|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 15 January 2003
doi: 10.1242/jcs.00274
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
Institute of Molecular Biology, Department of Plant Physiology, Øster Farimagsgade 2A, 1353K Copenhagen, Denmark
* Author for correspondence (e-mail: mundy{at}biobase.dk)
Accepted 15 November 2002
| Summary |
|---|
|
|
|---|
Key words: Gibberellins, Katanin, Kinesin, lue1, Microtubules
| Introduction |
|---|
|
|
|---|
Plant MT organization is under the control of external stimuli and
endogenous signals, including hormones (reviewed by
Shibaoka, 1994
). For example,
auxin, gibberellin (GA) and brassinosteroid treatments lead to a modification
of cortical MT (CMT) orientation into a transverse array
(Ishida and Katsumi, 1992
;
Baluska et al., 1993
;
Zandomeni and Schopfer, 1993
).
By contrast, ethylene (ET) and abscisic acid, an antagonist of GA, promote an
oblique orientation. In the GA-deficient maize d5 dwarf, CMTs exhibit
an oblique orientation that can be restored to the wild-type transverse
orientation upon GA application, which results in normal growth
(Baluska et al., 1993
).
Moreover, the use of a GA biosynthesis inhibitor leads to a CMT misorientation
in wild-type root cells that is similar to that in d5. More recent
work has confirmed the role of GA in reorienting the CMT network in root and
leaf cells (Inada and Simmen, 2000; Wenzel
et al., 2000
). Despite these observations, molecular data linking
GA responses to CMT organization remain sparse.
Two major genes affecting responses to GA have been identified in
phenotypic screens for growth mutants. Dominant mutations of GAI/RGA,
which encode GRAS proteins proposed to function as the metazoan STAT
transcription factors (Richards et al.,
2000
), result in semi-dwarfism, an important agronomic trait.
Recessive mutations in SPY, which encodes an O-linked
N-acetylglucosamine transferase [OGT
(Thornton et al., 1999
)],
result in elongated plants with a constitutive GA-response phenotype. In
attempts to identify additional genes involved in GA responses, we developed a
fusion genetic approach to identify trans-acting mutations affecting the
expression of transgenes composed of the firefly luciferase reporter under the
control of the promoter of AtGA20ox1, which encodes the biosynthetic
GA20-oxidase (Meier et al.,
2001
). The AtGA20ox1 promoter was used because expression
from it is regulated through negative feedback by active product GAs;
therefore, cis-elements in the promoter may be targets for GA signaling
pathways. This screen identified the recessive, semidwarf lue1
mutant. Lue1 exhibited constitutive, high levels of LUC reporter and
AtGA20ox1 mRNA, as well as inappropriate feedback regulation of the
endogenous AtGA20ox1 and At3ox1 biosynthetic genes by GA.
Additionally, wild-type stature could not be rescued by GA applications. These
results indicated that the sensitivity of lue1 to GA was altered at
the levels of both GA biosynthetic feedback and vegetative cellular
responses.
We show here that lue1 is allelic to fra2 and bot1. Complementation of lue1 with the wild-type AtKSS gene restored normal stature and luciferase reporter levels. Treatments of lue1 with ET and GA revealed inappropriate hormonal responses related to cell growth. A reporter fusion between AtKSS and GFP revealed that AtKSS decorates the CMT in a punctate pattern. Moreover, a yeast two-hybrid screen performed with AtKSS as the bait identified proteins related to those involved in MT growth and processing, including a katanin p80 and a large protein containing a kinesin-like domain. Potential links between GA signalling and MT organization are discussed.
| Materials and Methods |
|---|
|
|
|---|
AtKSS gene cloning and lue1 complementation
The AtKSS gene was PCR-amplified with template DNA from BAC F5I6
and linker-primers 5'ACAAGCTTGTTGGTCCTGGCCAG-TCAGAC and
5'CTTAGATCTACATCCGGAGTCCTCCTTAGC. Products were digested with
HindIII and BglII and subcloned in the HindIII and
BamHI sites of the pCambia3300 vector (Cambia, Canberra) to
produce C3300-AtKSS. This construct was introduced into
Agrobacterium tumefaciens (PGV3101) by electroporation, which was
used to transform the lue1 mutant by vacuum infiltration
(Bechtold and Pelletier, 1998
).
T1 generation seedlings were selected in soil for phosphinothricin
resistance expressed from the pCambia3300 T-DNA by spraying seedlings
every 3 days with 10 mg/l Bastamycin (AgrEvo, Denmark).
CaMV35S-AtKSS-GFP-GUS reporter
AtKSS wild-type genomic DNA was PCR-amplified by RT-PCR using
linker-primers 5'AGATCTGGGAAGTAGTAATTCGTTAGCGGGTC and
5'AGATCTCCAAACTCAGAGAGCCACTTCTCGTG. PCR was performed for 30
cycles using Vent DNA polymerase (NEB) and Arabidopsis Col0 genomic
DNA as the template. The product was digested with BglII and cloned
into the same site of pCAMBIA1304 (Cambia, Canberra) to produce the
C1304-AtKSS-GFP-GUS fusion reporter. The AtKSS sequence and
correct fusion open reading frame were confirmed by sequencing. This construct
was transformed via the A. tumefaciens strain PGV3101 into
lue1 and Arabidopsis Col ecotype by vacuum infiltration.
T1 seedlings were selected for hygromycin resistance, carried on
the pCAMBIA1304 T-DNA, on MS plates with 50 mg/l hygromycin B. Homozygous
single insertion lines were selected from the T3 generation and
approximately 20 lines analyzed further.
Reporter assays
Equipment and protocols for LUC bioluminescence imaging were described
previously (Meier et al.,
2001
). GFP was visualized using a Zeiss LSM 510 laser-scanning
microscope applying the 488 nm line of the argon laser and the corresponding
dichroic mirror and a 505-530 nm band-pass filter. For reference, chlorophyll
fluorescence and a Nomarski image were recorded simultaneously.
RNA analysis
Total RNA (10 µg) extracted with the RNAgent kit (Promega) was
fractionated on standard formaldehyde gels and blotted onto Hybond-N+
membranes (Amersham). AtKSS mRNA levels were investigated by
hybridization with a ribonucleic [32P]CTP antisense probe
synthesized with T7 RNA polymerase (Ribokit, Promega) from a full-length cDNA
cloned in the pGEM-Teasy vector (Promega). AtKSS primers for
cDNA amplification were 5'GTTAGCGGGTCTACAA-GACCAC and
5'ACTCAGAGAGCCACTTCTCGTG. Hybridization and washing conditions were
performed as recommended by the manufacturer.
Analysis of CMF orientation by polarizing microscopy
For polarizing microscopy, 5 mm segments from the lower part of the
flowering stem were fixed in buffered 4% formaldehyde, embedded in paraffin
wax and sectioned longitudinally at 8 µm. Positions of maximum extinction
closest to the polarizing plane of the analyzer were determined visually by
rotating the stage of the polarizing microscope
(Frey-Wyssling, 1959
). The
angular absolute values of the difference between these positions and those of
the long cell axis parallel to the analyzer plane were determined. The
distinction between extinction parallel to the analyzer plane and to the
polarizer plane was made by insertion of a red first order compensator
(sensitive tint plate).
AtKSS protein interaction analyses
The full-length AtKSS cDNA bait was amplified by RT-PCR with
linker-primers AAA1-2hyb-F (GAGGAATTCGTGGGAAGTAGTA-ATTCGTTAGCG) and
AAA1-2hyb-R (GGGAGATCTTAAGCAGA-TCCAAACTCAGAGAGC). The product was
digested with BamHI and BglII and subcloned in the
BamHI site of pGBKT7 (Clontech Matchmaker System III) to
produce pGBKT7-AtKSS, which was introduced into yeast strain
PJ69A-4A. This bait strain was transformed with a cDNA library from mature
leaf mRNA in vector pGAD10 (Clontech, FL4000AB). The yeast two-hybrid
screen was performed according to the manufacturer's instructions for
prototrophic growth on medium lacking tryptophan (TRP), leucine (LEU),
histidine (HIS) and adenine (ADE) for 4 days at 30°C. A total of
15x106 transformants were screened to yield some 1000
positive clones. These clones were assayed for ß-galactosidase activity,
which eliminated roughly 50% of the clones. DNA was extracted from the
remainder and approximately 100 clones were used as PCR templates with
pGAD10 primers (Clontech, 9103-1) to size inserts and for sequencing.
Sequencing allowed us to discard clones containing frame shifts between the
GAL4-binding domain (GAL4-BD) and the prey clones or clones inserted in the
reverse orientation. One clone from each of the remaining prey insert groups
was mobilized in E. coli and re-sequenced. To confirm interactions,
bait and prey plasmids were individually co-transformed into PJ69A-4A and
re-evaluated for prototrophic growth and ß-galactosidase activity. To
confirm AtKSS interactions, prey cDNAs were subcloned into the T7 RNA
polymerase promoter-containing pGAD-T7 plasmid (Clontech).
Additionally, a truncated version (1.25B2) of the KTN P80.1 clone
1.25 was constructed by restriction digestion with BglII and
subsequent cloning into the BamHI site of pGADT7. Correct
orientation of the insert and frame were assessed by restriction digestion and
sequencing. All pGADT7-based constructs were confirmed for interaction with
AtKSS in directed yeast two-hybrid assays by co-transformation of the yeast
PJ69A-4A with pGBKT7-AtKSS. Additionally, an empty pGBKT7
(i.e. without the AtKSS fusion) was co-transformed with the
pGADT7-based vectors to confirm that both ß-galactosidase
activity and prototrophic growth require AtKSS-prey proteins interaction. To
further confirm AtKSS interactions, bait and prey proteins were synthesized by
in vitro transcription/translation using the T7-RNA-polymerase-based TnT kit
(Promega, #L4610) in the presence of 35S-methionine and
co-immunoprecipitated with protein-G-coupled Dynabeads (Dynal Biotech,
#100.03/04) according to the manufacturer's instructions. An
in-vitro-translated c-Myc-tagged lamin C (pGBKT7-Lam, Clontech) was used as a
control in co-immunoprecipitation assays.
Genetic analyses
Lue1 was previously mapped with SSLP markers
(Bell and Ecker, 1994
) to the
bottom of chromosome 1, south of marker nga692
(Meier et al., 2001
). New SSLP
markers were generated by comparison with Col0 and Ler ecotype DNA sequences
available from Cereon Genomics
(http://godot.ncgr.org/cereon/).
The following primer combinations were used: F18B13-2-F
(5'TTAATTATGGTTTCATGATCATGG) and F18B13-2-R
(5'CTTTCCTTACACATCTTTCCTGC) from BAC F18B13; F23A5-2-F
(5'CTCGAGATCTAGACATGGAGC) and F23A5-2-R (5'GTCTAGGTTCAACAATGCTGC)
from BAC F23A5; F9K20-1-F (5'TCCTCCGCTTCCGATTGGTC) and F29K20-1-R
(5'GGTACCGTCACGTTCGCCGT) from BAC F29K20; T8K14-1-F
(5'CAATGCGCTCTGAATCTCTGAC) and T8K14-1-R (5'CCATTCACCCACTCTTGACTC)
from BAC T8K14.
| Results |
|---|
|
|
|---|
To confirm that loss of AtKSS function was responsible for the lue1 mutant phenotype, the AtKSS gene, including 1.7 kb of 5'UTR and 1.3 kb of 3'UTR, was amplified from the Col0 ecotype and mobilized into lue1 via the vector C3300-AtKSS. Fig. 1A shows that the wild-type AtKSS gene rescued the lue1 dwarf phenotype, indicating that the nonsense mutation in AtKSS is responsible for the lue1 phenotype. Phenotypic rescue was observed for all bastamycin-resistant T1 plants. Moreover, herbicide resistance carried on the C3300-AtKSS construct was found to co-segregate with the wild-type phenotype in subsequent generations.
|
To check whether GA5-LUC reporter overexpression in lue1
(Meier et al., 2001
)
(Fig. 1B) would be restored to
wild-type levels in lue1 plants complemented by the
C3300-AtKSS construct, homozygous T3 generation seedlings
were grown on MS plates and assayed for LUC activity in vivo. Strong reporter
activity was detected in lue1
(Fig. 1C), whereas
lue1 plants carrying C3300-AtKSS exhibited markedly reduced
LUC levels (Fig. 1D). This
indicates that the lue1 mutation in AtKSS is responsible for
the GA5-LUC reporter overexpression observed in lue1.
Transcriptional regulation of AtKSS by GA
AtKSS mRNA levels in lue1 and wild-type transgenic (WT)
seeds were assayed by RNA blot hybridization. This showed that AtKSS
mRNA levels were markedly reduced in lue1
(Fig. 1E), which suggests that
the truncated ORF of the lue1 AtKSS allele reduces the stability of
the mutant mRNA. Alternatively, AtKSS could be involved in a feed-forward
regulation of its own transcription, which would be impaired in lue1.
Since lue1 exhibits altered regulation of both the GA5-LUC
reporter and endogenous AtGA20ox1 gene
(Meier et al., 2001
), we
investigated the expression of AtKSS upon GA3 treatment in
the GA-deficient ga1-1 mutant
(Koornneef and van der Veen,
1980
). This showed that AtKSS mRNA accumulation levels
were lower in ga1-1 than in wild-type Ler and could be
restored to wild-type levels by GA3 treatment. These results
indicate that GA levels modulate AtKSS mRNA accumulation.
Lue1 exhibits altered cell elongation responses to GA and
ET
As lue1 exhibits altered AtGA20ox1 expression levels, the
mutant might be affected in its responses to GA. To assess this, GA-related
responses, including flowering induction and cell elongation, were compared in
GA-treated WT seedlings and lue1 seedlings grown under long-day
conditions (Fig. 2). GA
treatments caused both lue1 and WT leaves to pale. Flowering could be
promoted in lue1 by application of GA3 or GA4,
although the effect of the latter was more pronounced
(Fig. 2A). Flowering induction
by GA was the same in both lue1 and WT
(Fig. 2B). Indeed, GA
applications reduced FT from 40 to 30 days for both WT and lue1
plants, indicating that the general sensitivity of lue1 to GA was not
compromised. However, the mutant exhibited decreased stem elongation in
response to GA (data not shown). This apparent insensitivity of lue1
to GA-responsive cell elongation was pronounced in leaves, such that neither
blade nor petiole length was affected by GA treatment
(Fig. 2C).
|
Preliminary germination tests revealed that hypocotyl hook formation is impaired in lue1. Since hooking is caused by differential cell elongation, which is regulated, at least in part, by ET, we investigated lue1 sensitivity to ET. WT and lue1 seeds were plated on MS supplemented with 50 µM ACC and allowed to germinate in the dark. As expected, WT seedlings exhibited a typical hook that could be increased by ACC treatment (Fig. 3A,B). By contrast, hypocotyl hook formation was impaired in lue1 control seedlings, whereas ACC treatment did not significantly induce hooking in the mutant (Fig. 3A,B). However, other ET-induced morphological changes were unaffected in lue1, including hypocotyl thickening (Fig. 3C) and hypocotyl and root shortening (Fig. 3D,E).
|
Lue1 sensitivity to ET was also investigated in seedlings
germinated in the light, which has previously been shown to stimulate
hypocotyl growth of seedlings grown on low nutrient medium
(Smalle et al., 1997
). As
expected, hypocotyl growth was enhanced in WT seedlings grown in the presence
of ACC (Fig. 3F). Similarly,
lue1 hypocotyl growth was also induced, although apparently to a
lesser extent. Both WT and lue1 root elongations were strongly
reduced in the presence of ACC (Fig.
3G). Taken together, these results indicate that although
lue1 is generally responsive to ET, the mutant exhibits inappropriate
responses leading to cell growth orientation.
The lue1 mutant exhibits abnormal CMF and CMT
orientation
Before cloning the AtKSS gene, the general isotropic cell growth
observed in lue1 led us to investigate CMF and CMT orientation in the
mutant. CMF orientation was measured in WT and lue1 hypocotyls by
polarizing microscopy, which is based on the birefringence of CMF
(Frey-Wyssling, 1959
).
Fig. 4A shows an example of
polarizing microscopy of WT and lue1 pitted vessel cells. For WT, the
minimum and maximum birefringences were obtained for a rotation angle close to
0° and 45°, respectively. This indicated an average transverse
orientation of CMF compared to the main growth axis. By contrast, the minimum
and maximum birefringent angles in lue1 were approximately 45°
and 0°, indicating that CMF have an average orientation approaching
45°. Moreover, the generally lower intensity at maximum birefringence is
interpreted as a more random orientation in the mutant cells, since staining
of the wall showed no difference in wall thickness. Similar polarizing
acquisitions were performed on xylem parenchyma, sclerenchyme and epidermal
radial walls. Interestingly, most cell types exhibited deviations of CMF in
lue1 compared with WT (Fig.
4B). Moreover, CMF orientation was more variable in lue1
than in WT cells, as clearly show in the standard deviations of measurements
for pitted vessels. A Mann-Whitney rank sum test was performed to test whether
the difference in median values of CMF orientation in WT and lue1
cells was statistically significant. This test confirmed the more random
distribution of CMF in lue1 (P<0.001). These results have
recently been confirmed and extended by microscopic analyses showing that the
aberrant MT orientation caused by the fra2 mutation in AtKSS
results in distorted deposition of cellulose microfibrils
(Burk and Ye, 2002
).
|
As it is generally thought that a CMT network orients the CMF cellulose
polymers laid down just outside the plasmalemma, the altered CMF orientation
in lue1 might reflect disorganized CMT. We therefore compared CMT
network organization in lue1 and WT by crossing lue1 with
transgenic plants expressing a translational fusion between GFP and the
MT-associated protein4 [MP4 (Marc et al.,
1998
)]. This reporter fusion decorates CMT in Arabidopsis
cells without interfering with cytoskeletal organization
(Mathur and Chua, 2000
).
Confocal microscopy revealed a striking difference between WT and
lue1 CMT in interphase cells. CMT in WT cells appeared ordered in
transverse arrays, whereas the decorated CMT in lue1 exhibited a more
random distribution (compare Fig. 4C with
D). This result is in agreement with previous observations
performed on bot1-5 and fra2 mutants cells
(Bichet et al., 2001
;
Burk et al., 2001
). These
observations were confirmed for most cell types investigated, including those
of the root, hypocotyl and cotyledon. However, no obvious difference between
WT and lue1 CMT organization was detected in stomata (compare
Fig. 4E with F), although
lue1 stomata exhibited a reduced length, comparable to other cell
types, when compared to WT. These results suggest that the role of AtKSS in
stomatal cell differentiation and development is less pronounced than in other
cell types.
The AtKSS protein decorates the CMT
To investigate the subcellular localization of AtKSS and its possible
interaction with CMT, we generated transgenic Arabidopsis Co10 plants
expressing a translational fusion between AtKSS and the GFP
and GUS reporters (AtKSS-G-G; Fig.
5A). Interestingly, all herbicide-resistant transgenic plants
expressing detectable levels of the GUS and GFP reporters phenocopied
lue1 (Fig. 5B). These
plants had the characteristic shorter and thicker organs of lue1,
including leaves, flowers and siliques. Leaf trichomes were also mainly two
branched and frequently distorted. By contrast, all herbicide-resistant
transgenic plants that appeared to be wildtype had very weak GUS activities
and no detectable GFP (data not shown). Confocal microscopy performed on
intact tissue showed that the AtKSS-G-G protein fusion is targeted to the
cytoplasm in epidermis root cells (Fig.
5D,E). No GFP was detected in organelles, vacuoles or nuclei. In
root cells close to the root tip, no obvious pattern was observed, and GFP
appeared as a blurry signal staining the entire cytoplasm. However, in
epidermal root cells that were distant from the tip the GFP signal appeared
associated with CMT (Fig.
5F,G). Similar CMT labeling by AtKSS-G-G was found in the
hypocotyl (Fig. 5H), in the
transition zone between root and hypocotyl
(Fig. 5I,J) and in stomata
(Fig. 5K). Closer examination
revealed that GFP decorated CMT bundles while establishing apparent protein
aggregations along its fibers (Fig.
5J). This punctate pattern of CMT labeling was particularly
prominent in cells close to the transition zone between the root and
hypocotyl.
|
AtKSS interacts with other MT-related proteins
The connection between AtKSS, CMT organization and GA prompted us to search
for proteins that interact with AtKSS. A yeast two-hybrid screen was therefore
performed with full-length AtKSS fused to the GAL4-DNA-binding domain
(GAL4-BD) as bait. An Arabidopsis cv Co10 cDNA library from mature
leaves was screened and resulted in the isolation of some 1000 clones, some of
which were further characterized (Fig.
6A). Protein-protein interactions in yeast were confirmed by
transforming the PJ69-4A strain (auxotrophic for TRP, LEU, HIS and ADE) with
plasmids containing GAL4-BD-AtKSS (pGBT7-AtKSS; TRP marker)
and GAL4-activation domain (pGAD10-prey; LEU marker). All
transformants grew on SD medium lacking TRP, LEU, ADE and HIS
(Fig. 6B, right). Additionally,
they exhibited strong ß-galactosidase activities
(Fig. 6B, center). This
indicates that the ADE2 and HIS3 genes, whose
transcriptional control is dependent on GAL4-AD and GAL4-BD interaction, are
expressed. By contrast, strains carrying empty pGBT7 lacking
AtKSS and the pGAD10-prey plasmids exhibited neither
auxotrophic growth on medium lacking the nutritional markers
(Fig. 6C, right) nor
ß-galactosidase activities (Fig.
6C, center), confirming the interactions between AtKSS and prey
proteins.
|
A katanin p80 subunit ortholog (Chromosome 1, BAC F11P17) was abundantly
represented in the clones obtained from the library screen. Two different
clones were obtained encoding the C-terminal domain of this protein, referred
to here as KTN-p80.1 (accession number: AAB71474;
Fig. 6A). This result is in
agreement with previous observations that the C-terminal region of katanin p80
is required for interaction with the katanin p60 subunit in animal cells
(Hartman et al., 1998
;
McNally et al., 2000
).
Co-immunoprecipitation assays confirmed the interaction between AtKSS and
KTN-p80.1 in vitro (Fig. 6D).
Database homology searches revealed the presence of three other
Arabidopsis KTN-p80.1-related genes that are represented in EST
databases. Although some of these predicted proteins exhibit low homology with
the central region of KTN-p80.1, all share high similarities within their
N-terminal WD40 repeats and within the C-terminal region of KTN-p80.1 and
katanin p80 subunits from other organisms
(Fig. 6E).
Another putative AtKSS-interacting protein (accession number, CAB89396;
referred to here as KSN1) was isolated as two independent yeast clones from
the library screen. KSN1 contains an ATP/GTP-binding site motif A (P-loop;
residues 223-230) and a kinesin motor domain signature (residues 356-367).
KSN1 was previously characterized as a cdc2a-interacting peptide [accession
number: AJ001729 (de Veylder et al.,
1997
)]. The KSN1 cDNA (clone 1.52) isolated in the
two-hybrid screen spans residues 473-867, a region with significant
similarities to another Arabidopsis protein represented by an EST
(AB011479.1). Co-immunoprecipitation assays confirmed the interaction between
AtKSS and the KSN1 peptide encoded by clone 1.52
(Fig. 6D).
| Discussion |
|---|
|
|
|---|
An explanation for these effects is that GA affects a distinct signaling
pathway that monitors and modulates cell growth. In this model, GA affects
cell elongation that induces AtKSS and/or represses
AtGA20ox1 indirectly via another pathway. Alternatively, GA and other
growth signaling pathways may crosstalk, in which case shared or interacting
components exist. Numerous reports have shown that GA signaling regulates the
transcription of target genes and the post-translational control of certain
proteins. For example, levels of the Arabidopsis GA signaling
repressor RGA, a member of the GRAS protein family thought to act as
transcription factors (Richards et al.,
2000
), are rapidly reduced upon GA application
(Silverstone et al., 2001
). In
addition, SPY encodes an O-linked
N-acetylglucosamine transferase (OGT) whose loss-of-function produces
a constitutive GA-response mutant phenotype
(Thornton et al., 1999
). OGT
addition of O-linked N-acetylglucosamine may regulate the
activity of substrate proteins antagonistically to their modification by
phosphorylation (Wells et al.,
2001
). Possible models of GA action therefore include the direct
modification and resultant stabilization of RGA by SPY
(Harberd et al., 1998
) that is
somehow counteracted by GA to derepress the expression of RGA downstream
targets, potentially including AtKSS. This model does not, however, explain
the effect that loss of AtKSS function has on the increase in
expression of the GA biosynthetic genes AtGA20ox1 and
At3ox1, whose expression is normally repressed by GA
(Meier et al., 2001
). This
effect suggests that AtKSS and/or other MT-associated proteins
indirectly affect GA feedback via regulatory pathways to integrate
cytoskeletal organization and cell elongation. Although such pathways remain
obscure, they may include signaling pathways related to brassinosteroids that
also affect MT organization (Catterou et
al., 2001
) and that we have shown to increase the expression of
AtGA20oxl (Bouquin et al.,
2001
).
The ectopic expression of a fusion reporter between AtKSS, GFP and GUS in
wild-type Co10 plants resulted in a dwarf phenotype similar to that of
lue1. This suggests that the AtKSS-G-G fusion functions as a dominant
negative form of AtKSS that lacks all or some of its activity. This hypothesis
is in agreement with the fact that the AtKSS-G-G reporter fusion failed to
rescue the lue1 mutant (data not shown). However, since AtKSS-G-G
decorates CMT, this reporter fusion is apparently correctly targeted and may
compete with endogenous AtKSS protein for factors important for its function.
If both the MT-interacting and katanin p80-interacting domains are functional
in AtKSS-G-G, then the C-terminal ATPase domain required for MT-severing
activity (Hartman and Vale,
1999
) may not be fully functional in the fusion. Such a model is
consistent with the fact that both the lue1 and fra2
mutations occur in the ATPase domain of AtKSS. In addition, we show that
AtKSS mRNA levels are detectable in lue1, although at
significantly lower levels than in WT. This suggests that the lue1
phenotype is primarily the result of an inactive katanin p60 rather than a
lack of the protein. We note that the fusion between the two reporters and
AtKSS was designed in the AtKSS C-terminus to avoid disturbing its N-terminal,
MT-interacting domain or potential post-translational processing including
glycosylation.
In all our observations, the AtKSS-G-G reporter was confined to the
cytoplasm. More specifically, the protein was observed as a blurry signal in
epidermal cells close to the root tip, whereas distinct CMT labeling patterns
were detected in other cells such as in the transition zone between the root
and hypocotyl, the hypocotyl and stomata. We also observed phragmoplast
labeling by AtKSS-G-G, although the signal intensity appeared weaker and more
random than in interphase cells (data not shown). Since mitosis and
cytokinesis were apparently unaffected in the allelic bot1-5 and
fra2 mutants (Bichet et al.,
2001
; Burk et al.,
2001
), these results indicate that the role of AtKSS in modulating
MT dynamics is less marked during mitosis than during interphase. This may be
due to a difference in protein targeting, although we cannot exclude
transcriptional control of AtKSS. Recently the Caenorhabditis
elegans Nedd8 ubiquitin-like protein modification pathway that regulates
cell cycle progression was shown to negatively regulate katanin, thus allowing
the formation of the mitotic spindle (Kurz
et al., 2002
). It is therefore possible that the
Arabidopsis katanin is similarly targeted for ubiquitin-mediated
degradation when assembly of the mitotic spindle is required.
In interphase cells, CMT labeling by the AtKSS-G-G reporter frequently
appeared as a punctate pattern, suggesting that the reporter fusion aggregates
along the CMT. Interestingly, C. elegans katanin p60 forms hexameric
rings around MT (Hartman et al.,
1998
; Hartman and Vale,
1999
). It is therefore likely that the AtKSS-G-G structures
observed along the CMT correspond to aggregations of katanin rings. This would
imply that the AtKSS-G-G ATPase domain binds ATP because katanin p60
oligomerization is an ATP-dependent process
(Hartman and Vale, 1999
).
However, the presence of intact but mis-oriented CMT in plants expressing
AtKSS-G-G suggests that this fusion may have reduced or no ATPase activity
required for MT severing. For example, overexpression of human katanin p60 in
HeLa cells results in disassembly of the interphase MT cytoskeleton
(McNally et al., 2000
), which
is clearly not the case in plant cells that overexpress AtKSS-G-G. The
importance of ATPase activity in vivo could be addressed with reporters based
on GFP fused to the AtKSS N-terminus or on AtKSS forms mutated to block
nucleotide hydrolysis and trap the enzyme in the ATP-bound state
(Hartman and Vale, 1999
).
Preliminary time-course observations of GFP-MAP4 reporter fluorescence indicated that wild-type CMT undergo rapid shrinkage and reorientation within minutes of transfer of seedlings from dark to light (data not shown). By contrast, modifications of the CMT network appeared to be slower in lue1. It is therefore probable that the abnormal CMT organization reflects the inability of lue1 CMT to respond rapidly to stimuli normally responsible for CMT reorientation and anisotropic cell growth. This would lead to the abnormal deposition of CMF in lue1 and contribute to the general organ fragility observed in fra2, bot1-5 and lue1, as well as their apparent insensitivity to hormone-mediated cell elongation.
A yeast two-hybrid screen with AtKSS as bait identified a katanin p80
subunit ortholog (KTN-p80.1) as an AtKSS interaction partner. This
result confirms that AtKSS has a katanin-like function. The two
KTN-p80.1 clones isolated (1.38 and 1.25) encode the C-terminus and implicate
this region in the interaction with the katanin p60. More specifically, clone
1.25 encodes the last 222 residues of KTN-p80.1, including 101 amino acids
conserved among katanin p80-like proteins. This domain is therefore sufficient
to establish interactions between katanin heterodimers, as shown in directed
yeast two-hybrid and co-immunoprecipitation assays using a truncated version
(1.25B2) of clone 1.25. Sequence homology searches identified three other
KTN-p80.1-related Arabidopsis genes with strong homology to
other katanin p80s, particularly in the N-terminal WD40 repeats and in the
C-terminal katanin-p60-interacting region. Since they are all represented in
EST databases, it is surprising that only KTN-p80.1 was isolated in the
two-hybrid screen. It may be that the other KTN-p80-encoding clones were
under-represented in the cDNA library, and we therefore cannot exclude the
possibility that AtKSS interacts with other KTN-p80.1-like proteins in planta.
In animal cells, the katanin p80 subunit targets the katanin complex to
centrosomes and regulates the MT-severing activity of the p60 subunit
(Hartman et al., 1998
;
McNally et al., 2000
).
Database searches indicated that Arabidopsis has only one copy of
AtKSS. However, several homologous proteins harboring the AAA ATPase domain,
but lacking the N-terminal region that contains the MT- and
katanin-p80-interacting domains, are present in Arabidopsis.
Moreover, the genetic isolation of null mutant alleles of AtKSS
suggests that there are no other genes with completely redundant functions.
Therefore, the involvement of AtKSS in multiple and distinct MT-related
activities may require tight control of its subcellular targeting. The fact
that all katanin-P80-related proteins from Arabidopsis are highly
similar within the WD40 domains and katanin-p60-interacting C-terminal
regions, but otherwise exhibit low homologies in the central regions, suggests
that the central region may be involved in differential targeting of the
katanin heterodimers. For example, KTN p80.1 could target AtKSS to CMT,
whereas another p80 form could target it to the phragmoplasm. This would
explain why the other katanin p80s may be under-represented in the yeast
two-hybrid library because there are less cells undergoing division than cells
in interphase. GUS reporter fusions using various katanin p80 promoters may
address this question. However, the fact that loss-of-function alleles of
AtKSS are apparently not impaired in cytokinesis and mitosis
indicates that this katanin p60 subunit plays a minor role in these cellular
events. Katanin activity analogous to that required in the spindle pole of
animal cells undergoing cell division may therefore be supplied by other
MT-severing proteins in plant cells.
Another AtKSS-interacting protein identified here (KSN1) harbors an
ATP/GTP-binding site motif A (P-loop) and a kinesin motor domain signature,
although these regions were apparently not involved in the interaction with
AtKSS. Kinesin motor enzymes hydrolyze ATP to generate force and movement
along MT. Numerous studies have shown a role for kinesins in MT-associated
activities such as vesicle transport along MT, mitosis and meiosis. Homology
searches indicated that KSN1 is member of a small family that includes another
protein exhibiting 77% identity with KSN1 (AB011479.1). An A-type
cyclin-dependent kinase (CDK) designated Cdc2 was previously shown to interact
with a KSN1 peptide (de Veylder et al.,
1997
). Interestingly, Cdc2 cosedimented with taxol-stabilized MT
(Weingartner et al., 2001
).
Additionally, a functional Cdc2-GFP fusion decorated the anaphase spindle and
phragmoplast. Subcellular localization of the Cdc2-GFP fusion was shown to be
cell-cycle-dependent and tightly associated with the nucleus during
interphase. Taken together with our inability to detect the AtKSS-G-G fusion
in the nucleus, the association of AtKSS with KSN1 and Cdc2, if any, is likely
to take place during mitosis. Alternatively, AtKSS and Cdc2a could compete for
recruitment of KSN1, although we found no significant sequence homologies
between AtKSS and Cdc2 to indicate conserved binding regions. Interestingly,
immunological experiments with antibodies targeted either against the
C-terminal region of Cdc2 or the PSTAIRE motif in the cyclin-binding domain
found in A-type CDKs showed that Cdc2 was associated with CMT from various
plants (Hemsley et al., 2001
).
This suggests that a multimeric protein complex including katanin heterodimers
KSN1 and Cdc2a could be involved in CMT processing.
The growing number of MT-associated proteins (MAP) and MT regulatory proteins that are being characterized in plants is rapidly increasing our understanding of MT genesis and dynamics. Among these MAPs, AtKSS seems to play a central role, especially in the integration of hormonal signals that lead to anisotropic cell growth by severing CMT, allowing reorientation of MT growth and thus CMF deposition. Further work is required to elucidate the molecular mechanisms that lead to the transcriptional regulation of GA biosynthetic genes and the exact involvement of AtKSS in mitosis and cytokinesis.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Arioli, T., Peng, L., Betzner, A. S., Burn, J., Wittke, W.,
Herth, W., Camilleri, C., Hofte, H., Plazinski, J., Birch, R. et al.
(1998). Molecular analysis of cellulose biosynthesis in
Arabidopsis. Science
279,717
-720.
Azimzadeh, J., Traas, J. and Pastuglia, M. (2001). Molecular aspects of microtubule dynamics in plants. Curr. Opin. Plant Biol. 4, 513-519.[CrossRef][Medline]
Baluska, F., Parker, J. S. and Barlow, P. W. (1993). A role for gibberellic acid in orienting microtubules and regulating cell growth polarity in the maize root cortex. Planta 191,149 -157.[CrossRef]
Bechtold, N. and Pelletier, G. (1998). In planta Agrobacterium-mediated transformation of adult Arabidopsis thaliana plants by vacuum infiltration. Methods Mol. Biol. 82,259 -266.[Medline]
Bell, C. J. and Ecker, J. R. (1994). Assignment of 30 microsatellite loci to the linkage map of Arabidopsis.Genomics 19,137 -144.[CrossRef][Medline]
Bichet, A., Desnos, T., Turner, S., Grandjean, O. and Hofte, H. (2001). BOTERO1 is required for normal orientation of cortical microtubules and anisotropic cell expansion in Arabidopsis.Plant J. 25,137 -148.[CrossRef][Medline]
Bouquin, T., Meier, C., Foster, R., Nielsen, M. E. and Mundy,
J. (2001). Control of specific gene expression by gibberellin
and brassinosteroid. Plant Physiol.
127,450
-458.
Burk, D. H. and Ye, Z.-H. (2002). Alteration of
oriented deposition of cellulose microfibrils by mutation of a katanin-like
microtubule-severing protein. Plant Cell
14, 1-17.
Burk, D. H., Liu, B., Zhong, R., Morrison, W. H. and Ye, Z.
H. (2001). A katanin-like protein regulates normal cell wall
biosynthesis and cell elongation. Plant Cell
13,807
-827.
Catterou, M., Dubois, F., Schaller, H., Aubanelle, L., Vilcot, B., Sangwan-Norreel, B. S. and Sangwan, R. S. (2001). Brassinosteroids, microtubules and cell elongation in Arabidopsis thaliana. II. Effects of brassinosteroids on microtubules and cell elongation in the bul1 mutant. Planta 212,673 -683.[CrossRef][Medline]
de Veylder, L., Segers, G., Glab, N., van Montagu, M. and Inze,
D. (1997). Identification of proteins interacting with the
Arabidopsis Cdc2aAt protein. J. Exp. Bot.
48,2111
-2112.
Frey-Wyssling, A. (1959). Die Pflanzliche Zellwand. Springer-Verlag, Berlin-Göttingen-Heidelberg.
Harberd, N. P., King, K. E., Carol, P., Cowling, R. J., Peng, J. and Richards, D. E. (1998). Gibberellin: inhibitor of an inhibitor of...? BioEssays 20,1001 -1008.[CrossRef][Medline]
Hartman, J. J., Mahr, J., McNally, K., Okawa, K., Iwamatsu, A., Thomas, S., Cheesman, S., Heuser, J., Vale, R. D. and McNally, F. J. (1998). Katanin, a microtubule-severing protein, is a novel AAA ATPase that targets to the centrosome using a WD40-containing subunit. Cell 93,227 -287.
Hartman, J. J. and Vale, R. D. (1999).
Microtubule disassembly by ATP-dependant oligomerization of the AAA enzyme
katanin. Science 286,782
-785.
Hemsley, R., McCutcheon, S., Doonan, J. and Lloyd, C. (2001). P34cdc2 kinase is associated with cortical microtubules from higher plant protoplasts. FEBS Lett. 508,157 -161.[CrossRef][Medline]
Inada, S. and Shimmen, T. (2000). Regulation of
elongation growth by gibberellin in root segments of Lemma minor.
Plant Cell Physiol. 41,932
-939.
Ishida, K. and Katsumi, M. (1992). Effect of gibberellin and abscissic acid on the cortical microtubule orientation in hypocotyl cells of light-grown cucumber seedlings. Int. J. Plant Sci. 153,155 -163.[CrossRef]
Koornneef, M. and van der Veen, J. H. (1980). Induction and analysis of gibberellin sensitive mutants in Arabidopsis thaliana (L.) Heynh. Theor. Appl. Genet. 58,257 -263.[CrossRef]
Kost, B., Spielhofer, P. and Chua, N.-H. (1998). A GFP-mouse talin fusion protein labels plant actin filaments in vivo and visualizes the actin cytoskeleton in growing pollen tubes. Plant J. 16,393 -401.[CrossRef][Medline]
Kost, B., Mathur, J. and Chua, N.-H. (1999). Cytoskeleton in plant development. Curr. Opin. Plant Biol. 2,462 -472.[CrossRef][Medline]
Kurz, T., Pintard, L., Willis, J. H., Hamill, D. R., Gonczy, P.,
Peter, M. and Bowerman, B. (2002). Cytoskeletal regulation by
the Nedd8 ubiquitin-like protein modification pathway.
Science 295,1294
-1298.
Marc, J., Granger, C. L., Brincat, J., Fisher, D. D., Kao, T.,
McCubbin, A. G. and Cyr, R. J. (1998). A GFP-MAP4 reporter
gene for visualizing cortical microtubule rearrangements in living epidermal
cells. Plant Cell 10,1927
-1940.
Mathur, J. and Chua, N.-H. (2000). Microtubule
stabilization leads to growth reorientation in Arabidopsis trichomes.Plant Cell 12,465
-477.
McClinton, R. S., Chandler, J. S. and Callis, J. (2001). cDNA isolation, characterization, and protein intracellular localization of a katanin-like p60 subunit from Arabidopsis thaliana. Protoplasma 216,181 -190.[Medline]
McNally, K. P., Bazirgan, O. A. and McNally, F. J. (2000). Two domains of p80 katanin regulate microtubule severing and spindle pole targeting by p60 katanin. J. Cell Sci. 113,1623 -1633.[Abstract]
Meier, C., Bouquin, T., Nielsen, M. E., Raventos, D., Mattsson, O., Rocher, A., Schomburg, F., Amasino, R. M. and Mundy, J. (2001). Gibberellin response mutants identified by luciferase imaging. Plant J. 25,509 -519.[CrossRef][Medline]
Nicol, F., His, I., Jaunau, A., Vernhettes, S., Canut, H. and Hofte, H. (1998). A plasma membrane-bound putative endo-1,4-beta-D-glucanase is required for normal wall assembly and cell elongation in Arabidopsis. EMBO J. 17,5563 -5576.[CrossRef][Medline]
Richards, D. E., Peng, J. and Harberd, N. P. (2000). Plant GRAS and metazoan STATs: one family? BioEssays 22,573 -577.[CrossRef][Medline]
Shibaoka, H. (1994). Plant hormone-induced changes in the orientation of cortical microtubules. Annu. Rev. Plant Physiol. Plant Mol. Biol. 45,527 -544.
Silverstone, A. L., Jung, H. S., Dill, A., Kawaide, H., Kamiya,
Y. and Sun, T. P. (2001). Repressing a repressor:
gibberellin-induced rapid reduction of the RGA protein in Arabidopsis.Plant Cell 13,1555
-1566.
Smalle, J., Haegman, M., Kurepa, J., van Montagu, M. and
Straeten, D. V. (1997). Ethylene can stimulate
Arabidopsis hypocotyl elongation in the light. Proc. Natl.
Acad. Sci. USA 94,2756
-2761.
Stoppin-Mellet, V., Gaillard, J. and Vantard, M. (2002). Functional evidence for in vitro microtubule severing by the plant katanin homolog. Biochem. J. 365,337 -342.[CrossRef][Medline]
Thornton, T. M., Swain, S. M. and Olszewski, N. E. (1999). Gibberellin signal transduction presents...the SPY who O-GlcNAc'd me. Trends Plant Sci. 4, 424-428.[CrossRef][Medline]
Wasteneys, G. O. (2002). Microtubule
organization in the green kingdom: chaos or self-order? J. Cell
Sci. 115,1345
-1354.
Webb, M., Jouannic, S., Foreman, J., Linstead, P. and Dolan,
L. (2002). Cell specification in the Arabidopsis
root epidermis requires the activity of ECTOPIC ROOT HAIR 3-a katanin-p60
protein. Development
129,123
-131.
Weingartner, M., Binarova, P., Drykova, D., Schweighofer, A.,
David, J. P., Heberle-Bors, E., Doonan, J. and Bogre, L.
(2001). Dynamic recruitment of Cdc2 to specific microtubule
structures during mitosis. Plant Cell
13,1929
-1943.
Wells, L., Vosseller, K. and Hart, G. W.
(2001). Glycosylation of nucleocytoplasmic proteins: signal
transduction and O-GLcNAc. Science
291,2376
-2378.
Wenzel, C. L., Williamson, R. E. and Wasteneys, G. O.
(2000) Gibberellin-induced changes in growth anisotropy precede
gibberellin-dependent changes in cortical microtubule orientation in
developing epidermal cells of barley leaves. Kinematic and cytological studies
on a gibberellin-responsive dwarf mutant, M489. Plant
Physiol. 124,813
-822.
Whittington, A. T., Vugrek, O., Wei, K. J., Hasenbein, N. G., Sugimoto, K., Rashbrooke, M. C. and Wasteneys, G. O. (2001). MOR1 is essential for organizing cortical microtubules in plants. Nature 411,610 -613.[CrossRef][Medline]
Zandomeni, K. and Schopfer, P. (1993). Reorientation of microtubules at the outer epidermal wall of maize coleoptiles by phytochrome, blue light photoreceptor and auxin. Protoplasma 173,103 -112.[CrossRef]
Zandomeni, K. and Schopfer, P. (1994). Mechanosensory microtubule reorientation in the epidermis of maize coleoptiles subjected to bending stress. Protoplasma 182,96 -101.[CrossRef][Medline]
Zuo, J., Niu, Q. W., Nishizawa, N., Wu, Y., Kost, B. and Chua,
N.-H. (2000). KORRIGAN, an Arabidopsis
endo-1,4-beta-glucanase, localizes to the cell plate by polarized targeting
and is essential for cytokinesis. Plant Cell
12,1137
-1152.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
M. Nakamura and T. Hashimoto A mutation in the Arabidopsis {gamma}-tubulin-containing complex causes helical growth and abnormal microtubule branching J. Cell Sci., July 1, 2009; 122(13): 2208 - 2217. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Guo, C.-M. K. Ho, Z. Kong, Y.-R. J. Lee, Q. Qian, and B. Liu Evaluating the microtubule cytoskeleton and its interacting proteins in monocots by mining the rice genome Ann. Bot., February 1, 2009; 103(3): 387 - 402. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-L. Xu, A. Rahman, T. I. Baskin, and J. J. Kieber Two Leucine-Rich Repeat Receptor Kinases Mediate Signaling, Linking Cell Wall Biosynthesis and ACC Synthase in Arabidopsis PLANT CELL, November 1, 2008; 20(11): 3065 - 3079. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Brodersen, L. Sakvarelidze-Achard, M. Bruun-Rasmussen, P. Dunoyer, Y. Y. Yamamoto, L. Sieburth, and O. Voinnet Widespread Translational Inhibition by Plant miRNAs and siRNAs Science, May 30, 2008; 320(5880): 1185 - 1190. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Buck-Sorlin, R. Hemmerling, O. Kniemeyer, B. Burema, and W. Kurth A Rule-based Model of Barley Morphogenesis, with Special Respect to Shading and Gibberellic Acid Signal Transduction Ann. Bot., May 1, 2008; 101(8): 1109 - 1123. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Bartolini and G. G. Gundersen Generation of noncentrosomal microtubule arrays J. Cell Sci., October 15, 2006; 119(20): 4155 - 4163. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yasuor, M. Abu-Abied, E. Belausov, A. Madmony, E. Sadot, J. Riov, and B. Rubin Glyphosate-Induced Anther Indehiscence in Cotton Is Partially Temperature Dependent and Involves Cytoskeleton and Secondary Wall Modifications and Auxin Accumulation Plant Physiology, August 1, 2006; 141(4): 1306 - 1315. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lee, S. Lee, K.-Y. Yang, Y.-M. Kim, S.-Y. Park, S. Y. Kim, and M.-S. Soh Overexpression of PRE1 and its Homologous Genes Activates Gibberellin-dependent Responses in Arabidopsis thaliana Plant Cell Physiol., May 1, 2006; 47(5): 591 - 600. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nakajima, T. Kawamura, and T. Hashimoto Role of the SPIRAL1 Gene Family in Anisotropic Growth of Arabidopsis thaliana Plant Cell Physiol., April 1, 2006; 47(4): 513 - 522. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhang, P. H. Grey, S. Krishnakumar, and D. G. Oppenheimer The IRREGULAR TRICHOME BRANCH loci regulate trichome elongation in Arabidopsis Plant Cell Physiol., September 1, 2005; 46(9): 1549 - 1560. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Komorisono, M. Ueguchi-Tanaka, I. Aichi, Y. Hasegawa, M. Ashikari, H. Kitano, M. Matsuoka, and T. Sazuka Analysis of the Rice Mutant dwarf and gladius leaf 1. Aberrant Katanin-Mediated Microtubule Organization Causes Up-Regulation of Gibberellin Biosynthetic Genes Independently of Gibberellin Signaling Plant Physiology, August 1, 2005; 138(4): 1982 - 1993. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. O. Wasteneys and Z. Yang New Views on the Plant Cytoskeleton Plant Physiology, December 1, 2004; 136(4): 3884 - 3891. [Full Text] [PDF] |
||||
![]() |
T. Shoji, N. N. Narita, K. Hayashi, J. Asada, T. Hamada, S. Sonobe, K. Nakajima, and T. Hashimoto Plant-Specific Microtubule-Associated Protein SPIRAL2 Is Required for Anisotropic Growth in Arabidopsis Plant Physiology, December 1, 2004; 136(4): 3933 - 3944. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Dixit and R. Cyr The Cortical Microtubule Array: From Dynamics to Organization PLANT CELL, October 1, 2004; 16(10): 2546 - 2552. [Full Text] [PDF] |
||||
![]() |
E. E. Dymek, P. A. Lefebvre, and E. F. Smith PF15p Is the Chlamydomonas Homologue of the Katanin p80 Subunit and Is Required for Assembly of Flagellar Central Microtubules Eukaryot. Cell, August 1, 2004; 3(4): 870 - 879. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Naoi and T. Hashimoto A Semidominant Mutation in an Arabidopsis Mitogen-Activated Protein Kinase Phosphatase-Like Gene Compromises Cortical Microtubule Organization PLANT CELL, July 1, 2004; 16(7): 1841 - 1853. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Vanstraelen, J. A. Torres Acosta, L. De Veylder, D. Inze, and D. Geelen A Plant-Specific Subclass of C-Terminal Kinesins Contains a Conserved A-Type Cyclin-Dependent Kinase Site Implicated in Folding and Dimerization Plant Physiology, July 1, 2004; 135(3): 1417 - 1429. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nakajima, I. Furutani, H. Tachimoto, H. Matsubara, and T. Hashimoto SPIRAL1 Encodes a Plant-Specific Microtubule-Localized Protein Required for Directional Control of Rapidly Expanding Arabidopsis Cells PLANT CELL, May 1, 2004; 16(5): 1178 - 1190. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lu, M. Srayko, and P. E. Mains The Caenorhabditis elegans Microtubule-severing Complex MEI-1/MEI-2 Katanin Interacts Differently with Two Superficially Redundant {beta}-Tubulin Isotypes Mol. Biol. Cell, January 1, 2004; 15(1): 142 - 150. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||