spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 23 December 2002
doi: 10.1242/jcs.00267


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jcs.00267v1
116/4/683    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, W.-J.
Right arrow Articles by Beers, M. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, W.-J.
Right arrow Articles by Beers, M. F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Journal of Cell Science 116, 683-692 (2003)
Copyright © 2003 The Company of Biologists Limited
doi: 10.1242/jcs.00267


Research Article

Deletion of exon 4 from human surfactant protein C results in aggresome formation and generation of a dominant negative

Wen-Jing Wang, Surafel Mulugeta, Scott J. Russo and Michael F. Beers*

Lung Epithelial Cell Biology Laboratories, Pulmonary and Critical Care Division, Department of Medicine, University of Pennsylvania School of Medicine, Philadelphia, PA 19104, USA

* Author for correspondence (e-mail: mfbeers{at}mail.med.upenn.edu)

Accepted 9 November 2002


    Summary
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Human surfactant protein C (hSP-C) is synthesized by the alveolar type 2 cell as a 197 amino acid integral membrane proprotein and proteolytically processed to a secreted 3.7 kDa mature form. Although the SP-C null mouse possesses a non-lethal phenotype, a heterozygous substitution of A for G in the first base of intron 4 of the human SP-C gene (c.460+1A>G) has been reported in association with familial interstitial lung disease and absence of mature protein. This mutation produces a splice deletion of exon 4 ({Delta}Exon4) resulting in removal of a positionally conserved cysteine in the C-terminal flanking propeptide. Based on a prior study showing that an identical deletion in the rat isoform diverted mutant protein to stable aggregates, we hypothesized that expression of the {Delta}Exon4 mutation would result in disruption of intracellular trafficking of both mutant and wild-type proSP-C. We tested this in vitro using fusion proteins of EGFP conjugated either to wild-type SP-C (EGFP/hSP-C1-197) or to SP-C deleted of Exon4 (EGFP/hSP-C{Delta}Exon4). Fluorescence microscopy showed that EGFP/hSP-C1-197 transfected into A549 cells was expressed in a punctuate pattern in CD63 (+) cytoplasmic vesicles, whereas EGFP/hSP-C{Delta}Exon4 accumulated in ubiquitinated perinuclear inclusions linked to the microtubule organizing center. A similar juxtanuclear pattern was observed following transfection of SP-C cDNA lacking only cysteine residues in the C-terminal propeptide encoded by Exon 4 (EGFP/hSP-CC120/121G). To evaluate whether mutant proSP-C could function as a dominant negative, EGFP/hSP-C{Delta}Exon4 was cotransfected with HA-tagged hSP-C1-197 and resulted in the restriction of both forms to perinuclear compartments. Addition of Na+ 4-phenylbutyrate, a facilitator of trafficking of other misfolded proteins, attenuated the aggregation of EGFP/hSP-C{Delta}Exon4. We conclude that c.460+1A>G mutation of human SP-C results in disruption of disulfide-mediated folding encoded by Exon 4 leading to diversion of unprocessed proSP-C to aggresomes. The heterotypic oligomerization of hSP-C1-197 and hSP-C{Delta}Exon4 provides a molecular mechanism for the dominant-negative effect observed in vivo.

Key words: Surfactant Protein C, Interstitial lung disease, Protein trafficking, Aggresome, Conformational disease


    Introduction
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Many inherited diseases are caused by the homozygous expression of mutant protein that induces a loss-of-function through interference with protein trafficking or function. In contrast, the heterozygous expression of some mutations appears to be sufficient to generate pathology (Kopito and Ron, 2000Go). Such diverse disorders as Alzheimer's and Parkinson's diseases (Carrell and Lomas, 1997Go), spinocerebeller ataxia (Chai et al., 1999Go), Charcot-Marie-Tooth disease (Notterpek et al., 1999Go; Vanslyke et al., 2000Go), prion encephalopathies (Prusiner and Hsiao, 1994Go), inflammatory liver disease associated with {alpha}1 antitrypsin deficiency (Carrell and Lomas, 2002Go), systemic amyloidosis (Perutz, 1997Go) and cystic fibrosis (Johnston et al., 1998Go) are part of a growing list of inherited diseases known as `conformational' diseases that arise when a mutant protein undergoes structural rearrangement that endows an ability to aggregate. At the recent international conference `Alpha-1 antitrypsin deficiency and other conformational diseases', the mechanisms by which cells respond to production of abnormal protein conformers and how misfolded proteins cause cytotoxicity were highlighted as important emerging questions (Kopito and Ron, 2000Go).

Surfactant protein C (SP-C) is a 35 amino acid hydrophobic lung-specific protein produced exclusively by alveolar type 2 cells (Weaver and Conkright, 2001Go; Weaver, 1998Go; Solarin et al., 2001Go). The extreme hydrophobicity of the alveolar form (SP-C3.7) is due to a 23 amino acid, polyvaline domain. Modeling of its secondary structure and biophysical analyses of purified SP-C3.7 indicate that in a lipid environment, monomeric SP-C (positions 9-34) exists as a stable valyl-rich helix oriented parallel to lipid acyl chains and able to span phospholipid bilayers. In solution, monomeric SP-C transforms from {alpha}-helix to ß-sheet aggregates reminiscent of amyloid fibril formation. Amyloid SP-C fibrils were isolated from bronchoalveolar lavage of patients with alveolar proteinosis demonstrating a propensity for this motif to undergo conformational changes (Gustafsson et al., 1999Go; Johansson, 2001Go; Kallberg et al., 2001Go).

Human SP-C (hSP-C1-197) is synthesized as a 197 amino acid proprotein and proteolytically processed as an integral membrane protein to the 3.7 kDa mature form that is subsequently transferred to the lumen of lamellar bodies for secretion into the alveolar space with surfactant phospholipids (Beers, 1998Go; Solarin et al., 2001Go). Complete biosynthesis requires four endoproteolytic cleavages of the SP-C propeptide and depends upon oligomeric sorting and targeting to subcellular processing compartments distal to the Golgi (Beers and Lomax, 1995Go; Johnson et al., 2001Go; Vorbroker et al., 1995Go; Wang et al., 2002Go). Studies using both the rat and human isoforms have demonstrated that the mature SP-C domain contained within the propeptide (residues 24-58) functions as a signal-anchor sequence effecting endoplasmic reticulum (ER) translocation, establishing a type II (NH2cytoplasm/COOHlumen) integral membrane orientation, and facilitating homomeric association during sorting (Russo et al., 1999Go; Keller et al., 1991Go; Wang et al., 2002Go). The NH2 flanking propeptide contains a functional targeting motif (E11-T19) for direction to late compartments; deletion or alteration of this region results in ER retention (Johnson et al., 2001Go). Conversely, removal or alteration of one or more cysteine residues from the COOH flanking propeptide results in mutant protein accumulation in a novel juxtanuclear compartment, the aggresome (Beers et al., 1998Go; Kabore et al., 2001Go).

Although the SP-C null mouse is viable (Glasser et al., 2001Go), recent reports in humans have shown heterozygous expression of over ten different mutant proSP-C forms in association with an absence of mature SP-C and interstitial lung disease (Nogee et al., 2001Go; Thomas et al., 2002Go; Nogee et al., 2002Go). The first SP-C mutation associated with interstitial lung disease was described in a term infant and mother both heterozygous for a G to A base substitution in the first codon of Intron 4 (Nogee et al., 2001Go). This mutation leads to abnormal splicing and a skip of Exon 4 (`hSP-C{Delta}Exon4') producing a foreshortened proSP-C lacking a conserved cysteine residue in the flanking COOH propeptide. Since cysteines in human proSP-C deleted by this mutation are positionally identical to a cysteine residue in the COOH flanking propeptide of the rat isoform that is essential for normal trafficking (Russo et al., 1999Go), we hypothesized that expression of the hSP-C{Delta}Exon4 isoform would result in disruption of COOH propeptide folding manifested in vitro by abnormal intracellular trafficking of mutant proSP-C, aggresome formation, and disruption of biosynthesis of the wild-type SP-C through creation of a dominant-negative effect.

To test this hypothesis, we expressed fusion proteins of EGFP and human proSP-C mutants lacking conserved cysteine residues, including the hSP-C{Delta}Exon4 mutation, and evaluated targeting and processing of expressed proteins in a transfected alveolar epithelial cell line. We report the first demonstration that expression of a clinically defined SP-C mutation results in accumulation of unprocessed, aberrant protein forms in a juxtanuclear compartment associated with components of the microtubule organizing center (MTOC). In addition, co-expression of the hSP-C{Delta}Exon4 variant with hSP-C1-197 is shown to also disrupt trafficking of the wild-type isoform. Finally, the oral butyrate analog, sodium 4-phenylbutyrate (4-PBA), which has been shown to promote trafficking of other mutant proteins such as CFTR, corrected mutant proSP-C juxtanuclear protein accumulation in vitro.


    Materials and Methods
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PEGFP-C1 plasmid was purchased form Clontech (Palo Alto, CA). The pcDNA3 eukaryotic expression plasmid was obtained from Invitrogen (San Diego, CA). Polyclonal anti-green fluorescent protein antisera were purchased from Molecular Probes (Eugene, OR). Texas Red-conjugated monoclonal and polyclonal secondary antibodies were obtained from Jackson Immunoresearch Laboratories (West Grove, PA). Anti-CD63 was purchased from Immunotech, (Marseille Cedex, France). Anti-ubiquitin monoclonal antibody was purchased from Chemicon (Temecula, CA). Monoclonal anti-HA (clone 12CA5 recognizing a peptide epitope from the hemagglutinin protein of human influenza virus) was obtained from Roche Molecular Biochemicals (Indianapolis, IN). Sodium 4-phenylbutyrate (4-PBA; Buphenyl®), manufactured by Triple Crown America (Perkasie, PA), was the generous gift of Ronald Rubenstein (Children's Hospital, Philadelphia, PA). Except where noted, other reagents were of electrophoretic grade and were purchased from Bio-Rad (Melville, NY) or Sigma (St Louis, MO).

ProSP-C antiserum
A monospecific polyclonal rat proSP-C antiserum was produced from a synthetic peptide antigen and has been previously characterized (Beers et al., 1994Go). Anti-NPROSP-C (Met10 to Glu23) recognizes proSP-C21 and all major intermediates but does not recognize mature SP-C.

SP-C and EGFP/SP-C expression constructs
pcDNA3-hSP-C (6+)
A full-length human SP-C cDNA insert of 875 bp corresponding to the published sequence of Warr et al. (Warr et al., 1987Go) was the generous gift of Philip Ballard. This insert was subcloned into the pcDNA3 eukaryotic expression vector polylinker at the EcoRI site as previously described for rat SP-C (Beers et al., 1998Go).

EGFP/hSP-C
A family of chimeric fusion proteins consisting of EGFP and wild-type human SP-C (Met1 to Ile197) or SP-C cDNA either lacking Exon 4 or containing point mutations in cysteine residues in the COOH flanking propeptide were generated by polymerase chain reaction (PCR) (Fig. 1).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1. Constructs used for analysis of human proSP-C trafficking. SP-C inserts containing wild-type or mutant human SP-C were generated by PCR and subcloned into either the EGFPC1 or pcDNA3 vectors as described in Materials and Methods. From top to bottom: hSP-C1-197 construct inserted into pcDNA3 containing full-length human SP-C shown with putative intrachain disulfide bonding between cys189 and cys120/121; EGFP/SP-C1-197 created by ligation of PCR generated hSP-C1-197 insert into the pEGFPC1 vector; EGFP/hSP-C{Delta}Exon4 is a deletional construct produced by removal of amino acids 110-144 encoded by Exon 4, which includes cys121/122; EGFP/hSP-CC120/121G is a double cysteine folding mutant containing Gly for Cys substitutions at residues 120 and 121 in the COOH flanking propeptide; EGFP/hSP-CC120/121/189G contains substitutions of Gly for Cys at codons 120, 121 and 189; HA/hSP-C1-197 is a full-length human SP-C cDNA containing the HA sequence peptide linked to the N-terminus and subcloned into pcDNA3. Amino acid nomenclature is based on published human SP-C sequence.

 

For EGFP/hSP-C1-197, pcDNA3-hSP-C (6+) served as template for a two primer single PCR reaction. The primers used were: (forward) 5'-dTACAAGTCCGGAATGGATGTGGGCAGCAAAGAGGTCCTG; (reverse) 3'-dTCTAGATGCATGCTCGAGCG. Amplification reactions containing 0.2 µM primers, 1.25 µM dNTP mixture, 1.5 µM MgCl2, 10 ng template, and 2.5 U VentR DNA polymerase (New England Biolabs, Beverly, MA) consisted of 30 cycles under previously published conditions (Johnson et al., 2001Go). An in-frame fusion protein was made through introduction of a BspEI site at the 5' end and an XhoI site at the 3' end for cloning into pEGFP-C1.

For mutant EGFP/hSP-CC189G, a two primer single reaction PCR technique was also used with pcDNA3-hSP-C (6+) serving as template. The primers used were: (forward) 5'-dTCCGGAC-TCAGATCTATGGATGTGGGCAGCAAAGAGGTCCTG; (reverse) 3'-dTCCGGTGGATCCCTAGATGTAGTAGAGCGGCACCTCGCC-ACCCAGGGTGTTCAC. Amplification produced a purified PCR insert containing the desired point mutation at codon 189 and lacking the 3' untranslated region which was ligated into pEGFP-C1 following digestion with BamHI and BglII.

For construction of EGFP/hSP-CC121/122G, mutagenesis was performed by overlap extension PCR with a two round, four-primer technique as previously published (Russo et al., 1999Go). The primers are listed in Table 1. Purified intermediate segments (SP-C1-125X and SP-C117-197) generated in separate PCR reactions using pcDNA3-hSP-C (6+) as the template with primers A and B or primers C and D were fused with a second round of PCR using primers complementary to the 5' -and 3' -ends (primers A and D, respectively). The resulting mutant insert, hSP-CC121/122G containing the 3' untranslated region was purified and ligated into pEGFP-C1 after digestion with BglII and BamHI.


View this table:
[in this window]
[in a new window]
 
Table 1. Primer sets used in PCR reactions for generation of SP-CC120/121G insert construct

 

For creation of EGFP/hSP-C{Delta}Exon4, deletion of exon 4 from pcDNA-hSP-C (6+) was also achieved by overlap extension PCR with a two round, four-primer technique. Exons 1-3 were amplified by single PCR using 2 primers: (forward) dTACAAGTCCGGAATGGATGTGGGCAGCAAAGAGGTCCTG; (reverse) dCTGCTGGTAGTCATACACCACGAGGCC. The other primary reaction amplified exon 5 through the 3' untranslated Poly A tail using a forward primer containing complete overlap with the 3' end of the reverse primer used to amplify Exon 3 (bold): (forward) dGGCCTCGTGGTGTATGACTACCAGCAGATGGAATGCTCT CTGCAGGCCAAGCCC; (reverse): dTCTAGATGCATGCTCGAGCG. The two overlapping primary products were fused by SOEing PCR using (forward) dTACAAGTCCGGAATGGATGTGGGCAGCAAAGAGGTCCTG and (reverse) dTCTAGATGCATGCTCGAGCG. Following digestion with BspEI and XhoI, the {Delta}Exon4 insert was subcloned into pEGFPC1.

A triple mutant lacking all three cysteines in the COOH domain (EGFP/SP-CC120/122/189G) was created by a single PCR performed using EGFP/hSP-CC121/122G as template with a primer set identical to that used to generate EGFP/hSP-CC189G.

Hemagglutinin-A-tagged wild-type proSP-C
By using pcDNA-hSP-C1-197 as a template, the hemagglutinin (HA) tag (YPYDVPDYA) was added to the N-terminus of hSP-C1-197 by PCR. The 5' (forward) primer was an 84mer and contained a KpnI site (bold), a Kozak sequence, and the HA-coding sequence (underlined): TCCGGACTCGGTACCATGGATTACCCATACGATGTTCCAGATTACGCTGCTGATGTGGGCAGCAAAGAGGTCCTGATGGAGAGC. The 3' (reverse) primer was a 36mer that contained a BamHI site (bold): CTATAGGGATCCGCCCTCTAGATGCATCCTCGACCC. The purified insert was subcloned back into the pcDNA3 vector using digestion with KpnI and BamHI.

All other procedures involving oligonucleotide and cDNA manipulations were performed essentially as described (Ausbel et al., 1995Go). Automated DNA sequencing in both directions failed to detect nucleotide mutations in wild-type or mutant SP-C constructs.

A549 cell line and transfection
The lung epithelial cell line A549 used in transfection studies was originally obtained through the American Type Culture Collection (Manasas, VA) and has been used in prior studies (Beers et al., 1998Go; Russo et al., 1999Go; Kabore et al., 2001Go). A549 cells grown to 50% confluence on glass coverslips were transiently transfected with EGFP/SP-C constructs (10 µg/dish) or co-transfected with two different constructs (5 µg/construct/dish) by CaPO4 precipitation as previously described (Russo et al., 1999Go). Where indicated, 4-PBA was added at the time of transfection and continued until harvest.

Immunohistochemistry
For double label studies, immunostaining of permeabilized cells fixed by immersion of coverslips in 4% paraformaldehyde was performed by incubation with primary antisera for 1 hour at room temperature followed by either secondary goat anti-mouse IgG monoclonal or secondary goat anti-rabbit IgG polyclonal antisera (Kabore et al., 2000Go; Russo et al., 1999Go). Fluorescence images of air-dried and Mowiol mounted slides were viewed on an Olympus I-70 inverted fluorescence microscope with filter packages High Q fluorescein isothiocyanate for EGFP (excitation at 480 nm, emission at 535/550 nm), and High Q TR for Texas Red (excitation at 560/555 nm, emission at 645/675 nm) obtained from Chroma Technology (Brattleboro, VT). Image acquisition, processing, and overlay analysis were performed using IMAGE1 software (Universal Imaging, West Chester, PA).

Polyacrylamide gel electrophoresis and immunoblotting
Cell pellets collected by scraping and centrifugation at 300 g were solubilized with 40 µl of solubilization buffer (50 mM Tris, 190 mM NaCl, 6 mM EDTA, 2% Triton X-100, 1 mM PMSF, pH 7.4). Following centrifugation at 8000 g for 30 seconds to remove nuclei, proteins were separated by electrophoresis on a 12% polyacrylamide gel and transferred to nitrocellulose (Laemmli, 1970Go).

Immunoblotting of transferred samples was done using successive incubations with primary polyclonal GFP antisera (1:5000) for 1 hour and goat anti-rabbit horseradish peroxidase-conjugated secondary antibody (1:10,000) for 1 hour at room temperature. Bands were visualized by enhanced chemiluminescence using a commercially available kit (Amersham, Arlington Heights, IL).


    Results
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
EGFP/hSP-C1-197 is targeted to cytosolic vesicles of A549 cells
We have previously utilized the human alveolar epithelial cell line, A549, to characterize functional domains that mediate trafficking of the rat SP-C proprotein (Beers et al., 1998Go; Russo et al., 1999Go; Wang et al., 2002Go; Kabore et al., 2000Go). In the current study, expression of the EGFP/hSP-C1-197 fusion protein was readily detected in transiently transfected A549 cells within 24-48 hours after introduction by CaPO4 precipitation. Similar to that observed with rat proSP-C, EGFP/hSP-C1-197 was expressed in cytoplasmic vesicles of A549 cells (Fig. 2). This pattern was similar to that seen with A549 cells transfected with wild-type human proSP-C lacking the EGFP tag identified by immunostaining with anti-proSP-C antiserum (Fig. 2B) or with an HA-tagged wild-type proSP-C (Fig. 2C). These results indicate that the presence of EGFP does not interfere with trafficking patterns for human SP-C1-197, which contains motifs for ER translocation and direction of heterologous fusion proteins to vesicular compartments.



View larger version (77K):
[in this window]
[in a new window]
 
Fig. 2. Expression of EGFP/hSP-C, pcDNA3/hSP-C and HA/hSP-C in transfected A549 cells. Plasmids containing cDNA for EGFP/hSP-C (A), pcDNA3/hSP-C (B), and HA/hSP-C (C) were introduced into A549 cells by CaPO4 precipitation. 48 hours after transfection, cells were fixed and/or stained with polyclonal {alpha}-NPROSP-C and Texas-Red-conjugated goat anti-rabbit serum or monoclonal anti-HA plus Texas-Red-conjugated goat anti-mouse IgG. The fluorescence images were acquired using High Q FITC filter package for EGFP/hSP-C (A) or a High Q Texas Red filter package for NPROSP-C (B) and HA staining (C). Corresponding phase images appear below each fluorescence panel.

 

The vesicular compartment targeted by wild-type proSP-C was identified using double-label fluorescence microscopy. Transfected EGFP/hSP-C1-197 expression was spatially restricted to CD-63-positive compartments, a marker antigen associated with lamellar bodies and to multivesicular bodies of type 2 cells (Fig. 3). Furthermore, this compartment was Calnexin-negative, EEA1-negative, and failed to stain for ubiquitin (data not shown). Collectively, these data indicate that, in this model, proSP-C is directed to a lysosomal like organelle that shares antigen markers with lamellar bodies of type 2 cells.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 3. EGFP/hSP-C1-197 chimeric protein is directed to CD63 positive cytoplasmic vesicles. A549 cells grown on glass coverslips at 50-60% confluence were transfected with 10 µg of EGFP-C1/SP-C1-197 using CaPO4 as described in Materials and Methods. At 48 hours after transfection, cells were fixed, permeabilized and stained with primary monoclonal CD-63 antiserum and IgG-specific secondary Texas-Red-labeled antisera. Images were acquired by video fluorescence microscopy as in Fig. 2 and are representative of six separate experiments and >50 cells for each construct. The majority of EGFP/hSP-C1-197 (A) was associated with CD-63 staining (B). Phase image is shown in C.

 

Altered distribution of EGFP/hSP-C{Delta}Exon4 expressed in lung epithelial cells
In contrast to wild-type human SP-C, EGFP fusion proteins containing the SP-C{Delta}Exon4 mutant were expressed in a time frame similar to that of wild-type proSP-C but were retained in proximal, juxtanuclear compartments (Fig. 4C).



View larger version (64K):
[in this window]
[in a new window]
 
Fig. 4. Unprocessed EGFP/hSP-C{Delta}Exon4 accumulates in juxtanuclear inclusions. (A-D) Immunofluorescence of A549 cells grown on coverslips were transfected with either EGFP/hSP-C1-197 (A) or EGFP/hSP-C{Delta}Exon4 (C). Forty-eight hours after introduction of plasmid DNA, cells were fixed and fluorescence images acquired. Corresponding phase images are presented in panels B and D; (E) Western blotting for detection of EGFP proteins. Nuclear-free lysates were prepared as detailed in Materials and Methods using cell pellets from dishes transfected identically to those in panels A-D. Fifty percent of each lysate was subjected to 12% SDS-PAGE. Separated proteins were transferred to nitrocellulose and immunoblotted with primary rabbit polyclonal anti-GFP. Bands were visualized using enhanced chemiluminescence. EGFPC1 was expressed as a major product with Mr 27,000 (lane 1). Analysis of EGFP/hSP-C1-197 fusion protein expression (lane 2) demonstrated two doublets bands with relative molecular weight (Mr) of 48-50,000 and 33-38,000, consistent with a primary translation product/palmitoylated form and two processing intermediates. In contrast, EGFP/hSP-C{Delta}Exon4 was expressed as a single smaller band (hatched arrow, lane 3).

 

Western blotting of A549 cell lysates using an anti-EGFP antisera demonstrated that the mutant proSP-C protein forms expressed by EGFP/hSP-C{Delta}Exon4 represented steady-state accumulation of an unprocessed, non-degraded fusion protein (Fig. 4E). The anti-EGFP antisera detected a major product of 27 kDa for cells transfected with EGFP alone. When wild-type EGFP/hSP-C1-197 was introduced, lysates contained two sets of anti-EGFP-positive bands. A doublet corresponding to the primary translation product of the fusion protein (Mr 48,000) and an accompanying higher molecular weight form (Mr 50,000) consistent with the known palmitoylated isoform is seen. A second set of two smaller intermediates was also identified; however, a band at 27 kDa (consistent with liberation of free EGFP) was not found. This profile is consistent with the notion that human SP-C-EGFP was palmitoylated and partially processed in this cell model by proteolysis of the C-terminus but without proteolytic modification of the NH2 propeptide. In contrast to wild-type proSP-C, expression of the hSP-C{Delta}Exon4 mutant resulted in formation of a single product representing a truncated primary translation product expressed without further modification. Together, the immunocytochemistry and western blotting data demonstrate that hSP-C{Delta}Exon4 accumulates in perinuclear inclusions without processing or degradation.

Human SP-C{Delta}Exon4 is directed to aggresomes
Since the recognition of abnormal and misfolded proteins is mediated by ubiquitin that promotes delivery of substrates to the 28S proteasome, we performed immunocytochemical staining of transfected A549 cells to further characterize the compartment. In contrast to wild-type SP-C, aggregates formed following transfection with EGFP/hSP-C{Delta}Exon4 were ubiquitinated (Fig. 5A-C). Furthermore, this compartment was CD63 and calnexin-negative (not shown) but in close approximation to tubulin-containing filaments, which suggested localization near the microtubule-organizing center (MTOC) (Fig. 5D-F). Taken together, the data suggest that the expression of the hSP-C{Delta}Exon4 mutant results in accumulation of mutant forms in a compartment compatible with aggresomes.



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 5. Ubiquitinated EGFP/hSP-C{Delta}Exon4 is associated with the MOTC. A549 cells grown on coverslips were transfected with EGFP/hSP-C{Delta}Exon4 using CaPO4. Forty-eight hours after introduction of plasmid DNA, cells were fixed and staining was performed using monoclonal antiserum against either ubiquitin (A-C) or {alpha}-tubulin (1:100) (D-F) and visualized with secondary goat antimouse-IgG—Texas-Red. Two channel fluorescence images were acquired for EGFP (A,D) and Texas Red (B,E).

 

Alteration of EGFP/hSP-C expression is promoted by disruption of disulfide-mediated folding
To examine the mechanism underlying the accumulation of hSP-C{Delta}Exon4 in aggresome structures, we performed site-directed mutagenesis to effect conservative substitution of Cys120 and Cys121 encoded within the fourth exon of human SP-C. When coupled to EGFP, subcellular expression patterns for the fusion protein were similar to those seen with removal of the entire fourth exon (Fig. 6C). As for EGFP/hSP-C{Delta}Exon4, aggregate formation was accompanied by colocalization with ubiquitin and {alpha}-tubulin (data not shown). Western blotting demonstrated that all cysteine mutant SP-C isoforms were expressed as single bands, which indicates that, as for SP-C{Delta}Exon4, COOH propeptide mutations result in stable formation of unprocessed forms.



View larger version (56K):
[in this window]
[in a new window]
 
Fig. 6. Mutation of Cys120/Cys121 in the COOH flanking propeptide mimics EGFP/hSP-C{Delta}Exon4 expression. A549 cells were transiently transfected with EGFP/hSP-C1-197 (A,B) or the COOH cysteine mutant EGFP/hSP-CC120/121G (C,D) using CaPO4. Images for EGFP expression were acquired 48 hours after transfection by using fluorescence microscopy with a FITC filter package. As for {Delta}Exon4, the cysteine mutant was restricted to a juxtanuclear region showing aggregation. (E) Western blotting for detection of EGFP proteins. Nuclear-free lysates were prepared from cell pellets obtained from dishes identically transfected with EGFP/hSP-CC120/121G, EGFP/hSP-CC120/121/189G, EGFP/hSP-CC189G, EGFP/hSP-C1-197, or EGFP/hSP-C{Delta}Exon4 as detailed in Materials and Methods. Immunoblotting was performed with primary rabbit polyclonal anti-GFP and bands visualized using enhanced chemiluminescence. EGFPC1 was expressed as a major product with Mr 27,000 (not shown). Analysis of EGFP/hSP-C1-197 fusion protein expression (lane 5) demonstrated a primary translation bands with relative molecular weight (Mr) of 50-48,000 and processed forms of 37-33,000. EGFP/hSP-CC120/121G (lane 3), EGFP/hSP-CC120/121/189G (lane 4), and EGFP/hSP-CC189G (lane 1) were each expressed as a single band with Mr 48,000. Mock transfected cells (lane 2) yield no immunoreactive bands.

 

Human SP-C{Delta}Exon4 acts a dominant negative
Previously published in vitro evidence indicated that trafficking of SP-C occurred via formation of oligomeric complexes (Wang et al., 2002Go). Because cases of interstitial lung disease associated with heterozygous expression of the hSP-C{Delta}Exon4 mutation also manifested a lack of detectable mature SP-C (Nogee et al., 2001Go), we hypothesized that the mutant protein could act to produce a dominant-negative effect by trapping wild-type protein in proximal compartments. To study this interaction, cotransfection studies were performed using EGFP/hSP-C{Delta}Exon4 and an HA-tagged wild-type human SP-C expressed in the pcDNA3 vector (Fig. 7). Cotransfection of both tagged wild-type forms (EGFP/SP-C1-197 and HA/SP-C1-197) resulted in co-expression of each fusion protein in the same cytosolic vesicles (Fig. 7A-C). In contrast, the co-expression of EGFP/hSP-C{Delta}Exon4 and HA/SP-C1-197 was now associated with restriction of both forms to perinuclear compartments (Fig. 7D-F). These results are consistent with the notion that heteromeric sorting of hSP-C{Delta}Exon4 mutants and wild-type SP-C can produce a functional dominant negative to inhibit the trafficking of wild-type protein.



View larger version (92K):
[in this window]
[in a new window]
 
Fig. 7. hSP-C{Delta}Exon4 alters trafficking of wild-type proSP-C. A549 cells were co-transfected with 5 µg of HA/hSP-C1-197 plasmid plus 5 µg of either EGFP/hSP-C1-197 (A-C) or EGFP/hSP-C{Delta}Exon4 (D-F) plasmids using CaPO4. Cotransfected cells fixed 48 hours after transfection, permeabilized and stained with anti-HA using Texas-Red-conjugated secondary antibody were subjected to fluorescence microscopy for EGFP (A,D) and {alpha}-HA (Texas Red) staining (B,E). EGFP- and HA-tagged hSP-C1-197 colocalize in the same cytoplasmic vesicles. In contrast, EGFP/hSP-C{Delta}Exon4 induced aggregation of HA/hSP-C1-197 in perinuclear compartments.

 

Treatment with chemical chaperones alters intracellular distribution of EGFP/hSP-C{Delta}Exon4
4-Phenylbutyric acid has been shown to facilitate the trafficking of mutant {Delta}508CFTR both in vitro and in vivo (Rubenstein et al., 1997Go; Rubenstein and Zeitlin, 2000Go). To investigate whether 4-PBA could alter aggregation of mutant SP-C, A549 cells transfected with EGFP/hSP-C{Delta}Exon4 were treated with increasing concentrations of 4-PBA for 48 hours. In contrast to cells treated with saline alone, A549 cells expressing mutant EGFP/hSP-C{Delta}Exon4 showed redirection of mutant fusion protein to cytosolic vesicles (Fig. 8). The in vitro pharmacological correction of juxtanuclear accumulation of mutant SP-C in A549 epithelial cells occurred at a range of doses from 1 to 5 mM. Doses greater than 5 mM were associated with cellular toxicity.



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 8. 4-Phenylbutyric acid blocks accumulation of EGFP/hSP-C{Delta}Exon4 in aggresomes. A549 cells grown on coverslips were transfected with 5 µg EGFP/hSP-C{Delta}Exon4 using CaPO4. At the time of transfection, cells were treated with either 0, 1 mM, or 5 mM Na 4-phenylbutyrate as indicated. Forty-eight hours after introduction of plasmid DNA, cells were fixed and fluorescence images for EGFP expression were acquired.

 


    Discussion
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The correct folding and deployment of biologically active proteins throughout the cell is an important step in gene expression (Kopito and Ron, 2000Go). Encoded proteins destined for delivery to the cell surface and for secretion are translocated into the endoplasmic reticulum (ER) during biosynthesis. Anterograde trafficking is tightly linked with the acquisition of biological function, and misfolded, potentially defective proteins are selectively tagged for degradation either in the ER or in proteasomes by a multi-step pathway (Kopito, 1997Go; Kopito and Ron, 2000Go; Gelman et al., 2002Go). While protein folding and quality control systems have been attributed to the molecular pathogenesis associated with several rare respiratory diseases, including cystic fibrosis and {alpha}1-antitrypsin deficiency (Carrell and Lomas, 2002Go; Carrell and Lomas, 1997Go), the recent association of mutant forms of surfactant protein C with familial forms of interstitial lung disease has raised the possibility that a similar pathophysiological mechanism is resulting from expression of these mutant forms of SP-C (Nogee, 2002Go). Previously we had shown that mutations in the COOH flanking propeptide encoded by the rat SP-C cDNA that promote misfolding result in the formation of protein aggregates and inhibition of wild-type protein trafficking in vitro (Kabore et al., 2001Go). The present report extends these observations by examining trafficking of a human SP-C mutation, hSP-C{Delta}Exon4, recently identified in a mother and daughter each heterozygous for the mutation and both with a biopsy diagnosis of interstitial lung disease (Nogee et al., 2001Go). We show that the expression of the hSP-C{Delta}Exon4 mutation results in juxtanculear accumulation of unprocessed mutant protein forms that produce a dominant-negative effect on the trafficking of co-expressed wild-type proSP-C. Importantly, as has been observed with CFTR, treatment with sodium 4-phenylbutyrate (4-PBA), which is implicated in the regulation of endogenous chaperones, is shown to attenuate the altered expression pattern.

The expression of mutant hSP-C{Delta}Exon4 is characterized by disruption of trafficking in the earliest compartments. Previously, ten Brinke et al., has demonstrated that a mutation in the N-terminal portion of human SP-C (hSP-CK34R35) resulted in blockade of egress of proSP-C from the ER and inhibited its palmitoylation, a Golgi-mediated event (ten Brinke et al., 2001Go). On SDS/PAGE analysis, we found that the EGFP fusion protein containing wild-type SP-C produces a high molecular weight doublet (Fig. 6E) that has been show to correlate with generation of a primary translation product and a higher molecular weight dipalmitoylated form (Vorbroker et al., 1992Go). A single band was observed when mutant SP-C forms containing deletions or mutations of COOH cysteine residues (hSP-C{Delta}Exon4, hSP-CC120/121G and hSP-CC189G) were expressed. The lack of a doublet is consistent with inhibition of delivery of these isoforms to the Golgi. However, unlike the persistent ER retention noted by ten Brinke et al., for the non-palmitoylated hSP-CK34R35 mutant, the fluorescence microscopy for EGFP/hSP-C{Delta}Exon4 protein instead demonstrates accumulation in a cytosolic compartment. Coupled with immunocytochemistry showing the presence of ubiquitination (a cytosolic event) and colocalization with {alpha}-tubulin, trafficking of the hSP-C{Delta}Exon4 mutant is consistent with ER translocation, misfolding, retrotranslocation, ubiquitination and clustering near the MTOC, prerequisites for the formation of a novel cellular structure termed the aggresome (Johnston et al., 1998Go; Kopito and Ron, 2000Go; Kopito, 2000Go).

A further consequence of mutant protein expression is an inhibition of cellular trafficking of wild-type SP-C. Recently, we have shown using crosslinking of transfected A549 cell lysates with bis-malemeidohexane that multimeric forms of wild-type rat SP-C fusion proteins (EGFP/SP-C1-194) are generated indicating that SP-C biosynthesis involves oligomeric association of proSP-C monomers (Wang et al., 2002Go). Thus, the results presented here are consistent with a dominant-negative effect induced by heteromeric sorting of wild-type and mutant protein to the same compartment. A schematic of the molecular modeling for the heteromeric interaction of wild-type and mutant SP-C is shown in Fig. 9. In this model, the early aggregation of heteromers of wild-type and mutant SP-C inhibits both the trafficking and processing of the wild-type form. A similar series of events has been observed for other mutant integral membrane proteins suggesting that this represents a common metabolic pathway for the handling of mutant proteins (Tobler et al., 1999Go). The heterozygous expression of hSP-C{Delta}Exon4 in humans with interstitial lung disease is associated with a lack of detectable mature SP-C (Nogee et al., 2001Go) that could be accounted for by this mechanism.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 9. Model of heterozygous expression of mutant SP-C. Schematic presentation of possible fates of synthesized proSP-C. (A) Expression of wild-type SP-C (hSP-C1-197) results in homomeric association, sorting and direction to CD63-positive vesicles (lamellar bodies). (B) In contrast, COOH folding mutants such as Exon 4 are retrotranslocated from the ER and directed preferentially to degradative pathways. Aggresomes form if protein expression exceeds degradation. (C) In heterozygous expression in vivo or co-transfection in vitro, via heteromeric association and retrotranslocation prior to sorting in the Golgi, folding mutants interact with wild-type SP-C to alter trafficking producing dominant negatives.

 

It is unlikely that the pathology associated with the hSP-C{Delta}Exon4 is due to a lack of SP-C. SP-C null mice have been produced (Glasser et al., 2001Go). The resulting phenotype produces viable mice at birth that grow to adulthood without apparent early structural pulmonary abnormalities. This is in contrast to a recent study from Weaver's group showing that lung-specific overexpression of the mature SP-C protein alone (lacking the propeptide flanking domains) in transgenic mice is neonatal lethal (Conkright et al., 2002Go). Thus, the consequence of expression of hSP-C{Delta}Exon4 cannot be explained simply by the lack of SP-C (dominant-negative effect) but suggests that this mutation is associated with a toxic gain of function.

There are several potential mechanisms whereby proSP-C folding mutants could affect cellular function. Formation of aggregates of misfolded proteins within specialized cells has been linked to a number of pathological states in both animal models and in humans (Kopito and Ron, 2000Go; Kopito, 2000Go). Perinuclear inclusions composed of aggregated, ubiquitinated protein and intermediate filament proteins are present in amyloidosis and in several neurodegenerative diseases including Alzheimer's disease as well as the peripheral myelin protein 22 (PMP-22)-associated polyneuropathies (Tobler et al., 1999Go). Similar inclusions have been associated with mutant PMP-22 expression in Schwann cells from the Trembler-J mouse (Notterpek et al., 1999Go). The exact role of aggresome formation in the pathogenesis of lung disease has not yet been investigated in paradigms of naturally occurring mutant proSP-C expression or under conditions of abnormal proSP-C trafficking. Recently, we used chimeric proteins containing EGFP and rat proSP-C to demonstrate that intraluminal disulfide-mediated folding of the C-terminus of rat proSP-C is required for intracellular trafficking of the intact propeptide (Kabore et al., 2001Go). Deletional mutants lacking cysteine residues at positions 122 and/or 186 of rat proSP-C were retained in a juxtanuclear compartment that stained for ubiquitin, {alpha}-tubulin and vimentin. Treatment of cells transfected with these mutants with the proteasome inihibitor lactacysteine enhanced formation of the juxtanuclear inclusions. Misfolding of unprocessed mutant proteins led to the formation of stable pool of unprocessed protein.

The present study predominantly concerns the formation of aggresomes in lung epithelial cells expressing mutant proSP-C proteins. It does not address the sequellae of the long-term effect of the aggresome on type-2 cell function. The experimental conditions that fostered the formation of aggresomes in this study were overexpression that probably imposes a significant stress on the degradative capacity of the cell. Our experiments raise the possibility of a homeostatic mechanism in the lung epithelium for the handling of mutant proteins. We speculate that the transport of ubiquinated proSP-C mutants to aggresomes functions to clear the cytoplasm of potentially toxic aggregates or may serve as a staging ground for eventual removal by incorporation into autophagocytic structures. However, western blots of lysates (Figs 4, 6) confirm the accumulation of a single form of mutant EGFP/proSP-C without evidence of smaller degradation products, which suggests that the half-life of these structures could be long. Thus, although aggresome formation could provide a cytoprotective role, the toxicity of the long-term accumulation of non-degraded aggregates is unclear. Therefore, given the recent in vitro results presented in this report, the expression of mutant forms of surfactant protein could contribute to lung pathogenesis through a toxic gain-of-function from either alterations in type-2 cell viability, function and/or homeostasis induced by protein aggregation. This concept of cellular toxicity from expression of mutant SP-C has been suggested by the recent work of Thomas et al., who have described a kindred of patients with interstitial lung disease extending over five generations, all expressing another SP-C mutation who developed interstitial lung diseases in both adults and children (Thomas et al., 2002Go). This mutation involves a glutamine for leucine substitution at codon 188 (hSP-CL188Q), which is located directly adjacent to Cys189. When transiently transfected in the MLE-12 lung epithelial cell line, hSP-CL188Q induced cell necrosis as assessed by release of LDH into the media, which indicates that SP-C mutants are capable of inducing cellular toxicity. It is interesting to note that in the present study, when Cys189 was mutated (EGFP/hSP-CC189G), the mutant fusion protein was directed to aggresomes (Fig. 6), which suggests a possible mechanism for these findings.

Chemical chaperones provide a potential therapy for conformational lung diseases by altering the intracellular fate of mutant proteins though intervention in their biosynthetic processing, degradation, or association with chaperones. Several agents have shown promise in interrupting `downstream' pathology in a number of systems (Sato et al., 1996Go; Rubenstein and Zeitlin, 2000Go; Fischer et al., 2001Go). 4-phenylbutyric acid is a short chain fatty acid scavenger that functions as an ammonia scavenger for the treatment of urea cycle enzyme deficiencies. It has also been used to induce production of fetal hemoglobin and is being evaluated for the treatment of sickle cell disease. In cystic fibrosis, 4-PBA has been shown to promote trafficking of the mutant protein and functional correction of transport defects. Part of the mechanism for this effect is related to the regulation of endogenous chaperones by this compound. When A549 cells expressing hSP-C{Delta}Exon4 were treated with 4-PBA, perinuclear aggregation was inhibited and increases in anterograde transport to cytosolic compartments were seen (Fig. 8). Although Hsc-70 expression was dramatically altered by 4-PBA in cells expressing the {Delta}508 mutant of CFTR, we were unable to find consistent changes in expression of hsp70 or hsc70 in A549 cells transfected with hSP-C{Delta}Exon4 (M.F.B., unpublished). The modulation of a different chaperone, changes in microtubule function, or direct effects of 4-PBA on SP-C folding remain mechanistic possibilities that will require additional studies.

In summary, we have shown that expression of hSP-C{Delta}Exon4 is associated with marked alterations in protein trafficking, which can also affect the targeting of wild-type SP-C in a dominant-negative fashion. In addition to hSP-C{Delta}Exon4 and hSP-CL188Q, Nogee has reported the presence of ten different SP-C mutations in 34 term infants and children with chronic lung disease (Nogee et al., 2002Go). In addition, two other mutations in the SP-C gene have been identified in patients with interstitial lung disease (M.F.B., A. Hamvas and P. A. Stevens, unpublished). Similar to hSP-C{Delta}Exon4 and hSP-CL188Q, most of these are clustered in the COOH flanking propeptide. Understanding the trafficking patterns of these mutants as well as the long term consequences of their expression through the use of stably transfected cell lines as well as transgenic models will be critical to the overall characterization of the pathogenesis of interstitial lung disease associated with mutant isoforms of SP-C.


    Acknowledgments
 
We thank Viviane Martin for assistance with construction of the HA tagged construct and Susan Guttentag for helpful discussions. This work was supported by NIH HL-19737 and P50-HL56401 (both to M.F.B.).


    References
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

Ausbel, F. M., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. and Struhl, K. (1995). Current Protocols in Molecular Biology. New York: John Wiley and Sons.

Beers, M. F. (1998). Molecular Processing and Cellular Metabolism of Surfactant Protein C. In Lung Surfactant: Cellular and Molecular Processing (ed. S. A.Rooney), pp.93 -124. Austin, TX: R.G. Landes,.

Beers, M. F. and Lomax, C. (1995). Synthesis and processing of hydrophobic surfactant protein C by isolated rat type II cells. Am. J. Physiol. 269,L744 -L753.

Beers, M. F., Kim, C. Y., Dodia, C. and Fisher, A. B. (1994). Localization, synthesis, and processing of surfactant protein SP-C in rat lung analyzed by epitope-specific antipeptide antibodies. J. Biol. Chem. 269,20318 -20328.[Abstract/Free Full Text]

Beers, M. F., Lomax, C. A. and Russo, S. J. (1998). Synthetic processing of surfactant protein C by alveolar epithelial cells. The COOH terminus of proSP-C is required for post-translational targeting and proteolysis. J. Biol. Chem. 273,15287 -15293.[Abstract/Free Full Text]

Carrell, R. W. and Lomas, D. A. (1997). Conformational disease. Lancet 350,134 -138.[CrossRef][Medline]

Carrell, R. W. and Lomas, D. A. (2002). Mechanisms of Disease: alpha(1)-antitrypsin deficiency — a model for conformational diseases. New Engl. J. Med. 346, 45-53.[Free Full Text]

Chai, Y. H., Koppenhafer, S. L., Shoesmith, S. J., Perez, M. K. and Paulson, H. L. (1999). Evidence for proteasome involvement in polyglutamine disease: localization to nuclear inclusions in SCA3/MJD and suppression of polyglutamine aggregation in vitro. Hum. Mol. Genet. 8,673 -682.[Abstract/Free Full Text]

Conkright, J. J., Na, C. L. and Weaver, T. E. (2002). Overexpression of Surfactant Protein-C Mature Peptide Causes Neonatal Lethality in Transgenic Mice. Am. J. Resp. Cell Mol. Biol. 26,85 -90.[Abstract/Free Full Text]

Fischer, H., Fukuda, N., Barbry, P., Illek, B., Sartori, C. and Matthay, M. A. (2001). Partial restoration of defective chloride conductance in {Delta} F508 CF mice by trimethylamine oxide. Am. J. Physiol. Lung Cell Mol. Physiol. 281,L52 -L57.[Abstract/Free Full Text]

Gelman, M. S., Kannegaard, E. S. and Kopito, R. R. (2002). A principal role for the proteasome in endoplasmic reticulum-associated degradation of misfolded intracellular cystic fibrosis transmembrane conductance regulator. J. Biol. Chem. 277,11709 -11714.[Abstract/Free Full Text]

Glasser, S. W., Burhans, M. S., Korfhagen, T. R., Na, C. L., Sly, P. D., Ross, G. F., Ikegami, W. and Whitsett, J. A. (2001). Altered stability of pulmonary surfactant in SP-C-deficient mice. Proc. Natl. Acad. Sci. USA 98,6366 -6371.[Abstract/Free Full Text]

Gustafsson, M., Thyberg, J., Naslund, J., Eliasson, E. and Johansson, J. (1999). Amyloid fibril formation by pulmonary surfactant protein C. FEBS Lett. 464,138 -142.[CrossRef][Medline]

Johansson, J. (2001). Membrane properties and amyloid fibril formation of lung surfactant protein. Biochem. Soc. Trans. 29,601 -606.[CrossRef][Medline]

Johnson, A. L., Braidotti, P., Pietra, G. G., Russo, S. J., Kabore, A., Wang, W. J. and Beers, M. F. (2001). Post-translational processing of surfactant protein-C proprotein — Targeting motifs in the NH2-terminal flanking domain are cleaved in late compartments. Am. J. Res. Cell Mol. Biol. 24,253 -263.[Abstract/Free Full Text]

Johnston, J. A., Ward, C. L. and Kopito, R. R. (1998). Aggresomes: a cellular response to misfolded proteins. J. Cell Biol. 143,1883 -1898.[Abstract/Free Full Text]

Kabore, A. F., Russo, S. J., Wang, W.-J. and Beers, M. F. (2000) Palmitoylation of proSP-C is not required for its intracellular targeting and proteolytic processing. Am. J. Respir. Crit. Care Med. 161,A41 .

Kabore, A. F., Wang, W. J., Russo, S. J. and Beers, M. F. (2001). Biosynthesis of surfactant protein C: characterization of aggresome formation by EGFP chimeras containing propeptide mutants lacking conserved cysteine residues. J. Cell Sci. 114,293 -302.[Abstract]

Kallberg, Y., Gustafsson, M. Persson, B., Thyberg, J. and Johansson, J. (2001). Prediction of amyloid fibril-forming proteins. J. Biol. Chem. 276,12945 -12950.[Abstract/Free Full Text]

Keller, A., Eistetter, H. R., Voss, T. and Schafer, K. P. (1991). The pulmonary surfactant protein C (SP-C) precursor is a type II transmembrane protein. Biochem. J. 277,493 -499.

Kopito, R. R. (1997). ER quality control: the cytoplasmic connection. Cell 88,427 -430.[CrossRef][Medline]

Kopito, R. R. (2000). Aggresomes, inclusion bodies and protein aggregation. Trends Cell Biol. 10,524 -530.[CrossRef][Medline]

Kopito, R. R. and Ron, D. (2000). Conformational disease. Nat. Cell Biol. 2,E207 -E209.[CrossRef][Medline]

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227,680 -685.[CrossRef][Medline]

Nogee, L. M. (2002). Abnormal expression of surfactant protein C and lung disease. Am. J. Resp. Cell Mol. Biol. 26,641 -644.[Free Full Text]

Nogee, L. M., Dunbar, A. E., Wert, S. E., Askin, F., Hamvas, A. and Whitsett, J. A. (2001). A mutation in the surfactant protein C gene associated with familial interstitial lung disease. New Engl. J. Med. 344,573 -579.[Free Full Text]

Nogee, L. M., Dunbar, A. E., III, Wert, S., Askin, F., Hamvas, A. and Whitsett, J. A. (2002). Mutations in the surfactant protein C gene associated with interstitial lung disease. Chest 121,20S -21S.[Free Full Text]

Notterpek, L., Ryan, M. C., Tobler, A. R. and Shooter, E. M. (1999). PMP22 accumulation in aggresomes: implications for CMT1A pathology. Neurobiol. Dis. 6, 450-460.[CrossRef][Medline]

Perutz, M. F. (1997). Amyloid fibrils — mutations make enzyme polymerize. Nature 385, 773, 775.[Medline]

Prusiner, S. B. and Hsiao, K. K. (1994). Human Prion Diseases. Annals Neurol. 35,385 -395.[CrossRef][Medline]

Rubenstein, R. C. and Zeitlin, P. L. (2000). Sodium 4-phenylbutyrate downregulates Hsc70: implications for intracellular trafficking of DeltaF508-CFTR. Am. J. Physiol. Cell Physiol. 278,C259 -C267.[Abstract/Free Full Text]

Rubenstein, R. C., Egan, M. E. and Zeitlin, P. L. (1997). In vitro pharmacologic restoration of CFTR-mediated chloride transport with sodium 4-phenylbutyrate in cystic fibrosis of epithelial cells containing delta F508-CTFR. J. Clin. Invest. 100,2457 -2465.[Medline]

Russo, S. J., Wang, W.-J., Lomax, C. and Beers, M. F. (1999). Structural requirements for intracellular targeting of surfactant protein C. Am. J. Physiol. 277,L1034 -L1044.

Sato, S., Ward, C. L., Krouse, M. E., Wine, J. J. and Kopito, R. R. (1996). Glycerol Reverses the Misfolding Phenotype of the Most Common Cystic Fibrosis Mutation. J. Biol. Chem. 271,635 -638.[Abstract/Free Full Text]

Solarin, K. O., Wang, W. J. and Beers, M. F. (2001). Synthesis and post-translational processing of surfactant protein C. Pediatr. Pathol. Mol. Med. 20,471 -500.[CrossRef][Medline]

ten Brinke, A., Batenburg, J. J., Gadella, B. M., Haagsman, H. P., Vaandrager, A. B. and van Golde, L. M. G. (2001). The juxtamembrane lysine and arginine residues of surfactant protein C precursor influence palmitoylation via effects on trafficking. Am. J. Resp. Cell Mol. Biol. 25,156 -163.[Abstract/Free Full Text]

Thomas, A. Q., Lane, K., Phillips, J., III, Prince, M., Markin, C., Speer, M., Schwartz, D. A., Gaddipati, R., Marney, A., Johnson, J., Roberts, R., Haines, J., Stahlman, M. and Loyd, J. E. (2002). Heterozygosity for a Surfactant Protein C Gene mutation associated with usual interstitial pneumonitis and cellular nonspecific interstitial pneumonitis in one kindred. Am. J. Respir. Crit. Care Med. 165,1322 -1328.[Abstract/Free Full Text]

Tobler, A. R., Notterpek, L., Naef, R., Taylor, V., Suter, U. and Shooter, E. M. (1999). Transport of Trembler-J mutant peripheral myelin protein 22 is blocked in the intermediate compartment and affects the transport of the wild-type protein by direct interaction. J. Neurosci. 19,2027 -2036.[Abstract/Free Full Text]

Vanslyke, J. K., Deschenes, S. M. and Musil, L. S. (2000). Intracellular transport, assembly, and degradation of wild-type and disease-linked mutant gap junction proteins. Mol. Biol. Cell 11,1933 -1946.[Abstract/Free Full Text]

Vorbroker, D. K., Dey, C., Weaver, T. E. and Whitsett, J. A. (1992). Surfactant protein C precursor is palmitoylated and associates with subcellular membranes. Biochim. Biophys. Acta 1105,161 -169.[Medline]

Vorbroker, D. K., Voorhout, W. F., Weaver, T. E. and Whitsett, J. A. (1995). Posttranslational processing of surfactant protein C in rat type II cells. Am. J. Physiol. 269,L727 -L733.

Wang, W. J., Russo, S. J., Mulugeta, S. and Beers, M. F. (2002). Biosynthesis of Surfactant Protein C (SP-C). Sorting of SP-C proprotein involves homomeric association via a signal anchor domain. J. Biol. Chem. 277,19929 -19937.[Abstract/Free Full Text]

Warr, R. G., Hawgood, S., Buckley, D. I., Crisp, T. M., Schilling, J., Benson, B. J., Ballard, P. L., Clements, J. A. and White, R. T. (1987). Low molecular weight human pulmonary surfactant protein (SP5): isolation, characterization, and cDNA and amino acid sequences. Proc. Natl. Acad. Sci. USA 84,7915 -7919.[Abstract/Free Full Text]

Weaver, T. E. (1998). Synthesis, processing and secretion of surfactant proteins B and C. Biochim. Biophys. Acta Mol. Basis Dis. 1408,173 -179.[Medline]

Weaver, T. E. and Conkright, J. J. (2001). Functions of surfactant proteins B and C. Annu. Rev. Physiol. 63,555 -578.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
M. Wang, J. P. Bridges, C.-L. Na, Y. Xu, and T. E. Weaver
Meckel-Gruber Syndrome Protein MKS3 Is Required for Endoplasmic Reticulum-associated Degradation of Surfactant Protein C
J. Biol. Chem., November 27, 2009; 284(48): 33377 - 33383.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
L Guillot, R Epaud, G Thouvenin, L Jonard, A Mohsni, R Couderc, F Counil, J de Blic, R A Taam, M Le Bourgeois, et al.
New surfactant protein C gene mutations associated with diffuse lung disease
J. Med. Genet., July 1, 2009; 46(7): 490 - 494.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Kotorashvili, S. J. Russo, S. Mulugeta, S. Guttentag, and M. F. Beers
Anterograde Transport of Surfactant Protein C Proprotein to Distal Processing Compartments Requires PPDY-mediated Association with Nedd4 Ubiquitin Ligases
J. Biol. Chem., June 12, 2009; 284(24): 16667 - 16678.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
M. Korfei, C. Ruppert, P. Mahavadi, I. Henneke, P. Markart, M. Koch, G. Lang, L. Fink, R.-M. Bohle, W. Seeger, et al.
Epithelial Endoplasmic Reticulum Stress and Apoptosis in Sporadic Idiopathic Pulmonary Fibrosis
Am. J. Respir. Crit. Care Med., October 15, 2008; 178(8): 838 - 846.
[Abstract] [Full Text] [PDF]


Home page
NeoReviewsHome page
W. A. Gower, S. E. Wert, and L. M. Nogee
Inherited Surfactant Disorders
NeoReviews, October 1, 2008; 9(10): e458 - e467.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M. Dong, J. P. Bridges, K. Apsley, Y. Xu, and T. E. Weaver
ERdj4 and ERdj5 Are Required for Endoplasmic Reticulum-associated Protein Degradation of Misfolded Surfactant Protein C
Mol. Biol. Cell, June 1, 2008; 19(6): 2620 - 2630.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Mulugeta, J. A. Maguire, J. L. Newitt, S. J. Russo, A. Kotorashvili, and M. F. Beers
Misfolded BRICHOS SP-C mutant proteins induce apoptosis via caspase-4- and cytochrome c-related mechanisms
Am J Physiol Lung Cell Mol Physiol, September 1, 2007; 293(3): L720 - L729.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Johansson, K. Nordling, T. E. Weaver, and J. Johansson
The Brichos Domain-containing C-terminal Part of Pro-surfactant Protein C Binds to an Unfolded Poly-Val Transmembrane Segment
J. Biol. Chem., July 28, 2006; 281(30): 21032 - 21039.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
J. P. Bridges, Y. Xu, C.-L. Na, H. R. Wong, and T. E. Weaver
Adaptation and increased susceptibility to infection associated with constitutive expression of misfolded SP-C
J. Cell Biol., January 30, 2006; 172(3): 395 - 407.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
S. Mulugeta, V. Nguyen, S. J. Russo, M. Muniswamy, and M. F. Beers
A Surfactant Protein C Precursor Protein BRICHOS Domain Mutation Causes Endoplasmic Reticulum Stress, Proteasome Dysfunction, and Caspase 3 Activation
Am. J. Respir. Cell Mol. Biol., June 1, 2005; 32(6): 521 - 530.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
J. C. Grutters and R. M. du Bois
Genetics of fibrosing lung diseases
Eur. Respir. J., May 1, 2005; 25(5): 915 - 927.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
F. Brasch, M. Griese, M. Tredano, G. Johnen, M. Ochs, C. Rieger, S. Mulugeta, K.M. Muller, M. Bahuau, and M.F. Beers
Interstitial lung disease in a baby with a de novo mutation in the SFTPC gene
Eur. Respir. J., July 1, 2004; 24(1): 30 - 39.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
A. Hamvas, L. M. Nogee, F. V. White, P. Schuler, B. P. Hackett, C. B. Huddleston, E. N. Mendeloff, F.-F. Hsu, S. E. Wert, L. W. Gonzales, et al.
Progressive Lung Disease and Surfactant Dysfunction with a Deletion in Surfactant Protein C Gene
Am. J. Respir. Cell Mol. Biol., June 1, 2004; 30(6): 771 - 776.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. M. Noorwez, R. Malhotra, J. H. McDowell, K. A. Smith, M. P. Krebs, and S. Kaushal
Retinoids Assist the Cellular Folding of the Autosomal Dominant Retinitis Pigmentosa Opsin Mutant P23H
J. Biol. Chem., April 16, 2004; 279(16): 16278 - 16284.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. P. Bridges, S. E. Wert, L. M. Nogee, and T. E. Weaver
Expression of a Human Surfactant Protein C Mutation Associated with Interstitial Lung Disease Disrupts Lung Development in Transgenic Mice
J. Biol. Chem., December 26, 2003; 278(52): 52739 - 52746.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Mulugeta and M. F. Beers
Processing of Surfactant Protein C Requires a Type II Transmembrane Topology Directed by Juxtamembrane Positively Charged Residues
J. Biol. Chem., November 28, 2003; 278(48): 47979 - 47986.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jcs.00267v1
116/4/683    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, W.-J.
Right arrow Articles by Beers, M. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, W.-J.
Right arrow Articles by Beers, M. F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?