|---|
1-antitrypsin deficiency
(Carrell and Lomas, 2002
Exon4, recently identified in a mother
and daughter each heterozygous for the mutation and both with a biopsy
diagnosis of interstitial lung disease
(Nogee et al., 2001
Exon4 mutation results in
juxtanculear accumulation of unprocessed mutant protein forms that produce a
dominant-negative effect on the trafficking of co-expressed wild-type proSP-C.
Importantly, as has been observed with CFTR, treatment with sodium
4-phenylbutyrate (4-PBA), which is implicated in the regulation of endogenous
chaperones, is shown to attenuate the altered expression pattern.
The expression of mutant hSP-C
Exon4 is characterized by
disruption of trafficking in the earliest compartments. Previously, ten Brinke
et al., has demonstrated that a mutation in the N-terminal portion of human
SP-C (hSP-CK34R35) resulted in blockade of egress of proSP-C from
the ER and inhibited its palmitoylation, a Golgi-mediated event
(ten Brinke et al., 2001
). On
SDS/PAGE analysis, we found that the EGFP fusion protein containing wild-type
SP-C produces a high molecular weight doublet
(Fig. 6E) that has been show to
correlate with generation of a primary translation product and a higher
molecular weight dipalmitoylated form
(Vorbroker et al., 1992
). A
single band was observed when mutant SP-C forms containing deletions or
mutations of COOH cysteine residues (hSP-C
Exon4,
hSP-CC120/121G and hSP-CC189G) were expressed. The lack
of a doublet is consistent with inhibition of delivery of these isoforms to
the Golgi. However, unlike the persistent ER retention noted by ten Brinke et
al., for the non-palmitoylated hSP-CK34R35 mutant, the fluorescence
microscopy for EGFP/hSP-C
Exon4 protein instead demonstrates
accumulation in a cytosolic compartment. Coupled with immunocytochemistry
showing the presence of ubiquitination (a cytosolic event) and colocalization
with
-tubulin, trafficking of the hSP-C
Exon4 mutant
is consistent with ER translocation, misfolding, retrotranslocation,
ubiquitination and clustering near the MTOC, prerequisites for the formation
of a novel cellular structure termed the aggresome
(Johnston et al., 1998
;
Kopito and Ron, 2000
;
Kopito, 2000
).
A further consequence of mutant protein expression is an inhibition of
cellular trafficking of wild-type SP-C. Recently, we have shown using
crosslinking of transfected A549 cell lysates with bis-malemeidohexane that
multimeric forms of wild-type rat SP-C fusion proteins
(EGFP/SP-C1-194) are generated indicating that SP-C biosynthesis
involves oligomeric association of proSP-C monomers
(Wang et al., 2002
). Thus, the
results presented here are consistent with a dominant-negative effect induced
by heteromeric sorting of wild-type and mutant protein to the same
compartment. A schematic of the molecular modeling for the heteromeric
interaction of wild-type and mutant SP-C is shown in
Fig. 9. In this model, the
early aggregation of heteromers of wild-type and mutant SP-C inhibits both the
trafficking and processing of the wild-type form. A similar series of events
has been observed for other mutant integral membrane proteins suggesting that
this represents a common metabolic pathway for the handling of mutant proteins
(Tobler et al., 1999
). The
heterozygous expression of hSP-C
Exon4 in humans with
interstitial lung disease is associated with a lack of detectable mature SP-C
(Nogee et al., 2001
) that
could be accounted for by this mechanism.
|
It is unlikely that the pathology associated with the
hSP-C
Exon4 is due to a lack of SP-C. SP-C null mice have
been produced (Glasser et al.,
2001
). The resulting phenotype produces viable mice at birth that
grow to adulthood without apparent early structural pulmonary abnormalities.
This is in contrast to a recent study from Weaver's group showing that
lung-specific overexpression of the mature SP-C protein alone (lacking the
propeptide flanking domains) in transgenic mice is neonatal lethal
(Conkright et al., 2002
). Thus,
the consequence of expression of hSP-C
Exon4 cannot be
explained simply by the lack of SP-C (dominant-negative effect) but suggests
that this mutation is associated with a toxic gain of function.
There are several potential mechanisms whereby proSP-C folding mutants
could affect cellular function. Formation of aggregates of misfolded proteins
within specialized cells has been linked to a number of pathological states in
both animal models and in humans (Kopito
and Ron, 2000
; Kopito,
2000
). Perinuclear inclusions composed of aggregated,
ubiquitinated protein and intermediate filament proteins are present in
amyloidosis and in several neurodegenerative diseases including Alzheimer's
disease as well as the peripheral myelin protein 22 (PMP-22)-associated
polyneuropathies (Tobler et al.,
1999
). Similar inclusions have been associated with mutant PMP-22
expression in Schwann cells from the Trembler-J mouse
(Notterpek et al., 1999
). The
exact role of aggresome formation in the pathogenesis of lung disease has not
yet been investigated in paradigms of naturally occurring mutant proSP-C
expression or under conditions of abnormal proSP-C trafficking. Recently, we
used chimeric proteins containing EGFP and rat proSP-C to demonstrate that
intraluminal disulfide-mediated folding of the C-terminus of rat proSP-C is
required for intracellular trafficking of the intact propeptide
(Kabore et al., 2001
).
Deletional mutants lacking cysteine residues at positions 122 and/or 186 of
rat proSP-C were retained in a juxtanuclear compartment that stained for
ubiquitin,
-tubulin and vimentin. Treatment of cells transfected with
these mutants with the proteasome inihibitor lactacysteine enhanced formation
of the juxtanuclear inclusions. Misfolding of unprocessed mutant proteins led
to the formation of stable pool of unprocessed protein.
The present study predominantly concerns the formation of aggresomes in
lung epithelial cells expressing mutant proSP-C proteins. It does not address
the sequellae of the long-term effect of the aggresome on type-2 cell
function. The experimental conditions that fostered the formation of
aggresomes in this study were overexpression that probably imposes a
significant stress on the degradative capacity of the cell. Our experiments
raise the possibility of a homeostatic mechanism in the lung epithelium for
the handling of mutant proteins. We speculate that the transport of
ubiquinated proSP-C mutants to aggresomes functions to clear the cytoplasm of
potentially toxic aggregates or may serve as a staging ground for eventual
removal by incorporation into autophagocytic structures. However, western
blots of lysates (Figs 4,
6) confirm the accumulation of
a single form of mutant EGFP/proSP-C without evidence of smaller degradation
products, which suggests that the half-life of these structures could be long.
Thus, although aggresome formation could provide a cytoprotective role, the
toxicity of the long-term accumulation of non-degraded aggregates is unclear.
Therefore, given the recent in vitro results presented in this report, the
expression of mutant forms of surfactant protein could contribute to lung
pathogenesis through a toxic gain-of-function from either alterations in
type-2 cell viability, function and/or homeostasis induced by protein
aggregation. This concept of cellular toxicity from expression of mutant SP-C
has been suggested by the recent work of Thomas et al., who have described a
kindred of patients with interstitial lung disease extending over five
generations, all expressing another SP-C mutation who developed interstitial
lung diseases in both adults and children
(Thomas et al., 2002
). This
mutation involves a glutamine for leucine substitution at codon 188
(hSP-CL188Q), which is located directly adjacent to
Cys189. When transiently transfected in the MLE-12 lung epithelial
cell line, hSP-CL188Q induced cell necrosis as assessed by release
of LDH into the media, which indicates that SP-C mutants are capable of
inducing cellular toxicity. It is interesting to note that in the present
study, when Cys189 was mutated (EGFP/hSP-CC189G), the mutant fusion
protein was directed to aggresomes (Fig.
6), which suggests a possible mechanism for these findings.
Chemical chaperones provide a potential therapy for conformational lung
diseases by altering the intracellular fate of mutant proteins though
intervention in their biosynthetic processing, degradation, or association
with chaperones. Several agents have shown promise in interrupting
`downstream' pathology in a number of systems
(Sato et al., 1996
;
Rubenstein and Zeitlin, 2000
;
Fischer et al., 2001
).
4-phenylbutyric acid is a short chain fatty acid scavenger that functions as
an ammonia scavenger for the treatment of urea cycle enzyme deficiencies. It
has also been used to induce production of fetal hemoglobin and is being
evaluated for the treatment of sickle cell disease. In cystic fibrosis, 4-PBA
has been shown to promote trafficking of the mutant protein and functional
correction of transport defects. Part of the mechanism for this effect is
related to the regulation of endogenous chaperones by this compound. When A549
cells expressing hSP-C
Exon4 were treated with 4-PBA,
perinuclear aggregation was inhibited and increases in anterograde transport
to cytosolic compartments were seen (Fig.
8). Although Hsc-70 expression was dramatically altered by 4-PBA
in cells expressing the
508 mutant of CFTR, we were unable to find
consistent changes in expression of hsp70 or hsc70 in A549 cells transfected
with hSP-C
Exon4 (M.F.B., unpublished). The modulation of a
different chaperone, changes in microtubule function, or direct effects of
4-PBA on SP-C folding remain mechanistic possibilities that will require
additional studies.
In summary, we have shown that expression of hSP-C
Exon4
is associated with marked alterations in protein trafficking, which can also
affect the targeting of wild-type SP-C in a dominant-negative fashion. In
addition to hSP-C
Exon4 and hSP-CL188Q, Nogee has
reported the presence of ten different SP-C mutations in 34 term infants and
children with chronic lung disease (Nogee
et al., 2002
). In addition, two other mutations in the SP-C gene
have been identified in patients with interstitial lung disease (M.F.B., A.
Hamvas and P. A. Stevens, unpublished). Similar to
hSP-C
Exon4 and hSP-CL188Q, most of these are
clustered in the COOH flanking propeptide. Understanding the trafficking
patterns of these mutants as well as the long term consequences of their
expression through the use of stably transfected cell lines as well as
transgenic models will be critical to the overall characterization of the
pathogenesis of interstitial lung disease associated with mutant isoforms of
SP-C.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Ausbel, F. M., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. and Struhl, K. (1995). Current Protocols in Molecular Biology. New York: John Wiley and Sons.
Beers, M. F. (1998). Molecular Processing and Cellular Metabolism of Surfactant Protein C. In Lung Surfactant: Cellular and Molecular Processing (ed. S. A.Rooney), pp.93 -124. Austin, TX: R.G. Landes,.
Beers, M. F. and Lomax, C. (1995). Synthesis and processing of hydrophobic surfactant protein C by isolated rat type II cells. Am. J. Physiol. 269,L744 -L753.
Beers, M. F., Kim, C. Y., Dodia, C. and Fisher, A. B.
(1994). Localization, synthesis, and processing of surfactant
protein SP-C in rat lung analyzed by epitope-specific antipeptide antibodies.
J. Biol. Chem. 269,20318
-20328.
Beers, M. F., Lomax, C. A. and Russo, S. J.
(1998). Synthetic processing of surfactant protein C by alveolar
epithelial cells. The COOH terminus of proSP-C is required for
post-translational targeting and proteolysis. J. Biol.
Chem. 273,15287
-15293.
Carrell, R. W. and Lomas, D. A. (1997). Conformational disease. Lancet 350,134 -138.[CrossRef][Medline]
Carrell, R. W. and Lomas, D. A. (2002).
Mechanisms of Disease: alpha(1)-antitrypsin deficiency a model for
conformational diseases. New Engl. J. Med.
346, 45-53.
Chai, Y. H., Koppenhafer, S. L., Shoesmith, S. J., Perez, M. K.
and Paulson, H. L. (1999). Evidence for proteasome
involvement in polyglutamine disease: localization to nuclear inclusions in
SCA3/MJD and suppression of polyglutamine aggregation in vitro.
Hum. Mol. Genet. 8,673
-682.
Conkright, J. J., Na, C. L. and Weaver, T. E.
(2002). Overexpression of Surfactant Protein-C Mature Peptide
Causes Neonatal Lethality in Transgenic Mice. Am. J. Resp. Cell
Mol. Biol. 26,85
-90.
Fischer, H., Fukuda, N., Barbry, P., Illek, B., Sartori, C. and
Matthay, M. A. (2001). Partial restoration of defective
chloride conductance in {Delta} F508 CF mice by trimethylamine oxide.
Am. J. Physiol. Lung Cell Mol. Physiol.
281,L52
-L57.
Gelman, M. S., Kannegaard, E. S. and Kopito, R. R.
(2002). A principal role for the proteasome in endoplasmic
reticulum-associated degradation of misfolded intracellular cystic fibrosis
transmembrane conductance regulator. J. Biol. Chem.
277,11709
-11714.
Glasser, S. W., Burhans, M. S., Korfhagen, T. R., Na, C. L.,
Sly, P. D., Ross, G. F., Ikegami, W. and Whitsett, J. A.
(2001). Altered stability of pulmonary surfactant in
SP-C-deficient mice. Proc. Natl. Acad. Sci. USA
98,6366
-6371.
Gustafsson, M., Thyberg, J., Naslund, J., Eliasson, E. and Johansson, J. (1999). Amyloid fibril formation by pulmonary surfactant protein C. FEBS Lett. 464,138 -142.[CrossRef][Medline]
Johansson, J. (2001). Membrane properties and amyloid fibril formation of lung surfactant protein. Biochem. Soc. Trans. 29,601 -606.[CrossRef][Medline]
Johnson, A. L., Braidotti, P., Pietra, G. G., Russo, S. J.,
Kabore, A., Wang, W. J. and Beers, M. F. (2001).
Post-translational processing of surfactant protein-C proprotein
Targeting motifs in the NH2-terminal flanking domain are cleaved in late
compartments. Am. J. Res. Cell Mol. Biol.
24,253
-263.
Johnston, J. A., Ward, C. L. and Kopito, R. R.
(1998). Aggresomes: a cellular response to misfolded proteins.
J. Cell Biol. 143,1883
-1898.
Kabore, A. F., Russo, S. J., Wang, W.-J. and Beers, M. F. (2000) Palmitoylation of proSP-C is not required for its intracellular targeting and proteolytic processing. Am. J. Respir. Crit. Care Med. 161,A41 .
Kabore, A. F., Wang, W. J., Russo, S. J. and Beers, M. F. (2001). Biosynthesis of surfactant protein C: characterization of aggresome formation by EGFP chimeras containing propeptide mutants lacking conserved cysteine residues. J. Cell Sci. 114,293 -302.[Abstract]
Kallberg, Y., Gustafsson, M. Persson, B., Thyberg, J. and
Johansson, J. (2001). Prediction of amyloid fibril-forming
proteins. J. Biol. Chem.
276,12945
-12950.
Keller, A., Eistetter, H. R., Voss, T. and Schafer, K. P. (1991). The pulmonary surfactant protein C (SP-C) precursor is a type II transmembrane protein. Biochem. J. 277,493 -499.
Kopito, R. R. (1997). ER quality control: the cytoplasmic connection. Cell 88,427 -430.[CrossRef][Medline]
Kopito, R. R. (2000). Aggresomes, inclusion bodies and protein aggregation. Trends Cell Biol. 10,524 -530.[CrossRef][Medline]
Kopito, R. R. and Ron, D. (2000). Conformational disease. Nat. Cell Biol. 2,E207 -E209.[CrossRef][Medline]
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227,680 -685.[CrossRef][Medline]
Nogee, L. M. (2002). Abnormal expression of
surfactant protein C and lung disease. Am. J. Resp. Cell Mol.
Biol. 26,641
-644.
Nogee, L. M., Dunbar, A. E., Wert, S. E., Askin, F., Hamvas, A.
and Whitsett, J. A. (2001). A mutation in the surfactant
protein C gene associated with familial interstitial lung disease.
New Engl. J. Med. 344,573
-579.
Nogee, L. M., Dunbar, A. E., III, Wert, S., Askin, F., Hamvas,
A. and Whitsett, J. A. (2002). Mutations in the surfactant
protein C gene associated with interstitial lung disease.
Chest 121,20S
-21S.
Notterpek, L., Ryan, M. C., Tobler, A. R. and Shooter, E. M. (1999). PMP22 accumulation in aggresomes: implications for CMT1A pathology. Neurobiol. Dis. 6, 450-460.[CrossRef][Medline]
Perutz, M. F. (1997). Amyloid fibrils mutations make enzyme polymerize. Nature 385, 773, 775.[Medline]
Prusiner, S. B. and Hsiao, K. K. (1994). Human Prion Diseases. Annals Neurol. 35,385 -395.[CrossRef][Medline]
Rubenstein, R. C. and Zeitlin, P. L. (2000).
Sodium 4-phenylbutyrate downregulates Hsc70: implications for intracellular
trafficking of DeltaF508-CFTR. Am. J. Physiol. Cell
Physiol. 278,C259
-C267.
Rubenstein, R. C., Egan, M. E. and Zeitlin, P. L. (1997). In vitro pharmacologic restoration of CFTR-mediated chloride transport with sodium 4-phenylbutyrate in cystic fibrosis of epithelial cells containing delta F508-CTFR. J. Clin. Invest. 100,2457 -2465.[Medline]
Russo, S. J., Wang, W.-J., Lomax, C. and Beers, M. F. (1999). Structural requirements for intracellular targeting of surfactant protein C. Am. J. Physiol. 277,L1034 -L1044.
Sato, S., Ward, C. L., Krouse, M. E., Wine, J. J. and Kopito, R.
R. (1996). Glycerol Reverses the Misfolding Phenotype of the
Most Common Cystic Fibrosis Mutation. J. Biol. Chem.
271,635
-638.
Solarin, K. O., Wang, W. J. and Beers, M. F. (2001). Synthesis and post-translational processing of surfactant protein C. Pediatr. Pathol. Mol. Med. 20,471 -500.[CrossRef][Medline]
ten Brinke, A., Batenburg, J. J., Gadella, B. M., Haagsman, H.
P., Vaandrager, A. B. and van Golde, L. M. G. (2001). The
juxtamembrane lysine and arginine residues of surfactant protein C precursor
influence palmitoylation via effects on trafficking. Am. J. Resp.
Cell Mol. Biol. 25,156
-163.
Thomas, A. Q., Lane, K., Phillips, J., III, Prince, M., Markin,
C., Speer, M., Schwartz, D. A., Gaddipati, R., Marney, A., Johnson, J.,
Roberts, R., Haines, J., Stahlman, M. and Loyd, J. E. (2002).
Heterozygosity for a Surfactant Protein C Gene mutation associated with usual
interstitial pneumonitis and cellular nonspecific interstitial pneumonitis in
one kindred. Am. J. Respir. Crit. Care Med.
165,1322
-1328.
Tobler, A. R., Notterpek, L., Naef, R., Taylor, V., Suter, U.
and Shooter, E. M. (1999). Transport of Trembler-J mutant
peripheral myelin protein 22 is blocked in the intermediate compartment and
affects the transport of the wild-type protein by direct interaction.
J. Neurosci. 19,2027
-2036.
Vanslyke, J. K., Deschenes, S. M. and Musil, L. S.
(2000). Intracellular transport, assembly, and degradation of
wild-type and disease-linked mutant gap junction proteins. Mol.
Biol. Cell 11,1933
-1946.
Vorbroker, D. K., Dey, C., Weaver, T. E. and Whitsett, J. A. (1992). Surfactant protein C precursor is palmitoylated and associates with subcellular membranes. Biochim. Biophys. Acta 1105,161 -169.[Medline]
Vorbroker, D. K., Voorhout, W. F., Weaver, T. E. and Whitsett, J. A. (1995). Posttranslational processing of surfactant protein C in rat type II cells. Am. J. Physiol. 269,L727 -L733.
Wang, W. J., Russo, S. J., Mulugeta, S. and Beers, M. F.
(2002). Biosynthesis of Surfactant Protein C (SP-C). Sorting of
SP-C proprotein involves homomeric association via a signal anchor domain.
J. Biol. Chem. 277,19929
-19937.
Warr, R. G., Hawgood, S., Buckley, D. I., Crisp, T. M.,
Schilling, J., Benson, B. J., Ballard, P. L., Clements, J. A. and White, R.
T. (1987). Low molecular weight human pulmonary surfactant
protein (SP5): isolation, characterization, and cDNA and amino acid sequences.
Proc. Natl. Acad. Sci. USA
84,7915
-7919.
Weaver, T. E. (1998). Synthesis, processing and secretion of surfactant proteins B and C. Biochim. Biophys. Acta Mol. Basis Dis. 1408,173 -179.[Medline]
Weaver, T. E. and Conkright, J. J. (2001). Functions of surfactant proteins B and C. Annu. Rev. Physiol. 63,555 -578.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
M. Wang, J. P. Bridges, C.-L. Na, Y. Xu, and T. E. Weaver Meckel-Gruber Syndrome Protein MKS3 Is Required for Endoplasmic Reticulum-associated Degradation of Surfactant Protein C J. Biol. Chem., November 27, 2009; 284(48): 33377 - 33383. [Abstract] [Full Text] [PDF] |
||||
![]() |
L Guillot, R Epaud, G Thouvenin, L Jonard, A Mohsni, R Couderc, F Counil, J de Blic, R A Taam, M Le Bourgeois, et al. New surfactant protein C gene mutations associated with diffuse lung disease J. Med. Genet., July 1, 2009; 46(7): 490 - 494. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kotorashvili, S. J. Russo, S. Mulugeta, S. Guttentag, and M. F. Beers Anterograde Transport of Surfactant Protein C Proprotein to Distal Processing Compartments Requires PPDY-mediated Association with Nedd4 Ubiquitin Ligases J. Biol. Chem., June 12, 2009; 284(24): 16667 - 16678. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Korfei, C. Ruppert, P. Mahavadi, I. Henneke, P. Markart, M. Koch, G. Lang, L. Fink, R.-M. Bohle, W. Seeger, et al. Epithelial Endoplasmic Reticulum Stress and Apoptosis in Sporadic Idiopathic Pulmonary Fibrosis Am. J. Respir. Crit. Care Med., October 15, 2008; 178(8): 838 - 846. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. A. Gower, S. E. Wert, and L. M. Nogee Inherited Surfactant Disorders NeoReviews, October 1, 2008; 9(10): e458 - e467. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Dong, J. P. Bridges, K. Apsley, Y. Xu, and T. E. Weaver ERdj4 and ERdj5 Are Required for Endoplasmic Reticulum-associated Protein Degradation of Misfolded Surfactant Protein C Mol. Biol. Cell, June 1, 2008; 19(6): 2620 - 2630. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mulugeta, J. A. Maguire, J. L. Newitt, S. J. Russo, A. Kotorashvili, and M. F. Beers Misfolded BRICHOS SP-C mutant proteins induce apoptosis via caspase-4- and cytochrome c-related mechanisms Am J Physiol Lung Cell Mol Physiol, September 1, 2007; 293(3): L720 - L729. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Johansson, K. Nordling, T. E. Weaver, and J. Johansson The Brichos Domain-containing C-terminal Part of Pro-surfactant Protein C Binds to an Unfolded Poly-Val Transmembrane Segment J. Biol. Chem., July 28, 2006; 281(30): 21032 - 21039. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Bridges, Y. Xu, C.-L. Na, H. R. Wong, and T. E. Weaver Adaptation and increased susceptibility to infection associated with constitutive expression of misfolded SP-C J. Cell Biol., January 30, 2006; 172(3): 395 - 407. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mulugeta, V. Nguyen, S. J. Russo, M. Muniswamy, and M. F. Beers A Surfactant Protein C Precursor Protein BRICHOS Domain Mutation Causes Endoplasmic Reticulum Stress, Proteasome Dysfunction, and Caspase 3 Activation Am. J. Respir. Cell Mol. Biol., June 1, 2005; 32(6): 521 - 530. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Grutters and R. M. du Bois Genetics of fibrosing lung diseases Eur. Respir. J., May 1, 2005; 25(5): 915 - 927. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Brasch, M. Griese, M. Tredano, G. Johnen, M. Ochs, C. Rieger, S. Mulugeta, K.M. Muller, M. Bahuau, and M.F. Beers Interstitial lung disease in a baby with a de novo mutation in the SFTPC gene Eur. Respir. J., July 1, 2004; 24(1): 30 - 39. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hamvas, L. M. Nogee, F. V. White, P. Schuler, B. P. Hackett, C. B. Huddleston, E. N. Mendeloff, F.-F. Hsu, S. E. Wert, L. W. Gonzales, et al. Progressive Lung Disease and Surfactant Dysfunction with a Deletion in Surfactant Protein C Gene Am. J. Respir. Cell Mol. Biol., June 1, 2004; 30(6): 771 - 776. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Noorwez, R. Malhotra, J. H. McDowell, K. A. Smith, M. P. Krebs, and S. Kaushal Retinoids Assist the Cellular Folding of the Autosomal Dominant Retinitis Pigmentosa Opsin Mutant P23H J. Biol. Chem., April 16, 2004; 279(16): 16278 - 16284. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Bridges, S. E. Wert, L. M. Nogee, and T. E. Weaver Expression of a Human Surfactant Protein C Mutation Associated with Interstitial Lung Disease Disrupts Lung Development in Transgenic Mice J. Biol. Chem., December 26, 2003; 278(52): 52739 - 52746. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mulugeta and M. F. Beers Processing of Surfactant Protein C Requires a Type II Transmembrane Topology Directed by Juxtamembrane Positively Charged Residues J. Biol. Chem., November 28, 2003; 278(48): 47979 - 47986. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||