|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 19 February 2003
doi: 10.1242/jcs.00338
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |

Laboratory of Lympho-Epithelial Interactions, Department of Cell Biology
and Infection, Pasteur Institute, 28, Rue du Dr Roux, 75015 Paris,
France
* Present address: Laboratory of Traffic and Signaling, UMR 144 Curie/CNRS,
Curie Institute, 26, rue d'Ulm, 75005 Paris Cedex, France
Author for correspondence (e-mail:
epringau{at}pasteur.fr)
Accepted 23 December 2002
| Summary |
|---|
|
|
|---|
Key words: Esophagus, Keratinocytes, Intestinal metaplasia, Barrett's esophagus
| Introduction |
|---|
|
|
|---|
These studies have been partly hampered because of the absence of adequate
culture models. Previous attempts have been restricted to explants culture of
esophageal mucosa (Fitzgerald et al.,
1996
; Kaur et al.,
2000
) or short-term primary cultures
(Compton et al., 1998
;
Banks-Schlegel and Harris,
1983
; Banks-Schlegel and Green,
1981
) limited by the rapid death of the culture or immortalized
cell lines, where the genetic regulation is altered by the immortalization
process (Rheinwald and Becket, 1980;
Stoner et al., 1982
;
Stoner et al., 1991
;
Palanca-Wessels et al., 1998
;
Mothersill and Seymour, 1989
).
Recent studies have shown that animals such as mice, rats and rabbits can
provide in vivo models for intestinal metaplasia of the esophagus
(Vaezi et al., 1995
;
Goldstein et al., 1997
;
Ouatu-Lascar et al., 1999
;
Xu et al., 2000
). Apart from
the anatomo-pathologic observations and the evaluation of the severity of the
lesions, the molecular mechanisms underlying the metaplastic process that take
place in the esophagus cannot be investigated in these models. Histological
studies do not provide a better understanding of the molecular and cellular
processes leading to the syndrome and these models require complicated
surgical manipulations.
Insight into the mechanisms that direct cellular changes to establish and
maintain the metaplastic phenotype may be gained by studying, at the molecular
level, the expression in the esophageal cells of key developmental genes such
as the intestinal transcription factors that might be activated during the
transdifferentiation process. Candidates that might play a function in
triggering intestinal metaplasia are the rodent caudal-related cdx1
and cdx2 homeobox genes that encode transcription factors involved in
intestinal cell differentiation and proliferation
(Freund et al., 1992
;
James and Kazenwadel, 1991
;
James et al., 1994
). In vitro
and in vivo studies of cdx2 homeobox gene expression have suggested
that this transcription factor is important in the early steps of
differentiation and maintenance of the intestinal cell phenotype
(Suh and Traber, 1996
;
Troelsen et al., 1997
;
Mallo et al., 1997
;
Soubeyran et al., 1999
).
In an attempt to investigate the role of acid pH in the intestinal transdifferentiation process of esophageal cells, we have chosen an approach consisting in the establishment of a model of normal, long-term culture of mouse esophageal keratinocytes in a double-chamber system. In this model, acid exposure effect on cdx2 activation was investigated. Here, we show that low pH exposure of the apical compartment of the double-chamber culture was sufficient to induce expression of the specific intestinal transcription factor Cdx2 in differentiated mouse esophageal cells.
| Materials and Methods |
|---|
|
|
|---|
Cell culture
The mouse esophageal cells (P3E6) were routinely grown in DMEM/Ham's F12
medium, supplemented with 10% fetal bovine serum, 5 µg/ml transferrin, 5
µg/ml insulin, 1 nM triiodothyronine, 30 nM sodium selenite, 10 ng/ml
epidermal growth factor (EGF), 0.5 mg/ml cholera toxin, 5 mg/ml
hydrocortisone, 1% non-essential amino acids, 1% penicillin-streptomycin 250
µg/ml amphotericin and 7.5% bicarbonate, at 37°C in a 10%
CO2 atmosphere. Experiments were performed between passages 11 and
13 on cells grown on either plastic support, glass coverslips or permeable
Transwell filters (6.5 mm or 24 mm insert diameter, 0.4 µm pore size;
Costar, Cambridge, MA, USA). Caco2 TC7 cells (kindly provided by M. Rousset,
INSERM, Paris) were grown in DMEM, 25 mM glucose medium (Gibco BRL)
supplemented with 20% fetal bovine serum, 1% non-essential amino acids and 1%
penicillin-streptomycin at 37°C in a 10% CO2 atmosphere. Cells
were passaged (1/10 dilution) just before they reached confluency (4-5 days)
and medium was changed every two days.
pH assay
For the pH assay, cells were seeded onto the porous filters of Transwell
devices (Costar, Cambridge, MA, USA) at a concentration of
3x104 cells/mm2. Cells were cultured at pH 7.4
until day 16 (D 16) (when they reached confluency and differentiation) and
then the medium equilibrated at pH 3.5 was introduced into the upper (apical)
chamber of Transwell devices. D 16 was therefore considered as D+0 of the pH
assay. For convenience, subsequent days during the pH assay were designed as
D+`n'. DMEM/Ham's F12 complete medium at pH 3.5 was prepared by the addition
of 0.1 N HCl in the proportion necessary to achieve the desired pH. In order
to assure that any observed cellular change was not attributable to a change
in medium osmolarity, control cells were grown in DMEM/Ham's F12 complete
medium with an added volume of distilled water equivalent to the acid-treated
medium. Sets of cultured cells from the same passage were grown either at pH
3.5 or at pH 7.4. After 2 days, three filters for each pH assay were fixed for
immunocytological analysis (6.5 mm diameter) or used for western blot analysis
(24 mm diameter).
Immunocytochemistry
Epithelial cells grown on glass-slides or on porous filters were fixed in
ice-cold methanol for 10 minutes, and labeled with mouse monoclonal
anti-cytokeratin 4 (dilution 1/10; ICN Pharmaceuticals) and anti-cytokeratin
14 antibodies (dilution 1/10; ICN Pharmaceuticals). Antibodies were revealed
by either FITC-conjugated anti-mouse Ig antibody (1/100 dilution; Amersham
Pharmacia Biotech) or Cy3-conjugated anti-mouse Ig antibodies (1/100 dilution;
Jackson Immunoresearch). An Alexa 488 conjugated anti-fluorescein goat IgG
fraction (Molecular Probes) was also used (30 minutes, dilution 1/50). Nuclear
staining was performed by incubation with 0.2 mg/ml propidium iodide for 30
seconds. To analyze the expression of CDX2 protein, cells were fixed in PFA
(3.7%) and permeabilized with 2% Triton X-100. Staining was performed using a
rabbit polyclonal anti-CDX2 antibody (kindly provided by M. German, Dept. of
Medicine Hormone Research Institute, UCSF, San Francisco, CA). A
FITC-conjugated anti-rabbit Ig antibody (dilution 1/100; Amersham Pharmacia
Biotech) was then used to reveal CDX2 expression and localization. All
specimens were examined under a fluorescence microscope equipped for
fluorescence and interdifferential contrast (Leica DMR, Cambridge, UK).
Protein extraction and immunoblot analysis
Cells were grown on 24 mm diameter filters for immunoblot analysis. Cells
were washed three times with ice-cold sterile PBS, then harvested using a cell
scraper and centrifuged at 6000 g (10 minutes, 4°C). Cell
pellet was resuspended in lysis buffer (SDS Laemmli buffer, BioRad)
supplemented with a complete cocktail of protease inhibitors (Sigma). Protein
concentration was measured by the BCA protein assay (Pierce), as recommended
by the manufacturer. Proteins were separated using 10% SDS-polyacrylamide gel
electrophoresis and then transferred to nitro-cellulose membrane (0.45 mm).
Following transfer, membranes were incubated for 1 hour in blocking solution
(5% dry non-fat milk in PBS containing 0.05% Triton X-100), and then incubated
overnight at 4°C with the anti-CDX2 (kindly provided by M. German, Dept.
of Medicine Hormone Research Institute, UCSF, San Francisco, CA) or the
polyclonal anti-actin (dilution 1:100; Sigma), or the polyclonal anti-GFP
antibodies (dilution 1:100; Clontech Laboratories, Palo Alto, CA). Membranes
were washed in 3% dry non-fat milk in PBS containing 0.05% Triton X-100 and
incubated with anti-rabbit or anti-mouse peroxidase-conjugated secondary
antibody (1:10,000 dilution; Amersham Pharmacia Biotech) for 30 minutes.
Immunoblots were revealed using an enhanced chemioluminescence system
(ECLTM, Amersham Pharmacia Biotech).
Confocal and electron microscopy analysis
P3E6 cells grown on porous filters were fixed and stained as described
above and then examined by confocal laser scanning microscopy (CLSM, Leica,
Wtezlar, Germany). A series of filters cultured in parallel were embedded
according to a standard procedures and ultrathin sections (Leica ultracut UCT)
were examined by transmission electron microscopy (JEOL JEM-1200 EX II
microscope).
Construction of the recombinant plasmid containing the cdx2
promoter region
A 659 base pair BglII/KpnI fragment containing the DNA
sequence of the mouse cdx2 gene promoter was produced by PCR using
the following primers 5' GAAGATCTCCTTCTGCCTGAGAATGTAC
3' and 5' TCTGTCGTACCACTCCAGACGAAGCCATGG 3'
(GenBank U00454). The PCR reaction product was digested with BglII
and KpnI restriction enzymes and cloned upstream of the coding
sequence of the GFP reporter gene into the multiple cloning site between
BglII and KpnI of the pEGFP plasmid (Qiagen). The
recombinant vector was then transfected into Epicurian coli XL1-Blue Competent
cells (Stratagene) and recovered by a maxi plasmid preparation kit (Qiagen).
The construct was confirmed by PCR and sequence analysis. The recombinant
plasmid named pcdx2EGFP was then used for transfection experiments.
Transfection of P3E6 cells by pcdx2EGFP plasmid
Cells were plated at a density of 1x105 per 35 mm diameter
well and transfected 24 hours later with 5 µg of pcdx2EGFP plasmid mixed to
15 µl Lipofectin (Lipofectamine kit, Invitrogen Life Technologies). After a
5 hour incubation, cells were washed and fed with fresh DMEM/Ham's F12 medium.
Stable transfectants were selected in medium supplemented with 0.5 µg/ml of
geneticin (Gibco BRL) and the resulting P3E6K2 cells were routinely grown in
geneticin medium. PCR analysis on stable transfected cells P3E6K2 confirmed
the presence of intact inserted construct of pcdx2EGFP (data not shown).
Transient transfection of the plasmid DNA in Caco2 cultured cells on glass
slides was performed by using the same procedure and the GFP expression was
checked at 48 hours post-transfection using epifluorescent microscopy.
| Results |
|---|
|
|
|---|
|
P3E6 cells proliferated and differentiated as `Malpighian-like'
multilayers of esophagus keratinocytes
P3E6 cells (passage 6) were seeded onto porous filter support and checked
for their ability to proliferate and differentiate. A similar growth curve and
cell doubling time to that obtained for P3E6 cells growing on plastic support
was obtained for cells growing on filters (data not shown). Confocal analysis
of immunocytochemistry of esophageal keratinocytes cultured for 16 days
revealed a pattern of expression of cytokeratins typical of the malpighian
epithelium of the esophagus. Cytokeratin 14 (CK14) was strongly and uniformly
expressed (Fig. 2A), whereas
cytokeratin 4 (CK4) was only expressed in the suprabasal cell layer
(Fig. 2B). Thus, just as it
occurs in vivo, the CK4 staining was restricted to the upper layers, whilst
the CK14 staining was observed only in the 2-3 basal layers of stratified
cells. When xz sections were analyzed multiple layers of cells could be
observed, as shown by labeling of nuclei with propidium iodide
(Fig. 2C). TEM analysis
confirmed that epithelial cells formed multilayers when grown on filter
supports, forming numerous interdigitations and making contact via desmosomes
(Fig. 2D).
|
Effects of acid pH on P3E6 cell growth
In attempts to investigate the role of acid pH on esophagus cells in
physiological conditions, exposure to pH 3.5 was started at D16 (D+0 of
acidification) when cells became confluent, differentiated and formed
multilayers, a condition resembling the in vivo cellular organization. The
porous filters allowed us to have independent access to the apical and to the
basal chamber of the culture. Acidified medium (pH 3.5) was added only to the
apical chamber of the culture, while neutral medium (pH 7.4) was maintained in
the basolateral chamber. In these conditions, no significant passage of medium
was observed between the upper and the basolateral chamber when checked by
analyzing the pH of the medium of the two chambers during the experiment.
Interestingly, the acid medium was not buffered by the neutral medium present
in the basolateral chamber, despite the absence of tight junctions. This
correlates with the results obtained by Orlando et al.
(Orlando et al., 1992
) showing
the presence of barriers to paracellular permeability in rabbit esophageal
epithelium.
Fig. 3 shows the effect of acidity on cell growth of P3E6 cultured at pH 7.4 or after continuous exposure to pH 3.5 on their apical side. Exposure of cells to pH 3.5 induced a significant decrease of the total cell number at D+1 of acid exposure. A plateau was then reached and remained constant between D+4 and D+20. However, when a new steady state was reached, the total number of P3E6 cells incubated at pH 3.5 on their apical side was decreased by 42% when compared with P3E6 cells maintained at pH 7.4 (Fig. 3). This suggests that acidification of the medium exerts a direct effect on the efficiency of multilayer formation. However, no significant decrease in CK4 expression was observed in the acidified and control cells (data not shown). In order to assess whether acid treatment affected cell proliferation, we examined PCNA expression. No difference in cell proliferation was noted after D+1 between cells exposed to acid or neutral medium at their apical pole (Fig. 3B). In contrast, when cells were exposed to acid pH on both sides, cells rapidly died (data not shown).
|
Long-term acidification of cultured cells lead to activation of the
cdx2 promoter
The vector pcdx2GFP consisting of the regulatory sequences of the mouse
cdx2 gene inserted immediately upstream of the coding sequence of the
green fluorescent protein (GFP) reporter gene was constructed to test whether
chronic exposure to acidity could induce activation of the promoter of the
cdx2 intestinal specific homeobox gene. Functionality of the
construct pcdx2GFP was checked by transfecting the intestinal Caco-2 cell
line, known to express high levels of CDX2 endogenous protein.
Immunofluorescent detection of GFP after transient transfection (48 hours) was
observed as expected (data not shown). Therefore, the pcdx2GFP plasmid was
considered suitable for the subsequent experiments.
The pcdx2GFP construct was stably transfected into P3E6 cells (P3E6K2) after selection with geneticin. These cells were then checked for GFP expression during the pH assay. On the basis of results obtained with the cell growth curve, the pH assay was performed by starting acid exposure at D16 (D+0) and maintained for a further period of 22 days (D+22). At intervals of two days, two filters cultured at each pH condition (pH 7.4 and pH 3.5) were fixed in methanol and checked for GFP expression. Persistent exposure to pH 3.5 of the apical side of P3E6K2 cells induced transcription of the GFP reporter gene as demonstrated by fluorescence microscopy analysis and western blot (Fig. 4). GFP-positive cells were observed at D+10 of exposure to pH 3.5. Between D+10 and D+14 the number of positive cells remained stable (8/12 ± 3 cells/filter of 0.33 cm2). The number of positive cells significantly increased at D+16 of exposure to pH 3.5. An average of 35 (±6) cells per filter were found positive at D+16. Fig. 4A shows a representative field of a filter at D+18 of exposure to pH 3.5, on which an islet of GFP-positive cells was observed. No GFP expression was observed during the same time of exposure of P3E6K2 cells to pH 7.4 (data not shown). Consistent with these observations, GFP expression was detected by western blot analysis only in the acid-exposed P3E6K2 cell extracts (Fig. 4B). To better characterize the degree of differentiation of P3E6K2 cells that expressed GFP under the control of cdx2 promoter, immunocytological analysis of CK14 and CK4 was performed. Fig. 4C,D show the same field of cells as figure 4A after an additional staining with the anti-CK14 and the anti-CK4 antibodies. GFP expressing cells were CK14 negative (Fig. 4C) but CK4 positive (Fig. 4D). Thus, the regulatory sequence of the cdx2 intestinal homeogene controlling the expression of GFP seemed to be activated only in the suprabasal differentiated P3E6 cells, suggesting that modification of the gene expression program by acid exposure occurred preferentially in the proliferative compartment.
|
P3E6 cells expressed the endogenous CDX2 protein when exposed at acid
pH
We then checked whether the acid-induced GFP expression under the control
of cdx2 regulatory sequence in P3E6K2 cells was consistent with the
induction of expression of the endogenous Cdx2 protein. Nontransfected P3E6
cells were seeded on filters and the pH assay was repeated as described above.
At the same time intervals as those chosen for GFP expression analysis in
P3E6K2 cells, immunocytochemical analysis was performed using an anti-CDX2
antibody on P3E6 cells. Fig.
5B,C show immunocytochemical analysis on P3E6 cells exposed to
acid or neutral pH. Caco2 cells, used as a positive control, displayed
homogenous nuclear staining of endogenous CDX2 protein as expected
(Fig. 5A). No staining was
detected in P3E6 cells cultured (D+18) at pH 7.4
(Fig. 5B).
Fig. 5C shows a representative
field of P3E6 cells at D+18 cultured at pH 3.5 and as expected expression of
Cdx2 protein was confined to P3E6 cell nuclei. Furthermore, the number of
endogeneous Cdx2 positive cells corresponded to the number of P3E6K2 cells in
which the construct Cdx2-promoter fused to GFP. These results were consistent
with those obtained by western blot analysis
(Fig. 5D), confirming
pH-dependent induction of Cdx2 protein expression. Intestinal Caco-2 cells,
used as a positive control, displayed a signal at 33 kDa corresponding to the
molecular weight of CDX2 protein. Expression of Cdx2 in P3E6, not detected at
pH 7.4, was observed as a function of pH (pH 5 and pH 3.5). It has to be noted
that in the western blot detection, two additional bands of lower and higher
molecular weight were always detected in P3E6 cell extracts but not in Caco-2
cells extracts. These additional bands did not vary with decreasing pH, and
did not display the expected molecular weight of Cdx2 (33 kDa), suggesting
that they could correspond to non-specific immunoreactions.
|
| Discussion |
|---|
|
|
|---|
Previous attempts to culture normal esophageal epithelium have been limited
mainly to explant cultures of rabbit (Stef
et al., 1981
), rat (Stoner et
al., 1982
) or human esophageal mucosa
(Resau et al., 1990
;
Vocci et al., 1983
;
Mothersill and Seymour, 1989
)
that are limited in time and do not allow chronic exposure to low pH. To the
best of our knowledge, we have for the first time, set up a system of
long-term culture of normal mouse esophageal cells. Remarkably, the cultured
cells reached the same cellular organization as observed in Malpighian
epithelium in vivo, showing homogeneous expression of cytokeratin 14 and
cytokeratin 4 in basal and suprabasal layers, respectively. On average we
could obtain four layers of cells. In addition, culture on filter support
provided the advantage that we could have independent access to each side of
the cell culture. The reproducibility of both the proliferation and
specialization patterns of the described primary esophageal cell culture
indicated that these cultures represented a useful tool for investigating
pathological mechanisms in functioning esophageal cells. These cultures
represented a controlled system in which the possible role of acid exposure in
the transdifferentiation process of normal esophageal cells into an intestinal
cell phenotype could be studied.
Acidification of the apical medium induced a rapid decrease in the number
of growing cells but cells rapidly adapted to this acid environment, did not
arrest proliferation and persisted in culture. Conversely, cells grown on
plastic supports or exposed at both sides at low pH, rapidly arrested
proliferation and died (data not shown). These results are in agreement with
other findings showing that esophageal cells possess an
H+-extruding mechanism at their apical surface to adapt to the
degree of lowering pH (Grinstein et al., 1998;
Tobey et al., 1998
).
To assess the effect of low pH on the conversion of normal esophageal cells
into intestinal cell type, we focused, in our study, on a very early marker of
intestinal differentiation, the intestinal transcription factor CDX2, assumed
to be a candidate that is activated during the first steps of the
esophageal-intestinal transition. The rationale resides in the fact that CDX2
has been shown to be crucial in the early step of intestinal cell
differentiation and in maintenance of intestinal phenotype
(Freund et al., 1992
;
James and Kazenwadel, 1991
;
James et al., 1994
;
Suh and Traber, 1996
;
Soubeyran et al., 1999
).
Interestingly, we have found expression of CDX2 in human Barrett esophagus
explants (data not shown) and this has been confirmed by a recent work
(Akashi et al., 2002
). It was
shown that CDX2 expression was initiated at the stage of esophagitis and was
maintained as strong nuclear staining in Barrett epithelium. These data
support our hypothesis that implies that CDX2 could be an early event leading
to the development of Barrett's esophagus (BE).
The implication of CDX2 in intestinal metaplasia has been recently
demonstrated in the intestinal metaplasia of the stomach where CDX2 was
ectopically overexpressed, suggesting that it could play a major role during
intestinal metaplasia formation in the stomach
(Bai et al., 2002
).
Furthermore, it has been shown that mice in which cdx2 gene has been
inactivated by homologous recombination developed multiple intestinal
polyp-like lesions that did not express CDX2 and that contained areas of
squamous metaplasia in the form of stratified squamous epithelium, similar to
that occurring in the mouse esophagus (Beck
et al., 1999
). This indirectly suggests a key role of
cdx2 in governing the differentiation process of squamous cells into
intestinal cells. In addition, it has been shown that acid exposure
significantly increases the activity of p38 MAPK in a Barrett's adenocarcinoma
cell line (Saouza et al., 2002); this consolidates our results since other
reports have shown that CDX2 plays a role in mediating p38 function in
enterocyte differentiation (Houde et al.,
2001
). Besides the observation of CDX2 expression in BE, the
factor(s) responsible for its activation and its expression have not been
studied before. In this study, we demonstrated that in a long-term culture
model of mouse esophageal cells the activation and the expression of Cdx2 may
result from chronic acid exposure alone. Furthermore, this change in genetic
program occurs in well-defined esophageal cultured cells, thus, suggesting
that BE can arise from Malphigian cells themselves, at least under some
particular physico-chemical conditions. Interestingly an electron microscopy
study revealed that P3E6 cells exposed to acid pH showed enlarged
extracellular spaces that were absent in cells exposed to neutral pH (data not
shown). A recent report by Tobey et al.
(Tobey et al., 1996
) presented
this feature as recurrent in patients having gastroesophageal reflux. This may
correlate with an early pathological event that, in the long term, could give
rise to the development of intestinal metaplasia. However, in our study, a
complete, typical metaplasia with well-differentiated intestinal cells could
not be reached by acid exposure alone. Expression of other intestinal markers
such as villin could not be observed by western blot analysis. However, villin
is expressed at a late stage of the intestinal transdifferentiation process of
esophageal cells, when cells have assumed morphologically an intestinal-like
phenotype. According to the literature, although acidity is considered as the
main factor associated to BE, the pathology is described as consequence of
multifactorial and multistep processes. Thus, a complete transdifferentiation
program probably needs other inducing environmental factors. This in vitro
model could be a potent tool to explore the role of acidity and modifications
of the physico-chemical microenvironment on specific gene expression. One can
speculate that P3E6 cells exposed to low pH must extrude protons and thus that
Na+/H+ exchanger could be involved, even indirectely, in
the pathway leading from pH 3.5 exposure to activation of the cdx2
gene.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Akashi, E., Kiichi, S., Ichiro, Y., Hiroyuki, O. and Kentaro, S. (2002). Comparative study of homeobox gene expression, in the inflammatory esophageal mucosa and Barrett's esophagus. Gastroenterology 122 Suppl.1, A-521.
Bai, Y. Q., Yamamoto, H., Akiyama, Y., Tanaka, H., Takizawa, T., Koike, M., Kenji Yagi, O., Saitoh, K., Takeshita, K., Iwai, T. and Yuasa, Y. (2002). Ectopic expression of homeodomain protein CDX2 in intestinal metaplasia and carcinomas of the stomach. Cancer Lett. 176,47 -55.[CrossRef][Medline]
Banks-Schlegel, S. and Green, H. (1981).
Involucrin synthesis and tissue assembly by keratinocytes in natural and
cultured human epithelia. J. Cell Biol.
90,732
-737.
Banks-Schlegel, S. P. and Harris, C. C. (1983). Tissue-specific expression of keratin proteins in human esophageal and epidermal epithelium and their cultured keratinocytes. Exp. Cell Res. 146,271 -280.[CrossRef][Medline]
Barbezat G. O. (1998). Recent advances. Gastroenterology 316,125 -128.
Barrett, N. R. (1950). Chronic peptic ulcer of the esophagus and esophagitis. Br. J. Surg. 38,175 -182.[Medline]
Beck, F., Chawengsaksophak, K., Waring, P., Playford, R. J. and
Furness, J. B. (1999). Reprogramming of intestinal
differentiation and intercalary regeneration in Cdx2 mutant mice.
Proc. Natl. Acad. Sci. USA
96,7318
-7323.
Blau, H. M., Brazelton, T. R. and Weimann, J. M. (2001). The evolving concept of a stem cell: entity or function? Cell 105,829 -841.[CrossRef][Medline]
Chaves, P., Cardoso, P., de Almeida, J. C., Pereira, A. D., Leitao, C. N. and Soares, J. (1999). Non-goblet cell population of Barrett's esophagus: an immunohistochemical demonstration of intestinal differentiation. Hum. Pathol. 30,1291 -1295.[CrossRef][Medline]
Compton, C. C., Warland, G., Nakagawa, H., Opitz, O. G. and Rustgi, A. K. (1998). Cellular characterization and successful transfection of serially subcultured normal human esophageal keratinocytes. Cell Physiol. 177,274 -281.
Egushi, G. and Kodama, R. (1993). Transdifferentiation. Curr. Opin. Cell Biol. 5,1023 -1028.[CrossRef][Medline]
Fitzgerald, R. C., Omary, M. B. and Triadafilopoulos, G. (1996). Dynamic effects of acid on Barrett's oesophagus. An ex vivo proliferation and differentiation model. J. Clin. Inv. 98,2120 -2128.[Medline]
Fitzgerald, R. C., Omary, M. B. and Triadafilopoulos, G. (1997). Acid modulation of HT29 cell growth and differentiation. J. Cell Science 110,663 -671.[Abstract]
Freund, J. N., Boukamel, R. and Benazzouz, A. (1992). Gradient expression of CDX along the rat intestine throughout postnatal development. FEBS Lett 314,163 -166.[CrossRef][Medline]
Goldstein, S. R., Yang, G., Curtis, S. K., Reuhl, K. R., Liu, B., Mirvish, S. S., Newmark, H. L. and Yan, C. S. (1997). Development of esophageal metaplasia and adenocarcinoma in a rat surgical model without the use of a carcinogen. Carcinogenesis 11,2265 -2270.
Gordon, J. I., Hooper, L. V., McNevin, M. S., Wong, M. and Bry, L. (1997). Ephitelial cell growth and differentiation. III. Promoting diversity in the intestine: conversations between the microflora, ephitelium, and diffuse GALT. Am. J. Physiol. 273,G565 -G570
Grinstein, S., Rotin, D. and Mason, M. J. (1989). Na+/H+ exchange and growth factor-induced cytosolic pH changes. Role in cellular proliferation. Biochim. Biophys. Acta 988, 73-97.[Medline]
Harrison, R. F., Perry, I. and Jankowski, J. A. (2000). Barrett's mucosa: remodelling by the microenvironment. J. Pathol. 192,1 -3.[Medline]
Houde, M., Laprise, P., Jean, D., Blais, M., Asselin, C. and
Rivard, N. (2001). Intestinal epithelial cell differentiation
involves activation of p38 mitogen-activated protein kinase that regulates the
homeobox transcription factor CDX2. J. Biol. Chem.
276,21885
-21894.
James, R. and Kazenwadel, J. (1991). Homeobox
gene expression in the intestinal epithelium of adult mice. J.
Biol. Chem. 266,3246
-3251.
James, R., Erler, T. and Kazenwadel, J. (1994).
Structure of the murine homeobox gene cdx2. Expression in embryonic
and adult intestinal epithelium. J. Biol. Chem.
269,15229
-15237.
Jankowski, J. A., Harrison, R. F., Perry, I., Balkwill, F. and Tselepis, C. (2000). Barrett's metaplasia. Lancet 356,2079 -2085.[CrossRef][Medline]
Kaur, B. S., Ouatu-Lascar, R., Omary, M. B. and
Triadafilopoulos, G. (2000). Bile salts induce or blunt cell
proliferation in Barrett's esophagus in an acid-dependent fashion.
Am. J. Physiol. Gastrointest. Liver Physiol.
278,G1000
-1009.
Kerneis, S. and Pringault, E. (1999). Plasticity of the gastrouodenal epithelium: the M cell paradigm and opportunismof pathogenic microorganisms. Semin. Immunol. 11,205 -215.[CrossRef][Medline]
Kraus, M., Leipziger, J., Fischer, K. G., Nitschke, R. and Hreger, R. (1994). Relevance of microenvironmental pH for self-organized tumor growth and invasion. Anticancer Res. 14,1573 -1583.[Medline]
Kumble, S., Omary, M. B., Fajardo, L. F. and Triadafilopoulos, G. (1996). Multifocal heterogeneity in villin and Ep-CAM expression in Barrett's esophagus. Int. J. Cancer 66, 48-54.[CrossRef][Medline]
Kumble, S., Omary, M. B., Cartwright, C. A. and Triadafilopoulos, G. (1997). Src activation in malignant and premalignant epithelia of Barrett's esophagus. Gastroenterology 112,348 -356.[CrossRef][Medline]
Mallo, G. V., Rechreche, H., Frigerio, J. M., Rocha, D., Zweibaum, A., Lacasa, M., Jordan, B. R., Dusetti, N. J., Dagorn, J. C. and Iovanna, J. L. (1997). Molecular cloning, sequencing and expression of the mRNA encoding human Cdx1 and Cdx2 homeobox. Down-regulation of Cdx1 and Cdx2 mRNA expression during colorectal carcinogenesis. Int. J. Cancer 74, 35-44.[CrossRef][Medline]
Martin, G. and Jain, R. (1994). Noninvasive
measurement of interstitial pH profiles in normal and neoplastic tissue using
fluorescence ratio imaging microscopy. Cancer Res.
54,5670
-5674.
Mothersill, C. and Seymour, C. B. (1989). Lethal mutations in cultured mammalian cells. Int. J. Radiat. Biol. 55,155 -156.[Medline]
Orlando, R. C., Lacy, E. R., Tobey, N. A. and Cowart K. (1992). Barriers to paracellular permeability in rabbit esophageal epithelium. Gastroenterology 102,910 -923.[Medline]
Ouatu-Lascar, R., Fitzgerald, R. C. and Triadafilopoullos, G. (1999). Differentiation and prolifaration in Barrett's esophagus and the effect of acid suppression. Gastroenterology 117,327 -335.[CrossRef][Medline]
Palanca-Wessels, M. C., Barrett, M. T., Galipeau, P. C., Rohrer, K. L., Reid, B. J. and Rabinovitch, P. S. (1998). Genetic analysis of long-term Barrett's esophagus epithelial cultures exhibiting cytogenetic and ploidy abnormalities. Gastroenterology 114,295 -304.[CrossRef][Medline]
Reid, B. J. (1991). Barrett's esophagus and esophageal adenocarcinoma. Gastroenterol. Clin. North Am. 20,817 -834.[Medline]
Resau, J. H., Phelps, P. C., Zhu, S. M., Smoot, D., Lee, H. K., Cottrell, R., Hudson, E. A. and Elliget, K. A. (1990). Long-term culture of human esophageal explants and cells. Cytotechnology 3,61 -73.[CrossRef][Medline]
Rheinwald, J. G. and Beckett, M. A. (1980). Defective terminal differentiation in culture as a consistent and selectable character of malignant human keratinocytes. Cell 22 Pt 2,629 -632.
Sharma, P. (1999). Recent advances in Barrett's esophagus: short-segmant Barrett's esophagus and cardia intestinal metaplasia. Semin. Gastrointest. Dis. 10, 93-102.[Medline]
Slack, J. M. W. (1985). Homeotic transformation in man: implications for the machanism of embryonic development and for the organization of the epithelia. J. Theor. Biol. 114,463 -490.[Medline]
Slack, J. M. W. (1986). Epithelial metaplasia and the second anatomy. Lancet 2, 268-271.[Medline]
Slack, J. M. W. and Tosh, D. (2001). Transdifferentiation and metaplasia switching cell types. Curr. Opin. Genet. Dev. 11,581 -586.[CrossRef][Medline]
Soubeyran, P., Andre, F., Lissitzky, J. C., Mallo, V. G., Moucadel, V., Roccabianca, M., Rechreche, H., Marvaldi, J., Dikic, I., Dagorn, J. C. and Iovanna, L. J. (1999). Cdx1 promotes differentiation in a rat intestinal epithelial cell line. Gastroenterology 117,1326 -1338.[CrossRef][Medline]
Souza, R. F., Morales, C. P. and Spechler, S. J. (2001). Review article: a conceptual approach to understanding the molecular mechanisms of cancer development in Barrett's oesophagus. Aliment Pharmacol. Ther. 15,1087 -1100.[CrossRef][Medline]
Souza, R. F., Shewmake, K., Terada, L. S. and Spechler, S. J. (2002). Acid exposure activates the mitogen-activated protein kinase pathways in Barrett's esophagus. Gastroenterology 122,299 -307.[CrossRef][Medline]
Spechler, S. J. and Goyal, R. K. (1996). The columnar-lined esophagus, intestinal metaplasia and normal Barrett. Gastroenterology 110,614 -621.[Medline]
Stef, J. J., Zboralske, F. F. and Karasek, M. A. (1981). In vitro culture of rabbit esophageal epithelial cells. Gastroenterology 81,30 -36.[Medline]
Stoner, G. D., Babcock, M. S., Cothern, G. A., Klaunig, J. E.,
Gunning, W. T., III and Knipe, S. M. (1982). In vitro
transformation of rat esophageal epithelial cells with
N-nitrosobenzylmethylamine. Carcinogenesis
3, 629-634.
Stoner, G. D., Kaighn, M. E., Reddel, R. R., Resau, J. H.,
Bowman, D., Naito, Z., Matsukura, N., You, M., Galati, A. J. and Harris, C.
C. (1991). Establishment and characterization of SV40
T-antigen immortalized human esophageal epithelial cells. Cancer
Res. 51,365
-371.
Suh, E. and Traber, P. G. (1996). An intestine-specific homeobox gene regulates proliferation and differentiation. Mol. Cell. Biol. 16,619 -625.[Abstract]
Tobey, N. A., Carson, J. L., Alkiek, R. A. and Orlando, R. C. (1996). Dilated intercellular spaces: a morphological feature of acid reflux-damaged human esophageal epithelium. Gastroenterology 111,1200 -1205.[CrossRef][Medline]
Tobey, N. A., Koves, M. D. and Orlando, R. C. (1998). Human esophageal cells possess an Na+/H+ exchanger for H+ extrusion. Am. J. Gastroenterol. 93,2075 -2081.[CrossRef][Medline]
Tosh, D. and Slack, J. M. W. (2002). How cells change their phenotype. Nature Reviews Mol. Cell. Biol. 3,187 -194.[CrossRef][Medline]
Troelsen, J. T., Mitchelmore, C., Spodsberg, N., Jensen, A. M., Noren, O. and Sjostrom, H. (1997). Regulation of lactase-phlorizin hydrolase gene expression by the caudal-related homeodomain protein Cdx2. J. Biochem. 322,833 -838.
Vaezi, M. F., Singh, S. and Richter, J. E. (1995). Role of acid and duodenogastric reflux in esophageal mucolal injury; a review of animal and human studies. Gastroenterology 108,1197 -1907.[CrossRef]
Vocci, M. J., Combs, J. W., Hillman, E. A., Resau, J. H. and Trump, B. F. (1983). The cell kinetics of the adaptation of the human esophagus to organ culture. In Vitro 19,881 -891.[Medline]
Xu, X., III, LoCicero, J., Macri, E., Loda, M. and Ellis, F. H., Jr (2000). Barrett's esophagus and associated adenocarcinoma in a mouse surgical model. J. Surg. Res. 88,120 -124.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
C.-L. Chang, P. Lao-Sirieix, V. Save, G. De La Cueva Mendez, R. Laskey, and R. C Fitzgerald Retinoic acid-induced glandular differentiation of the oesophagus Gut, July 1, 2007; 56(7): 906 - 917. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Liu, X. Zhang, C.-K. So, S. Wang, P. Wang, L. Yan, R. Myers, Z. Chen, A. P. Patterson, C. S. Yang, et al. Regulation of Cdx2 expression by promoter methylation, and effects of Cdx2 transfection on morphology and gene expression of human esophageal epithelial cells Carcinogenesis, February 1, 2007; 28(2): 488 - 496. [Abstract] [Full Text] [PDF] |
||||
![]() |
R C Fitzgerald Molecular basis of Barrett's oesophagus and oesophageal adenocarcinoma. Gut, December 1, 2006; 55(12): 1810 - 1820. [Full Text] [PDF] |
||||
![]() |
Z. Fan, J. Li, B. Dong, and X. Huang Expression of Cdx2 and Hepatocyte Antigen in Gastric Carcinoma: Correlation with Histologic Type and Implications for Prognosis Clin. Cancer Res., September 1, 2005; 11(17): 6162 - 6170. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-L. Wang, M. E. Shin, P. A. Knight, D. Artis, D. G. Silberg, E. Suh, and G. D. Wu Regulation of RELM/FIZZ isoform expression by Cdx2 in response to innate and adaptive immune stimulation in the intestine Am J Physiol Gastrointest Liver Physiol, May 1, 2005; 288(5): G1074 - G1083. [Abstract] [Full Text] [PDF] |
||||
![]() |
L M G Moons, D A Bax, E J Kuipers, H van Dekken, J Haringsma, A H M van Vliet, P D Siersema, and J G Kusters The homeodomain protein CDX2 is an early marker of Barrett's oesophagus J. Clin. Pathol., October 1, 2004; 57(10): 1063 - 1068. [Abstract] [Full Text] [PDF] |
||||
![]() |
M T Kennedy, R C K Jordan, K W Berean, and B Perez-Ordonez Expression pattern of CK7, CK20, CDX-2, and villin in intestinal-type sinonasal adenocarcinoma J. Clin. Pathol., September 1, 2004; 57(9): 932 - 937. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||