|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
doi: 10.1242/10.1242/jcs.00334
Research Article |
1 Program in Developmental Biology, Baylor College of Medicine, Houston, TX
77030, USA
2 Department of Biochemistry and Molecular Biology, University of Texas M.D.
Anderson Cancer Center, Houston, TX 77030, USA
3 Department of Molecular and Cellular Biology, Baylor College of Medicine,
Houston, TX 77030, USA
* Author for correspondence (e-mail: jrosen{at}bcm.tmc.edu)
Accepted 23 December 2002
| Summary |
|---|
|
|
|---|
Key words: ß-catenin, Wnt, Mammary gland, Apoptosis, Lobular
| Introduction |
|---|
|
|
|---|
Distinct developmental stages, defined primarily by morphology, but also by
differential gene expression, exist in the mammary gland. At birth, the
mammary gland is composed of a few rudimentary epithelial ducts surrounded by
the fat pad. On sexual maturity, the ductal epithelium begins to grow out into
the fat pad, creating branched tree-like ductal structures that extend to the
edges of the fat pad, while maintaining extensive interductal space. Systemic
hormonal changes, as well as localized gene expression associated with
pregnancy, trigger additional branching and lobuloalveolar growth of the
epithelium to fill in the interductal space. Lobuloalveolar development
continues throughout pregnancy and lactation, at which time the fat pad is
virtually filled with polarized epithelium. The lobuloalveolar clusters
differentiate into milk-producing units that secrete milk proteins and lipids
into the lumen during lactation. On weaning, the mammary lobuloalveolar cells
undergo apoptosis during involution, returning to a state that is
morphologically, but not genetically, similar to the virgin gland (reviewed by
Daniel and Silberstein,
1987
).
The Wnt (wingless) genes, first identified as mouse
mammary oncogenes (Nusse and Varmus,
1982
), encode a family of secreted glycoproteins that have been
well characterized for their roles in vertebrate and invertebrate development
(reviewed by Huelsken and Birchmeier,
2001
). However, a complete functional study of the Wnt genes in
the mammary gland has been hindered by the multiplicity of expression of
numerous Wnt family members and their essential role in early embryonic
development. The Wnts are involved in many aspects of vertebrate embryonic
development, including axis formation in Xenopus, myogenesis and
neural induction (reviewed by Moon et al.,
1997
). Germline deletion of most Wnts results in early embryonic
lethality (McMahon and Bradley,
1990
), so analysis of the role of specific Wnts in postnatal
mammary gland development has not been evaluated. However, a role for Wnt-4
has been suggested by rescue of Wnt-4-null mammary epithelial cells (MECs) by
transplantation into the cleared fat pads of wild-type recipients
(Brisken et al., 2000
). In
these studies, a delay in lobuloalveolar development was observed at
mid-pregnancy, but by day 1 of lactation no differences were observed between
the outgrowths of wild-type and Wnt-4 null MECs, presumably because of
compensation by other family members. This problem of Wnt redundancy has been
addressed in the current study by examining the requirement for
ß-catenin-mediated signalling as a convergence point for the canonical
Wnt signal transduction pathway.
ß-catenin, the vertebrate orthologue of Drosophila Armadillo
(McCrea et al., 1991
;
Peifer et al., 1991
), is a
multifunctional protein, characterized by a stretch of arm repeats that are
the sites of multiple protein-protein interactions
(Huber et al., 1997
;
Peifer et al., 1994
).
ß-catenin binds to E-cadherin at the adherens junctions, modulates
cadherin-dependent cell-cell adhesion
(Barth et al., 1997
;
Steinberg and McNutt, 1999
)
and links the cadherin/catenin complex to the cortical actin cytoskeleton
through the binding of
-catenin
(Herrenknecht et al., 1991
;
Nagafuchi and Tsukita, 1994
).
Additionally, ß-catenin plays a crucial role in the canonical Wnt
signalling cascade. The intracellular Wnt signal is propagated from the
membrane through Dishevelled (Yanagawa et
al., 1995
) to downregulate glycogen synthase kinase-3ß
(GSK-3ß) and subsequently disrupt a protein complex that includes
GSK-3ß, adenomatous polyposis coli (APC), axin, and members of the
ubiquitination/proteasome pathway
(Easwaran et al., 1999a
;
Ikeda et al., 1998
;
Kikuchi, 1999
;
Kishida et al., 1998
;
Rubinfeld et al., 1996
;
Salomon et al., 1997
).
Disruption of this complex prevents the GSK-3ß-dependent phosphorylation
of ß-catenin on specific N-terminal serine and threonine residues, and
thus protects ß-catenin protein from degradation through
ubiquitin-mediated proteolysis (Easwaran
et al., 1999a
; Rubinfeld et
al., 1996
). The stabilized ß-catenin protein can then be
transported to the nucleus where it forms complexes with members of the T-cell
factor (TCF)/Lef family of HMG-box transcription factors
(Behrens et al., 1996
;
Huber et al., 1996
;
Molenaar et al., 1996
).
Together, ß-catenin and TCF proteins comprise a bipartite transcripton
factor in which TCF supplies the DNA binding moiety and ß-catenin
provides the transactivation domain (reviewed by
Barker et al., 2000
). This
complex activates the transcription of target genes and, in some cases,
relieves the repression activity of TCF alone (reviewed by
Bienz, 1998
). Thus,
ß-catenin plays crucial roles in both epithelial cell-cell adhesion, as
well as in signal transduction.
Additionally, ß-catenin is a point of intersection and integration of
several other signalling pathways. For example, the retinoic acid receptor RAR
binds to ß-catenin in a retinoic acid ligand-dependent manner, not only
sequestering ß-catenin away from Tcf/Lef and downregulating transcription
of their target genes, but also potentially using ß-catenin to upregulate
genes responsive to retinoic acid signalling
(Easwaran et al., 1999b
).
ß-catenin may also be a site of cross-talk with the transforming growth
factor-ß (TGF-ß) signalling network. One mediator of the TGF-ß
signal, Smad4, binds to the HMG-box sequence of Lef-1 and forms a complex with
ß-catenin that binds promoters containing dual recognition sequences. The
presence of Smad4 in this transcriptional complex is required for the
transactivation of several Xenopus Wnt/ß-catenin target genes,
including twin, siamois and nodal-related-3
(Nishita et al., 2000
).
Therefore, the current study analyses the signalling function of
ß-catenin, a diverse protein that integrates several molecular
signals.
Previous characterization of ß-catenin function in vivo in the mammary
gland has included gain-of-function studies using either transgenic
overexpression of stabilized ß-catenin or stabilization of the endogenous
ß-catenin protein through whey acidic protein (WAP)-Cre-mediated
recombination. Transgenic overexpression of ß-catenin in the mammary
gland results in precocious lobular development in both male and female mice
(Imbert et al., 2001
), lack of
complete involution (Imbert et al.,
2001
) and mammary gland hyperplasias and adenocarcinomas
(Imbert et al., 2001
;
Michaelson and Leder, 2001
).
Stabilization of the endogenous ß-catenin protein in the mammary gland
leads to putative dedifferentiation of the alveolar epithelium and
transdifferentiation of these cells into epidermal and pilar structures,
suggesting that the suppression of ß-catenin signalling is required for
proper differentiation into secretory epithelial cells
(Miyoshi et al., 2002
).
Although these phenotypes from gain-of-function experiments probably result
from the transactivation of target genes in the ß-catenin signalling
cascade, the differential contributions of ß-catenin in normal
lobuloalveolar development through its role in adhesion versus signalling have
not been directly addressed.
Previous studies in Xenopus have successfully isolated
ß-catenin's signalling function from its role in cell-cell adhesion
through the use of a dominant negative mutant, ß-eng
(Montross et al., 2000
). In
this mutant, the carboxy-terminal region of ß-catenin, the region largely
responsible for ß-catenin's transactivation activity, has been replaced
with the active repressor domain from Drosophila Engrailed
(Jaynes and O'Farrell, 1991
;
Smith and Jaynes, 1996
).
Dorsal overexpression of ß-eng in Xenopus embryos results in
ventralization of the embryos and suppression of Wnt signalling target genes.
However, ß-eng associates and functions normally with members of the
cadherin complex, as shown by immunoprecipation and cellular adhesion assays.
Thus, ß-eng successfully represses endogenous ß-catenin signalling
without perturbing its cell-cell adhesion function
(Montross et al., 2000
).
In an effort to directly analyse the role of ß-catenin signalling in the developing mammary gland, ß-eng was expressed as a transgene preferentially in the mouse mammary gland. Both in vivo transgenic models and in vitro cell culture experiments revealed that, in response to ß-eng expression, apoptosis was induced in mammary epithelial cells and lobuloalveolar development of the mammary gland was severely compromised. Thus, these experiments have shown that ß-catenin signalling provides a survival signal in mammary precursor cells that is required for normal lobuloalveolar development.
| Materials and Methods |
|---|
|
|
|---|
Transgene construction
The rat WAP promoter fragment from 949 to +1 and the WAP 5'
UTR from +1 to +33 (Li et al.,
1994
) was cloned into the KCR vector (kindly provided by Franco
DeMayo, Baylor College of Medicine), which contains a rabbit ß-globin
intron and bovine growth hormone polyadenylation sequence. The ß-eng
mutant was excised from the pcDNA3 vector using PmeI and cloned into
the blunted EcoRI site of WAP-KCR between the intronic and
polyadenylation sequences (WBK construct). In a similar manner, ß-eng was
cloned into the mouse mammary tumour virus (MMTV)-KCR vector (kindly provided
by Steven Chua in the laboratory of Sophia Tsai, Baylor College of Medicine),
which contains a 2.3 kb fragment of the MMTV long terminal repeat upstream of
the KCR sequences (Muller et al.,
1988
) (MBK construct). Both transgenic constructs were excised
using BssHII, purified by gel electrophoresis, and injected into the
fertilized eggs of FVB mice by the Transgenic Core, Baylor College of
Medicine, supervised by Franco DeMayo. Four transgenic lines were generated:
MBK6322, MBK6323, WBK6414 and WBK6426.
Mammary gland morphology and histology
The use of all animals on this project was within the provisions of the
Public Health Service animal welfare policy, the principles of the Guide for
the Care and Use of Laboratory Animals and the policies and procedures of
Baylor College of Medicine as approved by the Baylor Subcommittee for Animal
Use. Mammary glands were removed at specific developmental time-points during
pregnancy (days post coitus), as verified by staging the embryos. For each
animal, one #4 inguinal gland was cut in half lengthwise, and each piece was
spread on waxed paper and fixed in fresh 4% paraformaldehyde on ice for 2
hours. One half of each fixed #4 inguinal gland was whole-mounted and stained
with hematoxylin as previously described
(Williams and Daniel, 1983
);
the other half was paraffin-embedded and 5 µm sections were stained with
hematoxylin and eosin. The remaining mammary glands were harvested and flash
frozen for RNA and protein extraction. At least three animals were analysed
per developmental time-point.
Immunohistochemical analysis of transgene expression was accomplished as
follows: following antigen retrieval as described previously
(Seagroves et al., 2000
),
endogenous peroxidase activity was quenched by soaking slides in 3%
H2O2 in MeOH for 5 minutes at room temperature. Sections
were then incubated overnight in Mouse on Mouse (MOM) block (Vector
Laboratories). Primary monoclonal antibody raised against the myc epitope
(clone 9E10) was applied to sections for 4 hours, followed by horseradish
peroxidase (HRP)-conjugated goat-anti-mouse secondary antibody (Jackson
Laboratories) for 1 hour. The peroxidase reaction was developed using the
3,3'-diaminobenzidine substrate in the DAB system (Vector Laboratories),
and sections were counterstained with methyl green.
Proliferation and apoptosis assays
Proliferation assays were performed as described previously by monitoring
the incorporation of bromodeoxyuridine (BrdU) injected 2 hours before
sacrifice (Seagroves et al.,
1998
). Proliferating cells were quantitated as the number of
FITC-labelled (i.e. BrdU-incorporated) cells out of the total DAPI-stained
nuclei.
Fixed, paraffin-embedded glands were sectioned and analysed for apoptosis
by immunofluorescent terminal deoxynucleotidyl transferase-mediated dUTP nick
end labelling (TUNEL) as described previously
(Humphreys et al., 1996
). For
both proliferation and apoptosis assays, only luminal epithelial cells were
included in these counts, as this is the expected location of transgene
expression (Li et al., 1994
).
At least 2000 cells from two to three animals were counted for each group at
each time-point.
Retroviral infection and analysis of HC11 cells
Stabilized ß-catenin (Montross et
al., 2000
) and ß-eng constructs were cloned into the pS2
retroviral backbone (kindly provided by Aguilar-Cordova, Baylor College of
Medicine) (Faustinella et al.,
1994
). 293T cells (ATCC) grown in Dulbecco's modified Eagles'
medium (JRH Biosciences) supplemented with 10% fetal bovine serum (JRH
Biosciences), 2 mM glutamine (Sigma), and 0.05 mg/ml gentamycin (Sigma) were
used as packaging cells by transiently transfecting pS2-ß-cat or
pS2-ß-eng with pCL-Eco construct (Imgenex Corp.). Transfection was
accomplished using FuGene (Roche) according to the manufacturer's
guidelines.
HC11 cells were plated on serum-coated glass coverslips (Fisher) in 100 mm tissue culture plates. Forty-eight hours after transfection, medium was collected from transfected 293T cells, filtered through 0.22 µm syringe filter, and applied to HC11 cells in a 1:1 ratio (1 plate 293T to 1 plate HC11). HC11 cells were spun at 3,000 g in a Marathon 6K clinical centrifuge (Fisher Scientific) on a swinging platform rotor for 30 minutes. Retroviral medium was removed from HC11 cells and replaced with RPMI (JRH Biosciences) supplemented with 10% fetal bovine serum, 2 mM glutamine (Sigma), 0.05 mg/ml gentamycin (Sigma), 5 µg/ml insulin (Sigma), and 0.01 µg/ml epidermal growth factor (Invitrogen). HC11 cells were grown for 48 hours after infection before harvesting. Coverslips were removed and fixed as described below, and the remaining cells on the plate were scraped into Hanks' Balanced Salt Solution (HBSS; JRH Biosciences), pelleted and flash frozen.
HC11 cells grown on coverslips and infected with pS2-ß-cat or pS2-ß-eng were fixed in fresh 4% paraformaldehyde for 30 minutes at 4°C, rinsed in PBS, and washed in PEM buffer (80 mM PIPES, 1 mM MgCl2, and 1 mM EGTA). Cells were quenched of background autofluorescence by incubation with 1 mg/ml NaBH4 in PEM buffer for 5 minutes and then permeabilized with PEM buffer supplemented with 0.2% Triton X-100 for 20 minutes. TUNEL analysis was performed by incubating cells for 45 minutes at 37°C with 1 mM ChromaTideTM Alexa Fluor® 488-5-dUTP (Molecular Probes) and components of the TdT Terminal Transferase Kit (Roche) according to manufacturer's instructions. Cells were then blocked overnight in TBS + 1% Tween supplemented with 5% dry milk and 1% bovine serum albumin (Sigma). Primary monoclonal antibody raised against the myc epitope (clone 9E10) was diluted 1:100 in blocking solution and incubated on cells for 1 hour. Secondary antibody, goat-anti-mouse conjugated to Texas Red (Molecular Probes), was diluted 1:600 in blocking solution and incubated with cells for 1 hour. Cells were then washed in TBST and mounted on slides with Vectashield containing DAPI (Vector Laboratories). The number of Alexa-488-positive cells out of total DAPI-stained nuclei was determined, and at least 10,000 cells per group were counted.
Western blotting and antibodies
HC11 cells were infected with ß-catenin or ß-eng, scraped and
flash frozen, and western blot analysis was performed as described previously
(Montross et al., 2000
;
Welm et al., 2002
). Antibodies
were used at the following dilutions: 9E10 anti-myc antibody at 1:1000,
rabbit-anti-ß-catenin antibody (raised against the N-terminal region of
ß-catenin) (McCrea et al.,
1993
) at 1:2,000, rabbit-anti-pAKT (Cell Signaling) at 1:500,
rabbit-anti-AKT (Cell Signaling) at 1:500, goat-anti-mouse-HRP (Jackson
Laboratories), and goat-anti-rabbit-HRP (Jackson Laboratories). Quantitation
was performed by densitometric scanning of western blots using a Molecular
Dynamics densitometer with the ImageQuant software.
RT-PCR analysis of CD44 and ITF-2 mRNAs
mRNA was extracted from cells using RNAzol (Tel-Test) according to the
manufacturer's instructions, and RT-PCR was performed on 500 ng RNA per
reaction using the SuperScript One-Step RT-PCR kit (Invitrogen). Twenty-two
cycles of PCR were performed under the following conditions: 94°C for 30
seconds, 56°C for 60 seconds, 72°C for 60 seconds. Primers sequences
were as follows: CD44-2077: 5'tggatccgaattagctg, CD44-2434:
5'ggcactacaccccaatcttc, ITF2-F1: 5'ccaccccaagacccttacag, ITF2-R1:
5'gctccttgaaagcctcgttg, L19F: 5'ctgaaggtcaaagggaatgtg; L19R:
5'ggacagagtcttgatgatctc. Aliquots were removed from the PCR reaction
after completion of 18, 20 and 22 cycles. Each reaction was accompanied by a
counterpart reaction with no reverse transcriptase to control for genomic DNA
contamination. Quantitation of PCR product bands in ethidium
bromide-containing agarose gel was accomplished using Kodak 1D 3.5 USB imaging
software.
| Results |
|---|
|
|
|---|
|
Generation of transgenic mice
To study the effects of ß-catenin signalling specifically on mammary
gland development, transgenic mice were generated expressing ß-eng under
two mammary-specific promoters (Fig.
1D). The ß-eng construct is composed of the amino-terminal
region and armadillo repeats of Xenopus ß-catenin fused to the
active repressor domain of Drosophila Engrailed
(Montross et al., 2000
). This
dominant negative ß-catenin construct was cloned into mammary-specific
expression vectors containing the MMTV long terminal repeat or the WAP
promoter (Campbell et al.,
1984
; Li et al.,
1994
), both of which have been used extensively to drive
mammary-specific transgene expression during pregnancy and lactation
(Li et al., 1994
;
Ma et al., 1999
;
Muller et al., 1990
;
Muller et al., 1988
;
Zahnow et al., 2001
). Both
constructs included an intron isolated from the rabbit ß-globin gene
cloned 5' to the ß-eng insert and a polyA sequence isolated from
bovine growth hormone. Previous experiments indicated the necessity of placing
the globin intron 5' to the large (3.3 kb) cDNA insert, presumably to
ensure that the cDNA was recognized as a terminal exon to facilitate transgene
expression (data not shown). Thus, these transgenic constructs were designed
to express the ß-eng mutant preferentially in the mammary gland.
The MMTV-ß-eng (MBK) and WAP-ß-eng (WBK) transgene constructs were microinjected into embryos, and five independent founder lines were identified by PCR screening of genomic DNA (data not shown). One of the five lines did not transmit the transgene to its progeny, so the remaining four lines were characterized for expression and phenotype. Two of these four lines expressed ß-eng under the MMTV-LTR, whereas two carried the WAP-driven transgene. After morphological characterization of these four lines, the conclusion was drawn that all four lines displayed the phenotype described below, regardless of the promoter driving expression or insertion site of the transgene. Therefore, for simplicity, further description of these mice will refer to transgenic or wild type, regardless of the transgenic line.
Decreased lobuloalveolar development in ß-eng transgenic mammary
glands
Mammary gland morphology was analysed in detail in the transgenic and
wild-type mice during mid-pregnancy and lactation and compared with transgene
expression (Fig. 2). Although
the overall reduction in lobuloalveolar development was similar in all four
MMTV- and WAP-driven transgenic lines, the extensive characterization of
developmental expression pattern and phenotype in the two WAP-driven
transgenic lines is described. At day 10 of pregnancy (10P)
(Fig. 2A,A') and 12P
(Fig. 2B,B'), transgenic
mammary epithelium (Fig. 2A,B)
was morphologically indistinguishable from wild-type littermates
(Fig. 2A',B'). By 16P
(Fig. 2C,C'), a reduction in
lobuloalveolar clusters could be detected in transgenic glands
(Fig. 2C) compared with
wild-type littermates (Fig.
2C').
|
Expression of the WAP-driven transgene is expected to markedly increase,
beginning at around 10P with the increase in lactogenic hormones and extending
through day 10 of lactation (Bayna and
Rosen, 1990
; Dale et al.,
1992
). Using an antibody against the myc-epitope tag in the
transgenic construct, WAP-driven-ß-eng expression was analysed at 10P
(Fig. 2D,D'), 12P
(Fig. 2E,E') and 16P
(Fig. 2F,F'). ß-eng
transgene expression was detected at 10P
(Fig. 2D) in lobular epithelium
of the transgenic mice, but not in wild-type littermates
(Fig. 2D'). In addition,
expression was nonuniform, similar to the pattern of other transgenes driven
from the same promoter (Li et al.,
1994
); some lobular clusters contained a few expressing cells,
whereas some clusters failed to express the transgene. Overall, it was
estimated that less than 50% of the lobular epithelial cells expressed the
transgene at 10P. At 12P, transgene expression could be detected in transgenic
mice (Fig. 2E), but only in a
punctate pattern associated with fragmented, apoptotic bodies that had largely
been cleared from the gland. No such antibody-reactive cellular debris was
detected in wild-type littermates (Fig.
2E'), as the only signal detected was an artefact, resulting from
antibody trapping in blood vessels (arrows). By 16P, no transgene expression
could be detected in the mammary glands of transgenic
(Fig. 2F) or wild-type mice
(Fig. 2F').
At day 1 of lactation (Fig. 2G-L (transgenic), Fig. 2G'-L' (wild type)), the reduction in overall epithelial content was marked in all four transgenic lines, as illustrated at low magnification (Fig. 2G,G'), higher magnification (Fig. 2H,H') and strikingly by whole-mount hematoxylin staining (Fig. 2I,I'). Higher magnification (Fig. 2H,H') showed that the existing epithelium appeared morphologically normal, with organized, albeit fewer, alveolar clusters. Transgenic females from all four lines also failed to support their litters; all pups died within 12 hours after birth with no milk in their stomachs, but survived and developed normally when fostered by a wild-type female (data not shown) Additionally, multiple rounds of pregnancy failed to rescue this phenotype, as transgenic females continued to be unable to support a litter (data not shown). Thus, expression of ß-eng in the mammary gland during pregnancy markedly inhibited lobuloalveolar development, such that insufficient milk was produced to nurture the offspring.
Interestingly, transgene expression is detected for only a small window of time (10P-12P), during which the morphology of the gland appears normal. By day 16 of pregnancy, there appears a distinguishable reduction in the overall amount of epithelium in the transgenic gland (Fig. 2C,C'), and higher magnification of the 16P transgenic gland reveals that persisting epithelium appears morphologically normal, with properly organized alveolar clusters, yet does not express the transgene (Fig. 2F,F'). The lower magnification images shown in Fig. 2G-I compared with their wild-type littermates shown in Fig. 2G'-I' illustrate that this overall reduction in epithelium is amplified through lactation. This unusual temporal relationship of the expected transgene expression (10P through lactation), detected transgene expression (10-12P) and morphological phenotype (16P-lactation) will be discussed later in the manuscript.
Reduced proliferation and increased apoptosis in ß-eng
transgenic mice
In an effort to understand the factors contributing to the lack of lobular
structures, proliferation and apoptosis were analysed in the mammary glands
from transgenic mice and their paired wild-type littermates
(Fig. 3) during the time of
early transgene expression. Bromodeoxyuridine (BrdU) incorporation was
analysed as a measure of MECs entering S phase in wild-type
(Fig. 3A) and transgenic
(Fig. 3B) mice at days 10-13 of
pregnancy. Mid-pregnancy is a time of extensive proliferation in the normal
mammary epithelium, and levels of proliferation were decreased approximately
twofold in the MECs of ß-eng transgenic compared with wild-type mice
during this time of development (Fig.
3C). Apoptosis during this time of extensive growth and
differentiation of the mammary gland is usually barely detectable. TUNEL
analysis of wild-type (Fig. 3D)
and transgenic (Fig. 3E)
epithelium revealed approximately a fivefold increase in apoptosis in the
transgenic animals (Fig. 3F). The cells undergoing apoptosis were localized to specific lobuloalveolar
clusters (Fig. 3E), rather than
distributed sporadically around the gland, and these clusters correlated with
regions of transgene expression (data not shown). These data suggest that the
lack of lobular epithelium observed later in development resulted from a small
(twofold) decrease in proliferation, as well as a marked (fivefold) increase
in apoptosis during mid-pregnancy in the transgenic mice.
|
As mentioned previously, transgenes driven by the WAP promoter are expected to show increased expression, beginning at around 10P and continuing throughout pregnancy and early lactation. However, transgene expression was only detected from 10-12P in ß-eng transgenic mice, at which time the transgene-expressing cells underwent programmed cell death, and the transgene could no longer be detected at later stages of development in the surviving mammary epithelium. This brief window of expression in fewer than 50% of epithelial cells appeared to result in almost immediate apoptosis, which posed a significant challenge for further studies to characterize the mechanisms responsible for these effects. Therefore, a MEC culture model derived from mid-pregnant mice was selected that could be used to further elucidate the role of ß-catenin signalling in the mammary gland.
HC11 cells are derived from normal, mid-pregnant MECs
(Ball et al., 1988
), and,
unlike many other MEC lines, they maintain a somewhat `normal' epithelial
phenotype. HC11 cells can be induced with lactogenic hormones to express
ß-casein. In addition, they occasionally form limited alveolar-like
structures when transplanted back into the cleared fat pad, and when grown at
confluence, they display clear E-cadherin staining around the cell periphery
(Humphreys and Rosen, 1997
).
Therefore, HC11 cells were selected as an in vitro model system in which to
study the effects of ß-eng signalling in the mammary gland.
ß-eng induces apoptosis in HC 11 cells
HC11 cells were retrovirally infected with either stabilized ß-catenin
(gain-of-function) or ß-eng (dominant negative loss-of-function), and
apoptosis was analysed by immunofluorescent TUNEL assay 48 hours after
infection (Fig. 4). This
time-point was selected as the optimum time after infection at which to allow
appropriate transgene integration and expression without completely losing the
pool of expressing cells to apoptosis. The levels of apoptosis were extremely
low in mock-infected cells (Fig.
4A,C) and in ß-catenin-infected cells
(Fig. 4C), but expression of
ß-eng in HC11 cells increased the level of apoptosis approximately
fivefold (Fig. 4B,C), which is
similar to the induction seen in mid-pregnant transgenic glands
(Fig. 3). Immunofluorescent
detection of the myc epitope in the ß-eng construct
(Fig. 4D, red) showed that
approximately 50% of the HC11 cells were infected. Also, the cells undergoing
apoptosis (Fig. 4D, green)
colocalized with cells expressing the transgene
(Fig. 4D, red). At this fixed
time-point, not every infected cell was undergoing programmed cell death, but
every dying cell colocalized with ß-eng expression
(Fig. 4D). Therefore,
expression of ß-eng induces apoptosis in HC11 mammary epithelial cells,
confirming the apoptotic phenotype observed in the mammary glands of
ß-eng transgenic mice at mid-pregnancy.
|
It should be noted that HC11 cells, like most established murine cell
lines, contain a mutant p53 (Merlo et al.,
1993
). One might predict that this perturbation of the cells'
apoptotic signalling pathway might artificially affect the response to
ß-eng signalling in these cells. However, the similar induction of
apoptosis observed in the transgenic model suggests that the effects of
ß-eng signalling in HC11 cells mimic the in vivo situation.
ß-eng effect on proliferation in HC11 cells
The effects of ß-catenin and ß-eng expression on the
proliferative response of HC11 cells were analysed by BrdU incorporation as
well as by western blot analysis of downstream proliferative genes. First,
transgene expression levels were verified by western blot analysis
(Fig. 5A); expression of
exogenous ß-catenin and ß-eng were detected in infected cells but
not in mock-infected cells, using an anti-myc-tag antibody. A band with lower
molecular weight (
105 kDa) was consistently detected in cells infected
with ß-eng and it may be a degradation product. An anti-ß-catenin
antibody detected the expression of endogenous ß-catenin, which served as
an internal loading control for epithelial cell content. In the retrovirally
transduced cells, the levels of exogenous ß-catenin and ß-eng
protein appeared to be comparable, but less abundant than endogenous
ß-catenin. However, this comparison may be somewhat misleading, as much
of endogenous ß-catenin is sequestered in the adherens junctions and not
available in the signalling pool, and the transduction efficiency was only
approximately 50%. However, it does appear that a substoichiometric ratio of
mutant-to-wild-type protein is sufficient to result in phenotypic effects in
MECs, in agreement with the previous results in Xenopus
(Montross et al., 2000
).
|
Proliferation was measured by immunofluorescent detection of FITC-labelled BrdU incorporation. Quantitation of labelled HC11 cells revealed no change in proliferation in cells expressing ß-catenin or ß-eng compared with mock-infected cells (Fig. 5B). Likewise, western blot analysis of cyclin D1, a transcriptional target of ß-catenin signalling, shows no changes in the levels of cyclin D1 protein in ß-catenin- or ß-eng-expressing cells compared with mock-infected cells (Fig. 2A).
Interestingly, western blot analysis of mitogen-activated protein kinase (MAPK) signalling revealed markedly increased levels of phospho-MAPK (Erk1 and Erk2) in cells expressing ß-eng compared with cells expressing ß-catenin or mock-infected cells, whereas overall levels of MAPK remained constant (Fig. 5A). This result presents an apparent contadiction regarding the mechanism of action for ß-catenin signalling. Activation of MAPK is usually observed as an early reponse to proliferative signals, but HC11 MECs expressing ß-eng do not show increased proliferation; instead, they undergo apoptosis.
Downstream signalling effects of ß-eng expression
In an effort to understand the downstream signalling events involved in the
induction of apoptosis by ß-eng, several potential target genes and
signalling pathways were analysed (Fig.
6).
|
To determine whether the induction of apoptosis in HC11 cells involved a ß-eng-mediated decrease in the PKB/AKT survival pathway, an analysis of phosphorylated PKB/AKT in HC11 cells infected with either ß-catenin or ß-eng was undertaken. No change in the levels of activated AKT compared with mock-infected cells was detected (Fig. 6A,B (arrow)). Thus, the apoptotic pathway activated by ß-eng appears to act independently of the PKB/AKT survival pathway.
CD44 and immunoglobulin transcription factor-2 (ITF-2)
are two genes that have been reported to be transcriptional targets of
ß-catenin signalling (Kolligs et al.,
2002
; Wielenga et al.,
1999
), and their putative roles in mammary gland development are
addressed in further detail in the Discussion. Their regulation at the RNA
level was analysed by semi-quantitative RT-PCR, as sensitivity was crucial for
the detection of small changes in these low-expressing genes. Both
CD44 (Fig. 6C,D) and
ITF-2 (Fig. 6E,F) mRNA
levels were decreased by expression of ß-eng in HC11 cells. It is
important to note that these expression results probably underestimate the
magnitude of this inhibitory effect, as only 50% of the cells are expressing
the retrovirally transduced expression construct, and the cells were not
maintained under selection. These experiments show the ability of ß-eng
to negatively regulate target gene expression and provide some understanding
of the downstream events of ß-eng signalling that culminate in apoptosis
in mammary epithelial cells.
| Discussion |
|---|
|
|
|---|
The regenerative nature of the mammary gland (throughout the cycle of
pregnancy, lactation and involution) implies the presence of stem/progenitor
cells. Serial transplantation studies have shown that distinct populations of
progenitor cells give rise to ductal and lobular epithelial cells in the
mammary gland (Smith, 1996
).
Importantly, it appears that lobular epithelium, organized into milk-secreting
clusters, develops in a clonal manner, as indicated by retroviral tagging
experiments and serial transplantation experiments
(Kordon and Smith, 1998
).
Thus, an alteration of gene expression in the lobular progenitor cell will be
propagated throughout the lineage of the entire lobuloalveolar cluster.
Given the clonal nature of lobular development, a model can be postulated in which ß-catenin signalling is crucial for normal lobular development. In this model, ß-catenin provides a survival signal in the lobular progenitors, which allows these cells to divide and differentiate into lobuloalveolar clusters. When the ß-catenin signal is perturbed, in this case by the expression of ß-eng, the survival signal is lost, and the expressing cells undergo apoptosis. The loss of these few progenitor cells does not have an immediately dramatic effect on the morphological appearance of the gland (i.e. no gross phenotype at 10P-12P). However, as development continues and lobular clusters begin to expand, the lack of lobuloalveolar clusters that would have originated from transgene-expressing precursors, becomes strikingly evident. Transgene expression cannot be detected at this late developmental time-point, because, of course, all expressing precursors have undergone programmed cell death. The seemingly incongruous expression pattern and morphological phenotype data of the ß-eng transgenic mice actually support this model of ß-catenin-dependent survival of lobular mammary precursor cells.
Comparison of the current data with previous studies supports a model in
which a ß-catenin survival signal is required in lobuloalveolar
progenitor cells. Although several related mammary-specific transgenic or
knockout models also inhibit lactation in the mammary gland
(Fantl et al., 1995
;
Hsu et al., 2001
;
Sicinski et al., 1995
), there
are subtle differences in phenotype, which lend themselves to alternative
interpretations. CyclinD1/ mice and transgenic
MMTV-axin mice have similar phenotypes with a reduced number of alveoli, and
the existing alveoli are collapsed and not properly distended with lipids and
milk proteins (Fantl et al.,
1995
; Hsu et al.,
2001
). The cyclinD1/ phenotype clearly
results from decreased proliferation during development, but the transgenic
axin phenotype seems to depend on a combination of decreased proliferation
(i.e. reduced cyclinD1 protein level), as well as increased apoptosis.
However, the penetrance of this apoptotic response was only partial, as
transgene expression could continue to be detected throughout lactation
(Hsu et al., 2001
). The
current study, however, shows no survival of transgeneexpressing cells after
day 12 of pregnancy, yet the lack of lobular development manifests itself
later in development. Thus, expression of ß-eng early in the development
of lobuloalveolar progenitor cells results in almost immediate apoptosis
(supported by the HC11 data in which ß-eng induced apoptosis within 48
hours of infection), whereas the surrounding, nontransgenic progenitors
develop normally into fully distended lobular clusters.
The potential role of ß-catenin in the maintenance of mammary
stem/progenitor cells is supported by data from other tissue types. Recent
studies have illustrated the requirement for ß-catenin signalling in the
proper specification and differentiation of stem cells in the skin and hair
(DasGupta et al., 2002
;
Huelsken et al., 2001
;
Merrill et al., 2001
). In the
liver, differentiation of hepatic stem cells is associated with the
downregulation of Wnt/ß-catenin signalling and the repression of target
gene transcription (Plescia et al.,
2001
), and the epithelial stem cell compartment in the small
intestine is completely depleted in Tcf-4/ mice
(Korinek et al., 1998
). The
overexpression of ß-catenin in haematopoietic stem cells (HSCs) increases
the pool of functional (transplantable) HSCs, and this activity is inhibited
by expression of axin, a negative regulator of the ß-catenin pathway
(Reya et al., 2001
). These
data suggest that ß-catenin signalling may play an important role in
inhibiting differentiation and specifying stem-cell identity.
A recent study using extended labelling of mammary epithelial cells in vivo
identified a parity-induced population of cells that survived involution and
expanded during subsequent pregnancies
(Wagner et al., 2002
).
Although 90% of lobular epithelial cells undergo apoptosis during involution,
these cells survive, representing a constant population of putative progenitor
cells. This study also shows that this population of progenitor cells can be
targeted using the WAP promoter, further validating our model of WAP-driven
ß-eng expression in lobular progenitor cells. The analysis of
ß-catenin signalling in this persistant population could offer exciting
new insights into the role of ß-catenin in stem/progenitor cell
maintenance.
Several recent observations suggest that the well-established oncogenic
potential of ß-catenin signalling may function through an anti-apoptotic
mechanism in a variety of tissue types
(Carmeliet et al., 1999
;
Chen et al., 2001
;
Hsu et al., 2001
;
Su et al., 2002
;
You et al., 2002
). However,
none of these studies has identified the mechanism by which ß-catenin's
survival signal is propagated. The data presented here regarding the
independence of the PKB/AKT signalling pathway from ß-catenin-induced
survival in MECs agree with previously published studies indicating that AKT
is not involved in the Wnt-induced protection against chemotherapeutic agents
in Rat-1 fibroblasts (Chen et al.,
2001
). In fact, that study concluded that none of the expected
apoptotic/survival pathways were apparently involved (i.e. AKT, Janus kinase,
nuclear factor-
B), nor were any of the known apoptotic genes
misregulated (i.e. Bcl-2 family members, inhibitors of apoptosis (IAP) or Fas)
in response to ß-catenin signalling
(Chen et al., 2001
). Thus,
these recent studies suggest that ß-catenin plays a protective role
against apoptosis, but the precise mechanisms regulating such a survival
pathway remain to be determined.
The activation of MAPK signalling in this ß-eng system provides an
interesting puzzle. Why is this traditionally proliferative signal activated
in the apoptotic cells expressing ß-eng? One potential pathway through
which ß-catenin might be signalling in this case involves the
Bcl-2-related protein Bim, and its potential involvement in anoikis. Bim is a
pro-apoptotic BH3-only protein in the subfamily of Bcl-2 proteins that acts
upstream to inhibit Bcl-2 survival family members. Cytokine stimulation in
haematopoietic cell lines activates the MAPK pathway and subsequently
supresses transcription of Bim (Shinjyo et
al., 2001
). Thus, Bim and its signalling partners could represent
a potential mechanism through which ß-catenin provides a survival signal
to the cell.
The misregulation of the CD44 cell-surface protein in a variety of human
carcinomas, including breast carcinomas (reviewed by
Naor et al., 1997
), and the
identification of CD44 as a transcriptional target of ß-catenin
signalling (Wielenga et al.,
1999
), provided a potentially important target gene for analysis
in this model system. Recent studies by Yu et al. describe the role CD44 plays
in activation of ErbB4 signalling via complex formation with matrilysin and
heparin-binding epidermal growth factor (HB-EGF)
(Yu et al., 2002
). In both
CD44/ mice and mice expressing dominant negative
ErbB4 in the mammary gland, lactation is impaired
(Jones et al., 1999
;
Yu et al., 2002
), similar to
the ß-eng transgenic phenotype described here. Expression of the
ß-eng construct downregulated CD44 mRNA expression
(Fig. 6D,E), as well as
activation of the ErbB4 receptor (data not shown). These data, in conjunction
with the lactation phenotype observed in multiple mouse models, suggest that
CD44/ErbB4 signalling may be one mechanism through which ß-catenin
signalling modulates lobular development and lactation in the mammary
gland.
However, it is likely that ß-catenin signalling influences multiple
downstream targets affecting cell survival. ITF-2 is a basic helix-loop-helix
transcription factor and a target of ß-catenin signalling
(Kolligs et al., 2002
;
Zhai et al., 2002
). ITF-2 is
inhibited by Id-1, which acts as a dominant-negative inhibitor of basic
helix-loop-helix transcription factors, and functions to regulate mammary
epithelial cell growth, differentiation and apoptosis
(Parrinello et al., 2001
).
Id-1 induces apoptosis under dense cellular conditions in MECs, and this
effect is attenuated by the overexpression of ITF-2
(Parrinello et al., 2001
). The
downregulation of ITF-2 mRNA by expression of ß-eng in conjunction with
its apoptotic phenotype provides an additional potential mechanism of
ß-catenin-mediated cell survival. In this model, ß-catenin
signalling upregulates ITF-2, which can then effectively compete with its
dominant-negative inhibitor Id-1 to sustain a cell survival signal that has
yet to be identified.
A recent study in Drosophila has challenged the generally accepted
view of the mechanism by which ß-catenin regulates signal transduction in
the nucleus, in part by using a mutant ß-catenin construct related to
ß-eng (Chan and Struhl,
2002
). It is important to note that the construct used in those
studies was markedly different from ß-eng, in that it retained the
carboxy-terminal region of ß-catenin and contained an extra Gal4 DNA
binding domain, which probably accounts for the differences observed by those
authors. In addition, previous competition studies using ß-eng
(Montross et al., 2000
) show
that ß-eng acts in a dominant negative fashion to downregulate canonical
signalling targets, such as Siamois. Therefore, ß-eng can be used to
inhibit ß-catenin signalling, regardless of the mechanism of action by
which ß-catenin functions.
The data presented here provide for the first time unequivocal evidence
that ß-catenin signalling is crucial for normal mammary lobular
development. Although previous studies have shown that overexpression of axin
in the mammary gland resulted in increased apoptosis and decreased lobular
development (Zhang et al.,
1999
), axin also activates the c-Jun NH2-terminal
kinase/stress-activated protein kinase (JNK/SAPK) signalling cascade
independently of regulating ß-catenin degradation. Thus, in this case
other signalling events could have contributed to the observed apoptotic
phenotype. In Wnt4/ mice, lobular development was
inhibited during early stages of pregnancy, but the defect was rescued later
in development, presumably because of compensation by other mammary-expressed
Wnt family members (Brisken et al.,
2000
). Thus, the current study offers the first direct evidence of
the requirement of Wnt/ß-catenin signaling for normal mammary lobular
development, potentially through the maintenance of lobular progenitors.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Allgood, V. E., Zhang, Y., O'Malley, B. W. and Weigel, N. L. (1997). Analysis of chicken progesterone receptor function and phosphorylation using an adenovirus-mediated procedure for high-efficiency DNA transfer. Biochemistry 36,224 -232.[CrossRef][Medline]
Ball, R. K., Friis, R. R., Schoenenberger, C. A., Doppler, W. and Groner, B. (1988). Prolactin regulation of beta-casein gene expression and of a cytosolic 120-kd protein in a cloned mouse mammary epithelial cell line. EMBO J. 7,2089 -2095.[Medline]
Barker, N., Morin, P. J. and Clevers, H. (2000). The Yin-Yang of TCF/beta-catenin signaling. Adv. Cancer Res. 77,1 -24.[Medline]
Barth, A. I., Nathke, I. S. and Nelson, W. J. (1997). Cadherins, catenins and APC protein: interplay between cytoskeletal complexes and signaling pathways. Curr. Opin. Cell Biol. 9,683 -690.[CrossRef][Medline]
Bayna, E. M. and Rosen, J. M. (1990).
Tissue-specific, high level expression of the rat whey acidic protein gene in
transgenic mice. Nucleic Acids Res.
18,2977
-2985.
Behrens, J., von Kries, J. P., Kuhl, M., Bruhn, L., Wedlich, D., Grosschedl,R. and Birchmeier, W. (1996). Functional interaction of beta-catenin with the transcription factor LEF-1. Nature 382,638 -642.[CrossRef][Medline]
Bienz, M. (1998). TCF: transcriptional activator or repressor? Curr. Opin. Cell Biol. 10,366 -372.[CrossRef][Medline]
Brisken, C., Heineman, A., Chavarria, T., Elenbaas, B., Tan, J.,
Dey, S. K., McMahon, J. A., McMahon, A. P. and Weinberg, R. A.
(2000). Essential function of Wnt-4 in mammary gland development
downstream of progesterone signaling. Genes Dev.
14,650
-654.
Campbell, S. M., Rosen, J. M., Hennighausen, L. G., Strech-Jurk,
U. and Sippel, A. E. (1984). Comparison of the whey acidic
protein genes of the rat and mouse. Nucleic Acids Res.
12,8685
-8697.
Carmeliet, P., Lampugnani, M. G., Moons, L., Breviario, F., Compernolle, V., Bono, F., Balconi, G., Spagnuolo, R., Oostuyse, B., Dewerchin, M. et al. (1999). Targeted deficiency or cytosolic truncation of the VE-cadherin gene in mice impairs VEGF-mediated endothelial survival and angiogenesis. Cell 98,147 -157.[CrossRef][Medline]
Chan, S. K. and Struhl, G. (2002). Evidence that Armadillo transduces wingless by mediating nuclear export or cytosolic activation of Pangolin. Cell 111,265 -280.[CrossRef][Medline]
Chen, S., Guttridge, D. C., You, Z., Zhang, Z., Fribley, A.,
Mayo, M. W., Kitajewski, J. and Wang, C. Y. (2001). Wnt-1
signaling inhibits apoptosis by activating beta-catenin/T cell factor-mediated
transcription. J. Cell Biol.
152, 87-96.
Dale, T. C., Krnacik, M. J., Schmidhauser, C., Yang, C. L.,
Bissell, M. J. and Rosen, J. M. (1992). High-level expression
of the rat whey acidic protein gene is mediated by elements in the promoter
and 3' untranslated region. Mol. Cell. Biol.
12,905
-914.
Daniel, C. W. and Silberstein, G. B. (1987). Postnatal Development of the Rodent Mammary Gland. New York: Plenum.
DasGupta, R., Rhee, H. and Fuchs, E. (2002). A
developmental conundrum: a stabilized form of beta-catenin lacking the
transcriptional activation domain triggers features of hair cell fate in
epidermal cells and epidermal cell fate in hair follicle cells. J.
Cell Biol. 158,331
-344.
Easwaran, V., Song, V., Polakis, P. and Byers, S.
(1999a). The ubiquitin-proteasome pathway and serine kinase
activity modulate adenomatous polyposis coli protein-mediated regulation of
beta-catenin-lymphocyte enhancer-binding factor signaling. J. Biol.
Chem. 274,16641
-16645.
Easwaran, V., Pishvaian, M., Salimuddin and Byers, S. (1999b). Cross-regulation of beta-catenin-LEF/TCF and retinoid signaling pathways. Curr. Biol. 9,1415 -1418.[CrossRef][Medline]
Fantl, V., Stamp, G., Andrews, A., Rosewell, I. and Dickson,
C. (1995). Mice lacking cyclin D1 are small and show defects
in eye and mammary gland development. Genes Dev.
9,2364
-2372.
Faustinella, F., Kwon, H., Serrano, F., Belmont, J. W., Caskey, C. T. and Aguilar-Cordova, E. (1994). A new family of murine retroviral vectors with extended multiple cloning sites for gene insertion. Hum. Gene Ther. 5,307 -312.[Medline]
Herrenknecht, K., Ozawa, M., Eckerskorn, C., Lottspeich, F.,
Lenter, M. and Kemler, R. (1991). The uvomorulin-anchorage
protein alpha catenin is a vinculin homologue. Proc. Natl. Acad.
Sci. USA 88,9156
-9160.
Hsu, W., Shakya, R. and Costantini, F. (2001).
Impaired mammary gland and lymphoid development caused by inducible expression
of Axin in transgenic mice. J. Cell Biol.
155,1055
-1064.
Huber, O., Korn, R., McLaughlin, J., Ohsugi, M., Herrmann, B. G. and Kemler, R. (1996). Nuclear localization of beta-catenin by interaction with transcription factor LEF-1. Mech. Dev. 59,3 -10.[CrossRef][Medline]
Huber, A. H., Nelson, W. J. and Weis, W. I. (1997). Three-dimensional structure of the armadillo repeat region of beta-catenin. Cell 90,871 -882.[CrossRef][Medline]
Huelsken, J. and Birchmeier, W. (2001). New aspects of Wnt signaling pathways in higher vertebrates. Curr. Opin. Genet. Dev. 11,547 -553.[CrossRef][Medline]
Huelsken, J., Vogel, R., Erdmann, B., Cotsarelis, G. and Birchmeier, W. (2001). beta-Catenin controls hair follicle morphogenesis and stem cell differentiation in the skin. Cell 105,533 -545.[CrossRef][Medline]
Humphreys, R. C., Krajewska, M., Krnacik, S., Jaeger, R., Weiher, H., Krajewski, S., Reed, J. C. and Rosen, J. M. (1996). Apoptosis in the terminal endbud of the murine mammary gland: a mechanism of ductal morphogenesis. Development 122,4013 -4022.[Abstract]
Humphreys, R. C. and Rosen, J. M. (1997). Stably transfected HC11 cells provide an in vitro and in vivo model system for studying Wnt gene function. Cell Growth Differ. 8, 839-849.[Abstract]
Ikeda, S., Kishida, S., Yamamoto, H., Murai, H., Koyama, S. and Kikuchi, A. (1998). Axin, a negative regulator of the Wnt signaling pathway, forms a complex with GSK-3beta and beta-catenin and promotes GSK-3beta-dependent phosphorylation of beta-catenin. EMBO J. 17,1371 -1384.[CrossRef][Medline]
Imbert, A., Eelkema, R., Jordan, S., Feiner, H. and Cowin,
P. (2001). Delta N89 beta-catenin induces precocious
development, differentiation, and neoplasia in mammary gland. J.
Cell Biol. 153,555
-568.
Jaynes, J. B. and O'Farrell, P. H. (1991). Active repression of transcription by the engrailed homeodomain protein. EMBO J. 10,1427 -1433.[Medline]
Jones, F. E., Welte, T., Fu, X. Y. and Stern, D. F.
(1999). ErbB4 signaling in the mammary gland is required for
lobuloalveolar development and Stat5 activation during lactation.
J. Cell Biol. 147,77
-88.
Kikuchi, A. (1999). Roles of Axin in the Wnt signalling pathway. Cell Signal. 11,777 -788.[CrossRef][Medline]
Kishida, S., Yamamoto, H., Ikeda, S., Kishida, M., Sakamoto, I.,
Koyama, S. and Kikuchi, A. (1998). Axin, a negative regulator
of the wnt signaling pathway, directly interacts with adenomatous polyposis
coli and regulates the stabilization of beta-catenin. J. Biol.
Chem. 273,10823
-10826.
Kolligs, F. T., Nieman, M. T., Winer, I., Hu, G., Wan Mater, D., Feng, Y., Smith, I. M., Wu, R., Zhai, Y., Cho, K. R. et al. (2002). ITF-2, a downstream target of the Wnt/TCF pathway, is activated in human cancers with beta-catenin defects and promotes neoplastic transformation. Cancer Cell 1, 145-155.[CrossRef][Medline]
Kordon, E. C. and Smith, G. H. (1998). An entire functional mammary gland may comprise the progeny from a single cell. Development 125,1921 -1930.[Abstract]
Korinek, V., Barker, N., Moerer, P., van Donselaar, E., Huls, G., Peters, P. J. and Clevers, H. (1998). Depletion of epithelial stem-cell compartments in the small intestine of mice lacking Tcf-4. Nat. Genet. 19,379 -383.[CrossRef][Medline]
Li, B., Greenberg, N., Stephens, L. C., Meyn, R., Medina, D. and Rosen, J. M. (1994). Preferential overexpression of a 172Arg>Leu mutant p53 in the mammary gland of transgenic mice results in altered lobuloalveolar development. Cell Growth Differ. 5,711 -721.[Abstract]
Ma, Z. Q., Chua, S. S., DeMayo, F. J. and Tsai, S. Y. (1999). Induction of mammary gland hyperplasia in transgenic mice over-expressing human Cdc25B. Oncogene 18,4564 -4576.[CrossRef][Medline]
McCrea, P. D., Turck, C. W. and Gumbiner, B.
(1991). A homolog of the armadillo protein in Drosophila
(plakoglobin) associated with E-cadherin. Science
254,1359
-1361.
McCrea, P. D., Brieher, W. M. and Gumbiner, B.
(1993). Induction of a secondary body axis in Xenopus by
antibodies to beta-catenin. J. Cell Biol.
123,477
-484.
McMahon, A. P. and Bradley, A. (1990). The Wnt-1 (int-1) proto-oncogene is required for development of a large region of the mouse brain. Cell 62,1073 -1085.[CrossRef][Medline]
Merlo, G. R., Venesio, T., Taverna, D., Callahan, R. and Hynes, N. E. (1993). Growth suppression of normal mammary epithelial cells by wild-type p53. Ann. N. Y. Acad. Sci. 698,108 -113.[CrossRef][Medline]
Merrill, B. J., Gat, U., DasGupta, R. and Fuchs, E.
(2001). Tcf3 and Lef1 regulate lineage differentiation of
multipotent stem cells in skin. Genes Dev.
15,1688
-1705.
Michaelson, J. S. and Leder, P. (2001). beta-catenin is a downstream effector of Wnt-mediated tumorigenesis in the mammary gland. Oncogene 20,5093 -5099.[CrossRef][Medline]
Miyoshi, K., Shillingford, J. M., le Provost, F., Gounari, F.,
Bronson, R., von Boehmer, H., Taketo, M. M., Cardiff, R. D., Hennighausen, L.
and Khazaie, K. (2002). Activation of beta-catenin signaling
in differentiated mammary secretory cells induces transdifferentiation into
epidermis and squamous metaplasias. Proc. Natl. Acad. Sci.
USA 99,219
-224.
Molenaar, M., van de Wetering, M., Oosterwegel, M., Peterson-Maduro, J., Godsave, S., Korinek, V., Roose, J., Destree, O. and Clevers, H. (1996). XTcf-3 transcription factor mediates beta-catenin-induced axis formation in Xenopus embryos. Cell 86,391 -399.[CrossRef][Medline]
Montross, W. T., Ji, H. and McCrea, P. D.
(2000). A beta-catenin/engrailed chimera selectively suppresses
Wnt signaling. J. Cell Sci.
113,1759
-1770.
Moon, R. T., Brown, J. D. and Torres, M. (1997). WNTs modulate cell fate and behavior during vertebrate development. Trends Genet. 13,157 -162.[CrossRef][Medline]
Muller, W. J., Sinn, E., Pattengale, P. K., Wallace, R. and Leder, P. (1988). Single-step induction of mammary adenocarcinoma in transgenic mice bearing the activated c-neu oncogene. Cell 54,105 -115.[CrossRef][Medline]
Muller, W. J., Lee, F. S., Dickson, C., Peters, G., Pattengale, P. and Leder, P. (1990). The int-2 gene product acts as an epithelial growth factor in transgenic mice. EMBO J. 9, 907-913.[Medline]
Nagafuchi, A. and Tsukita, S. (1994). The loss of the expression of alpha-catenin, the 102 kD cadherin associated protein, in central nervous tissues during development. Dev. Growth Differ. 36,59 -71.
Naor, D., Sionov, R. and Ish-Shalom, D. (1997). CD44: Structure, function and association with the malignant process. Adv. Cancer Res. 71,241 -319.[Medline]
Nishita, M., Hashimoto, M. K., Ogata, S., Laurent, M. N., Ueno, N., Shibuya, H. and Cho, K. W. (2000). Interaction between Wnt and TGF-beta signalling pathways during formation of Spemann's organizer. Nature 403,781 -785.[CrossRef][Medline]
Nusse, R. and Varmus, H. E. (1982). Many tumors induced by the mouse mammary tumor virus contain a provirus integrated in the same region of the host genome. Cell 31, 99-109.[CrossRef][Medline]
Parrinello, S., Lin, C. Q., Murata, K., Itahana, Y., Singh, J.,
Krtolica, A., Campisi, J. and Desprez, P. Y. (2001). Id-1,
ITF-2, and Id-2 comprise a network of helix-loop-helix proteins that regulate
mammary epithelial cell proliferation, differentiation, and apoptosis.
J. Biol. Chem. 276,39213
-39219.
Peifer, M., Rauskolb, C., Williams, M., Riggleman, B. and
Wieschaus, E. (1991). The segment polarity gene armadillo
interacts with the wingless signaling pathway in both embryonic and adult
pattern formation. Development
111,1029
-1043.
Peifer, M., Berg, S. and Reynolds, A. B. (1994). A repeating amino acid motif shared by proteins with diverse cellular roles. Cell 76,789 -791.[CrossRef][Medline]
Plescia, C., Rogler, C. and Rogler, L. (2001). Genomic expression analysis implicates Wnt signaling pathway and extracellular matrix alterations in hepatic specification and differentiation of murine hepatic stem cells. Differentiation 68,254 -269.[CrossRef][Medline]
Reya, T., Morrison, S. J., Clarke, M. F. and Weissman, I. L. (2001). Stem cells, cancer, and cancer stem cells. Nature 414,105 -111.[CrossRef][Medline]
Rubinfeld, B., Albert, I., Porfiri, E., Fiol, C., Munemitsu, S. and Polakis, P. (1996). Binding of GSK3beta to the APC-beta-catenin complex and regulation of complex assembly. Science 272,1023 -1026.[Abstract]
Salomon, D., Sacco, P. A., Roy, S. G., Simcha, I., Johnson, K.
R., Wheelock, M. J. and Ben-Ze'ev, A. (1997). Regulation of
beta-catenin levels and localization by overexpression of plakoglobin and
inhibition of the ubiquitin-proteasome system. J. Cell
Biol. 139,1325
-1335.
Seagroves, T. N., Krnacik, S., Raught, B., Gay, J.,
Burgess-Beusse, B., Darlington, G. J. and Rosen, J. M.
(1998). C/EBPbeta, but not C/EBPalpha, is essential for ductal
morphogenesis, lobuloalveolar proliferation, and functional differentiation in
the mouse mammary gland. Genes Dev.
12,1917
-1928.
Seagroves, T. N., Lydon, J. P., Hovey, R. C., Vonderhaar, B. K.
and Rosen, J. M. (2000). C/EBPbeta (CCAAT/enhancer binding
protein) controls cell fate determination during mammary gland development.
Mol. Endocrinol. 14,359
-368.
Shinjyo, T., Kuribara, R., Inukai, T., Hosoi, H., Kinoshita, T.,
Miyajima, A., Houghton, P. J., Look, A. T., Ozawa, K. and Inaba, T.
(2001). Downregulation of Bim, a proapoptotic relative of Bcl-2,
is a pivotal step in cytokine-initiated survival signaling in murine
hematopoietic progenitors. Mol. Cell. Biol.
21,854
-864.
Sicinski, P., Donaher, J. L., Parker, S. B., Li, T., Fazeli, A., Gardner, H., Haslam, S. Z., Bronson, R. T., Elledge, S. J. and Weinberg, R. A. (1995). Cyclin D1 provides a link between development and oncogenesis in the retina and breast. Cell 82,621 -630.[CrossRef][Medline]
Smith, G. H. (1996). Experimental mammary epithelial morphogenesis in an in vivo model: evidence for distinct cellular progenitors of the ductal and lobular phenotype. Breast Cancer Res. Treat. 39,21 -31.[CrossRef][Medline]
Smith, S. T. and Jaynes, J. B. (1996). A conserved region of engrailed, shared among all en-, gsc-, Nk1-, Nk2- and msh-class homeoproteins, mediates active transcriptional repression in vivo. Development 122,3141 -3150.[Abstract]
Steinberg, M. S. and McNutt, P. M. (1999). Cadherins and their connections: adhesion junctions have broader functions. Curr. Opin. Cell Biol. 11,554 -560.[CrossRef][Medline]
Su, F., Overholtzer, M., Besser, D. and Levine, A. J.
(2002). WISP-1 attenuates p53-mediated apoptosis in response to
DNA damage through activation of the Akt kinase. Genes
Dev. 16,46
-57.
Wagner, K. U., Boulanger, C. A., Henry, M. D., Sgagias, M.,
Hennighausen, L. and Smith, G. H. (2002). An adjunct mammary
epithelial cell population in parous females: its role in functional
adaptation and tissue renewal. Development
129,1377
-1386.
Welm, B. E., Freeman, K. W., Chen, M., Contreras, A., Spencer,
D. M. and Rosen, J. M. (2002). Inducible dimerization of
FGFR1: development of a mouse model to analyze progressive transformation of
the mammary gland. J. Cell Biol.
157,703
-714.
Wielenga, V. J., Smits, R., Korinek, V., Smit, L., Kielman, M.,
Fodde, R., Clevers, H. and Pals, S. T. (1999). Expression of
CD44 in Apc and Tcf mutant mice implies regulation by the WNT pathway.
Am. J. Pathol. 154,515
-523.
Williams, J. M. and Daniel, C. W. (1983). Mammary ductal elongation: differentiation of myoepithelium and basal lamina during branching morphogenesis. Dev. Biol. 97,274 -290.[CrossRef][Medline]
Yanagawa, S., van Leeuwen, F., Wodarz, A., Klingensmith, J. and
Nusse, R. (1995). The dishevelled protein is modified by
wingless signaling in Drosophila. Genes Dev.
9,1087
-1097.
You, Z., Saims, D., Chen, S., Zhang, Z., Guttridge, D. C., Guan,
K. L., MacDougald, O. A., Brown, A. M., Evan, G., Kitajewski, J. et al.
(2002). Wnt signaling promotes oncogenic transformation by
inhibiting c-Myc-induced apoptosis. J. Cell Biol.
157,429
-440.
Yu, W. H., Woessner, J. F., Jr, McNeish, J. D. and Stamenkovic,
I. (2002). CD44 anchors the assembly of matrilysin/MMP-7 with
heparin-binding epidermal growth factor precursor and ErbB4 and regulates
female reproductive organ remodeling. Genes Dev.
16,307
-323.
Zahnow, C. A., Cardiff, R. D., Laucirica, R., Medina, D. and
Rosen, J. M. (2001). A role for CCAAT/enhancer binding
protein beta-liver-enriched inhibitory protein in mammary epithelial cell
proliferation. Cancer Res.
61,261
-269.
Zhai, Y., Wu, R., Schwartz, D. R., Darrah, D., Reed, H.,
Kolligs, F. T., Nieman, M. T., Fearon, E. R. and Cho, K. R.
(2002). Role of beta-catenin/T-cell factor-regulated genes in
ovarian endometrioid adenocarcinomas. Am. J. Pathol.
160,1229
-1238.
Zhang, Y., Neo, S. Y., Wang, X., Han, J. and Lin, S. C.
(1999). Axin forms a complex with MEKK1 and activates c-Jun
NH(2)-terminal kinase/stressactivated protein kinase through domains distinct
from Wnt signaling. J. Biol. Chem.
274,35247
-35254.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
Z. Wang, A. Havasi, J. M. Gall, H. Mao, J. H. Schwartz, and S. C. Borkan {beta}-Catenin Promotes Survival of Renal Epithelial Cells by Inhibiting Bax J. Am. Soc. Nephrol., September 1, 2009; 20(9): 1919 - 1928. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Su and R. C.M. Simmen Soy isoflavone genistein upregulates epithelial adhesion molecule E-cadherin expression and attenuates {beta}-catenin signaling in mammary epithelial cells Carcinogenesis, February 1, 2009; 30(2): 331 - 339. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Liu and J. F. Engelhardt The Glandular Stem/Progenitor Cell Niche in Airway Development and Repair Proceedings of the ATS, August 15, 2008; 5(6): 682 - 688. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Roarty and R. Serra Wnt5a is required for proper mammary gland development and TGF-{beta}-mediated inhibition of ductal growth Development, November 1, 2007; 134(21): 3929 - 3939. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hiremath, J. P. Lydon, and P. Cowin The pattern of {beta}-catenin responsiveness within the mammary gland is regulated by progesterone receptor Development, October 15, 2007; 134(20): 3703 - 3712. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Chen, W. A. Woodward, F. Behbod, S. Peddibhotla, M. P. Alfaro, T. A. Buchholz, and J. M. Rosen Wnt/beta-catenin mediates radiation resistance of Sca1+ progenitors in an immortalized mammary gland cell line J. Cell Sci., February 1, 2007; 120(3): 468 - 477. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. A. Woodward, M. S. Chen, F. Behbod, M. P. Alfaro, T. A. Buchholz, and J. M. Rosen WNT/beta-catenin mediates radiation resistance of mouse mammary progenitor cells PNAS, January 9, 2007; 104(2): 618 - 623. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lindvall, N. C. Evans, C. R. Zylstra, Y. Li, C. M. Alexander, and B. O. Williams The Wnt Signaling Receptor Lrp5 Is Required for Mammary Ductal Stem Cell Activity and Wnt1-induced Tumorigenesis J. Biol. Chem., November 17, 2006; 281(46): 35081 - 35087. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Yang, R. Kurotani, A. Yamada, S. Kimura, and F. J. Gonzalez Peroxisome Proliferator-Activated Receptor {alpha} Activation during Pregnancy Severely Impairs Mammary Lobuloalveolar Development in Mice Endocrinology, October 1, 2006; 147(10): 4772 - 4780. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Ginger, A. N. Shore, A. Contreras, M. Rijnkels, J. Miller, M. F. Gonzalez-Rimbau, and J. M. Rosen A noncoding RNA is a potential marker of cell fate during mammary gland development PNAS, April 11, 2006; 103(15): 5781 - 5786. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Fernandez-Valdivia, Y. Zhang, S. Pai, M. L. Metzker, and A. Schumacher l7Rn6 Encodes a Novel Protein Required for Clara Cell Function in Mouse Lung Development Genetics, January 1, 2006; 172(1): 389 - 399. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Votin, W. J. Nelson, and A. I. M. Barth Neurite outgrowth involves adenomatous polyposis coli protein and {beta}-catenin J. Cell Sci., December 15, 2005; 118(24): 5699 - 5708. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. A. Woodward, M. S. Chen, F. Behbod, and J. M. Rosen On mammary stem cells J. Cell Sci., August 15, 2005; 118(16): 3585 - 3594. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Teuliere, M. M. Faraldo, M.-A. Deugnier, M. Shtutman, A. Ben-Ze'ev, J. P. Thiery, and M. A. Glukhova Targeted activation of {beta}-catenin signaling in basal mammary epithelial cells affects mammary development and leads to hyperplasia Development, January 15, 2005; 132(2): 267 - 277. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Deroo, T. Denayer, F. Van Roy, and K. Vleminckx Global Inhibition of Lef1/Tcf-dependent Wnt Signaling at Its Nuclear End Point Abrogates Development in Transgenic Xenopus Embryos J. Biol. Chem., December 3, 2004; 279(49): 50670 - 50675. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Urban, G. Brown, and M. Freeman EGF receptor signalling protects smooth-cuticle cells from apoptosis during Drosophila ventral epidermis development Development, April 15, 2004; 131(8): 1835 - 1845. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Zhang, J. Cheng, N. R. Hackett, G. Lam, K. Shido, R. Pergolizzi, D. K. Jin, R. G. Crystal, and S. Rafii Adenovirus E4 Gene Promotes Selective Endothelial Cell Survival and Angiogenesis via Activation of the Vascular Endothelial-Cadherin/Akt Signaling Pathway J. Biol. Chem., March 19, 2004; 279(12): 11760 - 11766. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Mucenski, S. E. Wert, J. M. Nation, D. E. Loudy, J. Huelsken, W. Birchmeier, E. E. Morrisey, and J. A. Whitsett {beta}-Catenin Is Required for Specification of Proximal/Distal Cell Fate during Lung Morphogenesis J. Biol. Chem., October 10, 2003; 278(41): 40231 - 40238. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Rowlands, I. V. Pechenkina, S. J. Hatsell, R. G. Pestell, and P. Cowin Dissecting the roles of {beta}-catenin and cyclin D1 during mammary development and neoplasia PNAS, September 30, 2003; 100(20): 11400 - 11405. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||