|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 25 February 2003
doi: 10.1242/jcs.00337
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
1 Lehrstuhl für Genetik, Universität Regensburg, 93040 Regensburg,
Germany
2 Departamento de Microbiologia, Facultad de Biologia, Universidad de Sevilla
Apdo. 1095, 41080-Sevilla, Spain
3 Botanisches Institut, Universität zu Köln, 50931 Köln,
Germany
4 Laboratory of Gene Expression, 1st Faculty of Medicine, Charles University and
Department of Cell Biology, Institute of Experimental Medicine, Academy of
Sciences of the Czech Republic, Prague, Czech Republic
* Author for correspondence (e-mail: wolfgang.mages{at}biologie.uni-regensburg.de)
Accepted 21 December 2002
| Summary |
|---|
|
|
|---|
Key words: Basal body, Centriole, Flagella, Microtubule associated proteins, Antisense RNA
| Introduction |
|---|
|
|
|---|
More recently, Chlamydomonas has been gaining importance in the
field of basal bodies/centrioles (Dutcher,
1995b
; Marshall and Rosenbaum,
2000
), because it possesses a well-defined microtubule (MT)-based
cytoskeleton (LeDizet and Piperno,
1986
; Marshall and Rosenbaum,
2000
; Silflow and Lefebvre,
2001
) the most prominent structures being two (9x2 +2)
flagella and two basal bodies (also called kinetosomes), which are very
similar to the cilia and centrioles, respectively, of animals and humans both
in structure and function (Salisbury et
al., 1989
; Salisbury,
1995
; Geimer et al.,
1997
). Both of these structures are areas of intensive research
(Pazour et al., 2000
;
Yagi, 2000
;
Deane et al., 2001
;
Marshall and Rosenbaum, 2001
;
Silflow and Lefebvre, 2001
;
Sloboda, 2002
). Flagella/cilia
consist of about 250 different polypeptides
(Dutcher, 1995a
), and roughly
200 of these have already been identified both by conventional methods and by
a recent proteomic analysis of human cilia
(Dutcher, 1995a
;
Ostrowski et al., 2002
). By
contrast, basal bodies/centrioles play an important role in mitosis and
subsequent cell cleavage (Johnson and
Porter, 1968
; Ehler et al.,
1995
; Paoletti and Bornens,
1997
; Lechtreck and Grunow,
1999
; Marshall and Rosenbaum,
2000
) and contain about 200 different polypeptides
(Dutcher, 1995b
). However, few
basal body proteins have been described to date, including centrin in the
basal body distal lumen, the microtubule-nucleating protein
-tubulin in
the basal body proximal lumen (Fuller et
al., 1995
; Marshall and
Rosenbaum, 2000
) and
-tubulin
(Dutcher and Trabuco, 1998
),
which is necessary for triplet MT formation.
Since both, flagella/cilia and centrioles consist mainly of MTs, it can be
expected that proteins stabilizing these MTs or mediating their interaction
with other cellular components will be among the constituents of these
organelles still to be found. Examples of such MT-associated proteins (MAP)
that are already known components of human flagella or the mammalian
centrosome are RS20 (Whyard et al.,
2000
) and a protein related to brain MAP1B
(Dominguez et al., 1994
),
respectively.
In this report we describe a new component of the MT cytoskeleton that we
call deflagellation-inducible protein of 13 kDa (DIP13). We have found DIP13
and its human counterpart NA14
(Ramos-Morales et al., 1998
)
associated with MTs both in flagellar axonemes and obviously more
concentrated in basal bodies/centrioles in both organisms. Reducing
the intracellular amount of DIP13 protein in Chlamydomonas by RNAi
interfered with cell division, resulting in multinucleate, multiflagellate
cells. Our current results suggest that DIP13/NA14 is an important general
component of the MT cytoskeleton probably with a MT-stabilizing or connecting
function.
| Materials and Methods |
|---|
|
|
|---|
HeLa and COS-7 cells were grown in Dulbecco's modified Eagle medium (Gibco, Life Technologies, Spain) supplemented with 10% fetal calf serum (FCS). The KE37 cell line of T lymphoblastic origin was cultivated in RPMI 1640 medium (Gibco) containing 7% FCS. Both media contained 2 mM L-glutamine, 100 U/ml penicillin and 100 µg/ml streptomycin. Cells were maintained in a 5% CO2 humidified atmosphere at 37°C.
Flagellar fractionation
To prepare flagellar extracts for immunoblots, experimental deflagellation
and collection of flagella followed the dibucaine method
(Witman, 1986
). Membranes were
solubilized from isolated flagella with 2% NP-40, and axonemes collected by
centrifugation. The membrane/matrix fraction was removed, and axonemal pellets
were resuspended in HMDEK (10 mM HEPES, 5 mM MgSO4, 1 mM DTT, 0.5
mM EDTA, 25 mM KCl). Concentrated SDS-PAGE sample buffer was added to both
fractions prior to electrophoresis.
Nucleic acid procedures
Isolation of DNA, Southern and northern analyses and cloning procedures
followed standard protocols (Sambrook et
al., 1989
). Plasmid DNA from E. coli,
DNA from
lysates of recombinant phages, and DNA-fragments from agarose gels were
prepared using commercially available purification systems (Qiagen, Hilden,
Germany). RNA from C. reinhardtii was isolated according to Baker et
al. (Baker et al., 1986
) and
mRNA was isolated from total RNA using the oligotex dT mRNA purification
system (Qiagen).
RT-PCR amplification
Reverse transcription of 500 ng C. reinhardtii (strain CC125 MT+)
mRNA isolated from cultures 50 minutes after mechanical deflagellation was
accomplished using random hexamer primers and MuMLV reverse transcriptase
(United States Biochemical, Cleveland, OH). For the original amplification of
a DIP13 specific probe, PCR was carried out with degenerate 23-mer
primers, 5'-GGIGA(G/A)(A/T)(G/C)IGGIGCIGGNAA(G/A)AC (upstream primer)
and 5'-GT(C/T)TTI GC(G/A)TTICC(G/A)AAIGC(C/T)TC (downstream primer).
Fragments of 140 to 170 bp were cloned after nucleotide fill-in reactions into
the EcoRV site of pUC BM20 (Boehringer Mannheim, Germany) and
individual clones were sequenced. One of these clones, pDIP, carrying an
insert of 145 bp, was used as a hybridization probe in northern and Southern
analyses as well as for screening DNA libraries. RT-PCR amplification of the
5' untranslated region of DIP13 was performed after
determination of the exon-intron structure. For this purpose, PCR was carried
out on reverse-transcribed mRNA using a downstream primer overlapping exons 1
and 2 (5'-CCT CGA TGC ATT TTA CTA GC; nucleotides 1058-1050 and 946-936
of the DIP13 genomic sequence) and an upstream primer (5'-GCA
CCC AAA GCG ACA TCA TC; nucleotides 227-246) derived from the putative
DIP13 5' untranslated region. PCR was carried out for 40 cycles
(1 minute 95°C, 1 minute 60°C and 1 minute 30 seconds 72°C).
Amplification yielded the expected product of
700 bp, which was sequenced
directly.
Isolation of genomic and cDNA clones
20 DIP13-specific clones from a
lEMBL3-based C.
reinhardtii genomic library
(Goldschmidt-Clermont, 1986
),
four cDNA clones from a cDNA library in
lZAPII
(Wilkerson et al., 1998
) and
20 cDNA clones from a cDNA library in
ExLox (Paul A. Lefebvre,
personal communication) were isolated using the cloned 145-bp fragment from
pDIP as a probe.
DNA sequencing
-DNA and RT-PCR fragments were sequenced manually with the
T7-Sequenase quick-denature plasmid sequencing kit (Amersham Life Science,
Cleveland, OH) or the Thermo Sequenase radiolabeled terminator cycle
sequencing kit (Amersham Life Science, Cleveland, OH). Plasmid subclones were
sequenced by primer walking using gene specific primers and fluorescent
dye-terminator sequencing with an ABI Prism 310 automated sequencer (Applied
Biosystems, Foster City, CA).
Computer-assisted protein analysis
Theoretical analysis of the DIP13 amino acid sequence and structure was
done using the PredictProtein server of the EMBL Institute in Heidelberg
(http://www.embl-heidelberg.de/predictprotein).
Blast searches (Altschul et al.,
1997
) were performed on the NCBI server
(http://www.ncbi.nlm.nih.gov/BLAST),
Bethesda, USA.
Production of recombinant DIP13
The complete DIP13 open reading frame (ORF) was amplified by PCR
with two gene-specific primers from a cDNA clone. Upstream
(5'-CATAGGATCCATGTCTGCTCAAGGCCAAGCTC) and downstream
primers (5'-CTG CAAGCTTTCAAGAGCTGGCCTGCTTCTTC) were
binding at the translational start and stop codons (bold italics),
respectively. The first 10 nucleotides of each 32-mer introduced a
BamHI (upstream, bold) and a HindIII site (downstream, bold)
into the 356 bp PCR fragment, allowing to clone the RT-PCR fragment into the
His6 fusion vector pQE30 (Qiagen, Hilden, Germany) via
BamHI and HindIII giving rise to plasmid
pQE30/DIP13. Following retransformation of the sequence-verified
construct, recombinant DIP13 was purified from E. coli strain M15
pREP4 under denaturing conditions according to the supplier's protocol.
Construction of antisense plasmid pVW1
Plasmid pVW1 is based on cloning vector pIC20R
(Marsh et al., 1984
) and was
constructed for in vivo expression of the DIP13 open reading frame
(derived from pQE30/DIP13) in inverse orientation from a modified
C. reinhardtii hybrid promoter (M. Fuhrmann, personal communication)
(Schroda et al., 2000
)
containing sequences from the C. reinhardtii Hsp70A and
RBCS2 gene promoters. Individual sequences were derived from plasmid
pMF59 (M. Fuhrmann, personal communication), which in turn is a derivative of
plasmid pMF124cGFP (Fuhrmann et al.,
1999
). In brief, pVW1 contains the following sequences in the
order given between the single BglII and KpnI sites of
pIC20R, starting with the hybrid BglII/BamHI-site
(underlined) that originated from cloning: the sequence
5'AGATCCACTATAGGGCGAATTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGA
followed by bases 559 to 826 (accession no. M76725) from the C.
reinhardtii Hsp70A gene promoter. This sequence is followed by the bases
5'-GCTAGCTTAAGATCCCAAT joining Hsp70A to RBCS2 gene
bases 935 to 1146 (accession no. X04472). These are followed by the sequence
5'-CTGCAGCTT containing a filled-in partial HindIII
site (underlined), which in turn is followed by the complete inverse open
reading of the DIP13 gene set free from plasmid pQE30/DIP13
with BamHI after prior linearization with HindIII and
fill-in reaction to create a blunt HindIII- end for cloning.
Consequently, the inverse DIP13 ORF is immediately followed by the
sequence 5'-GGATCCC containing a BamHI site
(underlined) followed by bases 2401 to 2626 (accession no. X04472) from the
C. reinhardtii RBCS2 gene 3'region, the latter providing a
functional polyadenylation signal. The final bases
5'-TAAGCGGGTACC contain the KpnI site at the
3'end of the construct used for cloning into pIC20R. The resulting
plasmid, pVW1, is shown in
Fig.7A.
|
|
-tubulin used for indirect immunofluorescence has been described
(Silflow and Rosenbaum, 1981
-tubulin and used on immunoblots, was purchased from
Sigma. Anti-L23-antibody (McElwain et al.,
1993
-tubulin
antibody was purchased from Sigma and monoclonal anti-HA antibody was from
Amersham Life Science, Cleveland, OH.
Transient transfection of COS-7 cells
The full-length na14 ORF
(Ramos-Morales et al., 1998
)
was cloned in frame with the HA epitope
(Wilson et al., 1984
) into the
eukaryotic expression vector pECE (Ellis
et al., 1986
) to obtain an HA-epitope tagged NA14. The resulting
plasmid was purified (see below) followed by phenol extraction and ethanol
precipitation. COS-7 cells were split 24 hours before transfection so that
they were 60-80% confluent for transfection. 2-5x106
cells/assay were resuspended in 200 µl of 15 mM HEPES buffered
serum-containing medium, mixed with 50 µl of 210 mM NaCl containing 10
µg plasmid DNA and electroporated using a BioRad Gene Pulser. Six hours
after electroporation, medium was replaced by fresh medium and cells were
processed after 24 hours.
Cell fractionation, immunoprecipitation and preparation of
centrosomes
For lysis, COS-7 cells were harvested and washed in PBS.
2x107 cells per ml were lysed at 4°C in NP-40 buffer (10
mM Tris-HCl pH 7.4, 150 mM NaCl, 1% NP-40, 1 mM phenyl methyl sulfonyl
fluoride (PMSF) and 1 µg/ml of pepstatin, leupeptin and aprotinin) for 20
minutes. The extract was centrifuged at 15,000 g for 20
minutes and both supernatant (soluble fraction) and pellet (insoluble
fraction) were stored at 70°C. For immunoprecipitation experiments,
soluble fraction of HA-NA14-transfected cells or recombinant DIP13, as a
positive control, were preadsorbed with 10 µl of preimmune serum on 50
µl of protein-A-Sepharose and immunoprecipitated with 10 µl of
anti-DIP13 serum on 50 µl of protein-A-Sepharose. After incubation and
washing, bead pellets and supernatants were analyzed by immunoblotting using
anti-NA14 or anti-HA antibodies.
Detergent-soluble and insoluble cell fractions from KE37 cells were
obtained by a brief treatment of cells at 4°C with 1% NP-40, 0.5% sodium
deoxycholate in TNM buffer (10 mM Tris-HCl pH 7.4, 150 mM NaCl, 5 mM
MgCl2) containing protease inhibitors. Centrosomes from KE37 cells
were isolated essentially as described
(Bornens et al., 1987
).
Electrophoresis and immunoblotting
For analyzing total cells, extracts from 106 to
3x106 C. reinhardtii cells in sample buffer were run
per lane on 15% SDS-PAGE gels and electroblotted. Immunoblots were incubated
with anti-DIP13 antibody diluted 1:500, anti-L23-antibody diluted 1:500 and
anti-
-tubulin antibody (B-5-1-2) diluted 1:2500 respectively, followed
by incubation with secondary goat anti-rabbit antibody (or goat anti-mouse
antibody in the case of B-5-1-2) conjugated to peroxidase (1:5000; Sigma, St
Louis, MO) and detection using the ECL system (Amersham Pharmacia Biotech,
Uppsala, Sweden). Densitometric quantification of immunoblots was performed
using the software Optiquant of Packard Instrument Company (Meriden,
CT).
Proteins from mammalian cells were separated on 13.5% SDS-PAGE gels, followed by electroblotting. Nitrocellulose filters were blocked for 1 hour at 37°C in TBST (10 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.1% Tween 20) containing 5% nonfat dry milk. Then filters were incubated for 1-2 hours at 37°C in the primary antibody diluted in TBST/5% nonfat dry milk, washed in the same buffer, and incubated for 45 minutes at 37°C with secondary anti-rabbit or anti-mouse antibodies conjugated with peroxidase (Amersham Life Science, Cleveland, OH). After washes with TBST, peroxidase activity was revealed using the ECL system (Amersham Life Science, Cleveland, OH).
Indirect immunofluorescence
Indirect immunofluorescence was performed with C. reinhardtii
strain CC124 MT+ after treatment of cells with autolysin to remove cell walls
as described (Kozminski et al.,
1993
). Anti-DIP13 antiserum was used at a dilution of 1:50 and
anti-
-tubulin serum at a dilution of 1:500, respectively. As secondary
antibody, Alexa-Fluor488-conjugated goat anti-rabbit IgG (Molecular Probes,
Oregon) was used at a dilution of 1:400 for 2 hours. Microscopy was performed
under epifluorescence on an Olympus BX60F microscope (Olympus Optical Co.,
Hamburg, Germany) and images were taken using Kodak TMax 400 or EliteChrome
200 films (Kodak, Stuttgart, Germany). For nucleic acid staining, 0.2 µg/ml
DAPI (Sigma, München, Germany) was used.
For immunofluorescence, HeLa cells were grown on culture-treated slides for
24-48 hours before an experiment. Cells were rinsed twice with phosphate
buffered saline (PBS) and incubated in methanol at 20°C for 6
minutes to simultaneously fix and permeabilize the cells. Ejaculated
spermatozoa were obtained after an abstinence period of 2-4 days from two
fertile donors. Samples were diluted with fresh DMEM medium and incubated for
1 hour at 37°C. Motile spermatozoa were harvested, rinsed twice in PBS and
methanol-fixed as above. After methanol treatment, cells were processed as
described (Rios et al., 1994
).
Immunofluorescence analysis was performed on a Leica epifluorescence
microscope.
Immunoelectron microscopy
For postembedding immunogold electron microscopy C. reinhardtii
cytoskeletons (strain cw15+) were isolated as described
(Wright et al., 1985
) and
fixed in MT-buffer (30 mM HEPES, 5 mM Na-EGTA, 15 mM KCl, pH 7.0) containing
2% paraformaldehyde and 0.25% glutaraldehyde for 40 minutes at 15°C. The
cytoskeletons were dehydrated to 95% ethanol on ice and infiltrated with LR
Gold resin (Plano, Marburg, Germany) at 20°C for 36 hours. For
polymerization we used LR Gold resin containing 0.4% benzil and fluorescent
light at 20°C. Immunogold labeling of ultrathin sections was
performed as described previously (Robenek
et al., 1987
) with minor modifications. The anti-DIP13 antibody
(1:30 to 1:50) was applied at 4°C overnight and detected with goat
anti-rabbit-IgG conjugated to 10 nm or 15 nm gold particles (British BioCell,
Cardiff, UK).
Ultrathin sections <80 nm were obtained using a diamond knife (Diatome,
Biel, CH) on a RMC MT-6000 microtome (RMC, Tucson, AZ), mounted on
Pioloform-coated slot grids and stained with lead citrate and uranyl acetate
(Reynolds, 1963
). Micrographs
were taken with a Philips CM 10 transmission electron microscope using
Scientia EM film (Agfa, Leverkusen, Germany).
| Results |
|---|
|
|
|---|
-tubulin mRNA
(Baker et al., 1986
|
We then used the pDIP probe to screen a
EMBL3 genomic library of
C. reinhardtii
(Goldschmidt-Clermont, 1986
)
and isolated 20 DIP13-specific clones. A genomic sequence of 2898 bp
was obtained from one of these clones after suitable subcloning into plasmids
as described in Materials and Methods. This sequence is available from GenBank
under accession number AF131736. The complete DIP13 cDNA sequence was
assembled from several overlapping cDNA clones and RT-PCR fragments. It
contains a 333 bp open reading frame (ORF) potentially encoding a 13 kDa
protein. Database searches revealed that this protein is very similar to a
similar sized protein from humans, NA14
(Fig. 2A)
(Ramos-Morales et al., 1998
),
indicating that the predicted ORF and gene structures are correct. Southern
and sequence analyses further showed that DIP13 is a single copy gene
interrupted by two introns (Fig.
2B,C).
|
The 5' end of DIP13 mRNA was not determined precisely, but
according to the results of several RT-PCR experiments (data not shown) the
5' untranslated region has a minimal length of 669 bp
(Fig. 2B). Five different
polyadenylation signals have been identified in the 3' untranslated
region (Fig. 2B,
Table 1) by sequencing
individual cDNA clones. None of these signals, located 308 to 666 bp
downstream of the TGA stop codon, has the typical pentanucleotide consensus
TGTAA normally found in green algae
(Schmitt et al., 1992
) but
each is followed by a polyA tail starting 12 to 13 nucleotides after the last
base of the signal. It is likely that all five signals are used at the same
time, as indicated by the unusually broad signals obtained on northern blots
(Fig. 1).
|
The derived DIP13 protein consists of 111 amino acids with a
Mr of 12.7x103 and an isoelectrical point
of 8.39. DIP13 is predicted to be all
-helical
(Rost and Sander, 1993
;
Rost and Sander, 1994
) and to
our knowledge is the smallest
-helical protein known to date.
Remarkably, DIP13 also contains a short sequence (KREE; amino acids 25-28;
Fig. 2A) reminiscent of the
MT-binding motif KKEE (or KKEI/V) found in the
structural MT-associated protein, MAP1B
(Noble et al., 1989
). The
N-terminal region of DIP13 contains a sequence motif reminiscent of a leucine
zipper (Fig. 2A; amino acids
8-22), which is known to promote dimerization through
-helical
coiled-coil formation. Consistent with this feature we have found during FPLC
purification that recombinant DIP13 has a marked tendency to form oligomers
(data not shown). Moreover, the PROSITE Dictionary of Protein Sites and
Patterns revealed consensus motifs for N-glycosylation, casein kinase II
phosphorylation and PKC phosphorylation
(Fig. 2A).
Close homologs of Chlamydomonas DIP13 are present in humans and
mice. While the mouse sequence has only been filed in GenBank (accession
number AA274144) as a currently unnamed protein, the human homolog NA14
(accession number Z96932) has been identified by Ramos-Morales et al. as an
autoantigen found in patients with Sjögren's syndrome
(Ramos-Morales et al., 1998
).
These two proteins share 60% amino acid sequence identity with DIP13 and have
the same overall structural features (Fig.
2A). However, DIP13/NA14 are not restricted to green algae and
mammals, as homologous sequences are present in the genomes of several
protozoan parasites, a trematode and a fish
(Table 2). These predicted
proteins share from 30% to 64% identity with DIP13/NA14. However, no homologs
could be detected by database searches in the completed genomes of yeast,
Drosophila, C. elegans and A. thaliana.
|
DIP13 expression during the cell cycle
An anti-DIP13 polyclonal antiserum was raised in rabbit and its specificity
was tested on C. reinhardtii whole cell extracts
(Fig. 3A). As shown in the left
panel, both the preimmune and crude sera detected four to six crossreacting
bands between 15 and 60 kDa, while affinity-purified anti-DIP13 antiserum
shows only the one expected band at 13 kDa. This band is not detected by the
preimmune serum but is also present in crude serum. In addition, preincubation
of affinity-purifed anti-DIP13 serum with recombinant DIP13 protein
successfully prevents detection of the 13 kDa protein in
Chlamydomonas extracts (Fig.
3A, right panel). Therefore we conclude that our polyclonal
anti-DIP13 antiserum specifically and sensitively detects DIP13 protein.
|
Preliminary experiments for testing DIP13 expression along the C.
reinhardtii life cycle (Fig.
3B) were carried out by taking samples from synchronized cultures
every 2 hours. Samples were then processed in parallel by western blotting
using anti-DIP13 antiserum or by northern blotting with a DIP13-specific cDNA
probe. Two maxima of expression, one during the period of cell division and
the other about 6 hours later after the beginning of the light phase following
cell division were detected (data not shown). We first focussed on the maximum
of DIP13 expression during C. reinhardtii cell division. To this end,
100 cells per time point from a synchronized culture were analyzed by light
microscopy for their division stage hourly
(Fig. 3B). At the same time
points, samples were taken from these cultures and identical amounts of total
protein were analyzed on immunoblots (Fig.
3C) using three different antibodies, namely anti-DIP13, anti
-tubulin and anti-L23 (McEwain et al., 1993). The latter detects a
ribosomal protein and served as a loading control together with a
Coomassie-stained gel also presented in
Fig. 3C. As shown, DIP13
protein levels are clearly elevated between hours 0 (onset of division) and 4
(mid-divison). After 5 hours, when most cells are in the 4- (37 cells), 8- (10
cells) or (new) 1-cell stage (43 daughter cells) and division is close to
completion, the amount of DIP13 is clearly decreased again and stays low until
hour 7. Increased protein levels were also seen for
-tubulin from hour
0 but unlike DIP13 these levels did not go down after completion of division.
As expected, the amount of L23 protein stayed constant throughout the
experiment. In summary, these data substantiated that Chlamydomonas
cells need increased amounts of DIP13 during cell division (as is the case for
flagellar biosynthesis; see
Fig.1) and were in accordance
with the possibility that DIP13 is a structural component of the C.
reinhardtii cytoskeleton.
DIP13 is localized to centrioles, flagella and cytoplasmic MTs
Affinity-purified DIP13 antibody was used to localize DIP13 in fixed and
permeabilized Chlamydomonas cells by indirect immunofluorescence. As
shown in Fig. 4, DIP13 antibody
strongly labeled basal bodies and cytoplasmic MTs
(Fig. 4A,B,D). The strong basal
body labeling was clearly not paralleled by the control performed with
anti-
-tubulin antibody (Fig.
4C). Labeling of cytoplasmic MTs, however, appeared similar with
both antibodies, although DIP13 labeling seemed to be restricted to the
anterior half of cytoplasmic MTs (compare
Fig. 4A,B,D with C). In
addition, weaker punctate staining was seen with the DIP13 antiserum along the
flagella (Fig. 4A,D). This
punctate distribution does not appear to be artefactual since similarly
treated cells exhibited an homogeneous staining along the flagella with
anti-
-tubulin antibodies. (Fig.
4C).
To determine whether flagellar DIP13 is associated with the axoneme, whole and detergent-extracted flagella from vegetative Chlamydomonas cells (strain CC124 MT-) were analyzed by immunoblotting with anti-DIP13 antibody (Fig. 4E). As shown, DIP13 is clearly detectable in flagella and obviously associated with the axoneme.
In order to localize DIP13 in basal bodies and flagella in more detail, we performed immunogold labeling of isolated C. reinhardtii cytoskeletons. In the basal body region, DIP13 is located both at the outside (Fig. 5A1-3,6,7) and the inside of the basal bodies (Fig. 5A4,5). Strongest labeling was reproducibly detected at the one side of the basal body distal to the neighbouring basal body (Fig. 5A1,3). In flagella, the protein seemed to be associated both with outer doublet (Fig. 5B1-3) and central pair MTs (MT; Fig. 5B1,4-6) of the axoneme. A count of 214 gold particles from 139 axonemal sections resulted in exclusive outer doublet localization in 51% of the axonemes and in central pair localization in 33% of the axonemes. In about 16% of the cases no decision could be made between outer doublet and central pair labeling (Fig. 5B7-10). It has to be noted that in agreement with the punctate staining seen in immunofluorescence (Fig. 4A,D), immunogold labeling of longitudinal axonemal sections displayed multiple isolated spots with accumulated gold particles along the length of the axoneme (Fig. 5B1,4,9).
|
NA14 is localized to the centrosome and sperm flagella
NA14 was initially identified as a minor autoantigen recognized by an
autoimmune serum from a Sjögren syndrome patient. Neither the autoimmune
serum nor a polyclonal antibody raised against recombinant NA14 recognized
endogenous NA14 by IF. For this reason, subcellular localization was achieved
by expression of an HA-tagged version of NA14. Under these conditions,
exogenous NA14 localizes at the nucleus
(Ramos-Morales et al., 1998
).
NA14 was, therefore, believed to be a nuclear autoantigen. However, since NA14
exhibits a remarkably high sequence similarity to C. reinhardtii
DIP13, which definitely showed a localization pattern typical for a
cytoskeletal protein, we considered it to be necessary to reexamine NA14
localization in human cells and sought to test the possibility that anti-DIP13
antibody could serve to determine the subcellular localization of NA14.
We first wondered whether anti-NA14 antibody
(Ramos-Morales et al., 1998
)
was able to recognize recombinant DIP13 and, vice versa, whether anti-DIP13
antibody detected NA14 on immunoblots. As shown in
Fig. 6A (left panel), anti-NA14
clearly recognized recombinant DIP13 (lane 1). An extract from HA-NA14
overexpressing cells was included as a positive control (lane 2). On the
contrary, anti-DIP13 antibody did not detect HA-NA14 on immunoblots (data not
shown). We next attempted to immunoprecipitate NA14 by using anti-DIP13
antibody (Fig. 6A, middle and
right panels). Lysates from HA-NA14-overexpressing cells were
immunoprecipitated with the preimmune serum, as a negative control, (lanes
4,8) or with anti-DIP13 antibody (lanes 5,9).
|
As a control, recombinant DIP13 was also immunoprecipitated under identical conditions (lanes 3,7). Bead pellets (lanes 3-5,7-9) and supernatants (lanes 6,10) were separated by SDS-PAGE and transferred to nitrocellulose filters. Identical blots were incubated with either anti-NA14 (middle panel) or anti-HA antibodies (right panel). As can be observed, anti-DIP13 antiserum immunoprecipitated both purified DIP13 (lane 3) and HA-NA14 (lanes 5,9) indicating that the antibody was able to recognize native NA14. Obviously, purified DIP13 was not recognized by anti-HA antibody (lane 7).
These results prompted us to use anti-DIP13 antibody for IF experiments in
human cells. As shown in Fig.
6B (top three panels), anti-DIP13 labeling in methanol-fixed cells
strictly colocalized with the centrosomal markers
-tubulin and CTR453
at the centrosome and mitotic poles of HeLa cells. However, unlike in
Chlamydomonas, no staining of cytoplasmic MTs was observed. When
similar experiments were carried out on HA-NA14-overexpressing cells,
anti-DIP13 antibody recognized both endogenous NA14 at the centrosome and
exogenous HA-NA14 in the nucleus (data not shown) demonstrating the
specificity of anti-DIP13 labeling.
To confirm this centrosomal localization of NA14, immunoblots were
performed on triton-soluble and insoluble extracts of KE37 cells and on
isolated centrosomes (Fig. 6C).
Anti-NA14 antiserum reacted with a centrosomal protein of
14 kDa.
Together these results indicate that NA14 is, in fact, a centrosomal protein
in HeLa cells.
Finally, we investigated whether NA14 also localized in complex
microtubular structures in human cells. To do this, we double-stained human
spermatozoa (Fig. 6B, lower
panel) with anti-DIP13 and
-tubulin antibodies. Labeling of these cells
clearly resembles that of Chlamydomonas cells since strong labeling
of the basal body region with weaker labeling of the axonemes (which in turn
showed strong labeling for
-tubulin) was observed.
Antisense RNA inhibition of DIP13 expression
It is well-established that expression of antisense RNA within living cells
leads to inhibition of expression of the target gene
(Rosenberg et al., 1985
;
Fuhrmann et al., 2001
) and can
provide useful insights into the function of the protein of interest. To get a
first hint at DIP13 function, we expressed DIP13 antisense RNA in
transgenic Chlamydomonas cells. To this end, DIP13 cDNA was
cloned in inverse orientation under the control of the C. reinhardtii
hybrid AR-promoter (Fig. 7A)
[(Schroda et al., 2000
) M.
Fuhrmann, personal communication] and the construct, pVW1, was stably
transformed into Chlamydomonas cells. Six transformed cell lines were
identified by PCR analysis three of which are shown in
Fig. 7B. It was noted that
these transformed strains showed significantly slower growth than the
untransformed strain (data not shown). Asynchronous cultures of these three
strains together with the untransformed control strain were grown under
constant light and analyzed by light microscopy for phenotypic abnormalities.
Unlike in untransformed control cultures, a small fraction of cells of any
given culture had severe defects in cell morphology: cells were enlarged
(Fig. 7C3), had multiple pairs
of flagella (up to 12 flagella instead of two;
Fig. 7C1-3) and unusual cell
shapes (Fig. 7C2) among which
spindle-shaped cells (Fig. 7E2)
with two pairs of flagella at opposite cell poles were most prominent. Using
these criteria for defining abnormal cell morphology, cells from five to 10
random visual fields were counted and the number of unusual cells expressed as
fraction of total cells. In five independent experiments of this kind with
strains 33, 45 and 67 the sum of all abnormal cells in any given culture was
always between 5 and 14% of total cells while blind controls with the
untransformed strain ranged between 1 and 2%. There were no major differences
in numbers of unusual cells between the three different antisense strains.
Next, cell extracts from cultures with a comparably high (10-14%) fraction of abnormal cells were analyzed on immunoblots. Fig. 7D shows the result of such an experiment. Densitometric analysis of these immunoblots (middle panel) using L23 protein as a loading control indeed showed that DIP13 levels were reduced between 12 and 50% in these particular cultures while tubulin levels were comparable in all four strains.
Finally, DAPI staining of nuclei showed that cells with multiple pairs of flagella contained also multiple nuclei, one nucleus per flagella pair (Fig. 7E). In summary the results of functional analysis available to date suggest that expression of DIP13 antisense RNA leads to a defect in cell division. These results will be discussed below.
| Discussion |
|---|
|
|
|---|
In the light of the DIP13 localization pattern it is conceivable that these
proteins can bind to MTs directly, an idea supported by two facts: first, both
DIP13 and NA14 contain a motif, KREE, which is similar to the MT-binding sites
found in MAP1B (Noble et al.,
1989
); and second, DIP13 can be extracted from axonemes under high
salt conditions. The latter feature is shared with known MAPs
(Suprenant et al., 1993
;
Maccioni and Cambiazo, 1995
).
However, to fulfill the biochemical definition of a structural MAP, DIP13/NA14
will have to show copurification with tubulin in subsequent rounds of MT
assembly and disassembly (Mandelkow and
Mandelkow, 1995
).
Interestingly, DIP13/NA14 localization showed slight differences compared
with
-tubulin. In particular, they seem to be more concentrated in
Chlamydomonas basal bodies and in human centrosomes. In addition,
anti-DIP13 antibody recognized preferably anterior MTs while anti
-tubulin antibody also stained posterior MTs (compare
Fig. 4A,B,D with 4C). Because
it is well-known that certain MT subsets present, for example, in
Chlamydomonas flagellar axonemes and basal bodies
(Le Dizet and Piperno, 1986
;
Piperno et al., 1987
) are more
stable and contain acetylated tubulin, there is a possibility that DIP13/NA14
are preferentially associated with these more stable MT subsets. This
possibility is not ruled out by the fact that no MT labeling was observed in
HeLa cells, because those contain very few, if any, acetylated stable MTs
(Alieva et al., 1999
; Vorobjev
et al., 2000). However, immediate attempts to colocalize DIP13 with acetylated
MTs in Chlamydomonas using monoclonal antibody 6-11B-1
(LeDizet and Piperno, 1986
)
have not yielded clear results. Therefore, very careful follow-up studies for
colocalization of tubulin and acetylated tubulin with DIP13 and NA14 in
Chlamydomonas and several human cell types will be necessary to
confirm or disprove this hypothesis.
In our opinion, DIP13 and NA14 are not highly specialized but rather seem
to have more general functions. From our current view the two most likely
possibilities are (1) general stabilization of MTs, and (2) linking MTs to
motile systems. Both possibilities are not mutually exclusive. Together,
immunofluorescence and immunoelectron microscopy revealed strong labeling at
the outside of the proximal end of the basal body, a place that could be the
attachment point for the Chlamydomonas flagellar rootlet MT system
(MTR), which consists of two sets of two (2MTR) and two sets of four (4MTR)
MTs and is descending into the cell along the cell periphery from the proximal
end of the basal bodies. The MTR system plays an important role in basal body
positioning before mitosis, and during cell division it is nucleating MTs that
in turn initiate (together with the internuclear MTs) the formation of the
phycoplast (Ehler et al.,
1995
).
As a general MT stabilizing and connecting protein, DIP13 could be responsible for MTR anchoring to the basal bodies and stabilization of the 4MTR during cytokinesis. Moreover, it could keep the 4MTR (which are attached to migrating basal body pairs) in contact with each other during pro- and metaphase. Reduced DIP13 protein levels (as a consequence of successful RNAi) could lead to a loss of contact between the basal bodies and the 4MTR and improper elongation or depolymerization of the 4MTR, or loss of contact between two growing 4MTR. Moreover, force production relying on MT polymerization/depolymerization or the action of MT motors could also be compromised in this scenario. The consequence, however, would always be misplaced basal bodies, mispositioned cleavage furrows and, therefore, impaired cell division. This is what we observed.
It is not yet known why only a minor fraction of the cells in cultures of DIP13 antisense transformants showed these particular phenotypes. A possible answer could come from the finding of only minor reductions of protein levels in antisense cultures (Fig. 7D). It is conceivable that in some cells the antisense effect is stronger at a given time, resulting in more reduced DIP13 levels than in other cells. A cell division defect could then be observed only in cells with DIP13 levels below a given threshold concentration. However, this apparent drawback could be an advantage in the end, because it seems conceiveable that a DIP13 reduction of 90-100% caused by RNAi could make the cytoskeleton very unstable so that the phenotype would be lethal.
Several mutants with phenotypes similar (but not identical) to
DIP13 RNAi transformants have been described previously. Among these
is the bld2 mutant, which is characterized by multinucleate big
cells, but lacks basal bodies and flagella
(Ehler et al., 1995
).
Vfl2 and vfl3 mutants, defective in centrin or the distal
connecting fiber, respectively, also show random segregation of basal bodies
(Wright et al., 1983
) and thus
have multiple flagella but, in contrast to DIP13 RNAi transformants,
are mononucleate and of normal size. At present, DIP13 RNAi
transformants appear to be similar to oca1 and oca2
cytokinesis mutants described previously
(Hirono and Yoda, 1997
).
Cultures of these mutants contain large abnormally-shaped cells with multiple
flagella; each pair of flagella is connected to one nucleus. Analyses underway
will show whether DIP13 and oca mutants are genetically
linked.
DIP13/NA14 have also been found to be associated with flagellar axonemes of
Chlamydomonas and human cells. The functions they could perform in
this organelle are unclear at present but the fact that immunogold staining
did not show a discrete staining pattern with a certain periodicity raises the
possibility that the function in flagella is a dynamic rather than a static
one. We are currently constructing a DIP13/CGFP fusion vector
employing a modified version of the green fluorescent protein gene
codon-optimized for C. reinhardtii
(Fuhrmann et al., 1999
) for in
vivo localization (Ruiz-Binder et al.,
2002
) of DIP13 to solve the above question.
DIP13, NA14 and the mouse unnamed protein (AB041656) are the founding members of a new class of small proteins that might share conserved functions. Data from localization experiments are corroborated by the fact that the derived human and mouse proteins display 97% amino acid sequence identity, while DIP13 and NA14 still share 60% identical amino acids. As expected, we identified homologous proteins in a variety of eukaryotic organisms including several protozoans, Schistosoma and a fish. Unexpectedly, the completed genomes of C. elegans (www.sanger.ac.uk), Drosophila (www.ncbi.nlm.nih.gov), yeast (http://genome-www.stanford.edu/Saccharomyces) and A. thaliana (http://www.arabidopsis.org/blast) do not appear to contain a member of this protein family. Since yeast and Arabidopsis do not have centrioles or flagellated cell stages and they use different modes of cell division, the observed absence of a DIP13/NA14 homolog is plausible. However, the apparent absence of DIP13/NA14 is surprising in the cases of Caenorhabditis and Drosophila. Both organisms possess centrioles and ciliated/flagellated cell types. Maybe these organims employ proteins with functional but no sequence homology to DIP13/NA14.
Taking into consideration all the results presented here, we propose that there is a new class of small proteins that are associated with MTs and that may be of general importance in many eukaryotic organisms of different phyla. Many questions are immediately obvious, among these the presence of DIP13/NA14 homologs in other eukaryotic phyla, the molecular basis of DIP13/NA14 interaction with MTs and further elucidation of DIP13/NA14 function. Experiments to address these questions are underway.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Alieva, I. B., Gorgidze, L. A., Komarova, Y. A., Chernobelskaya, O. A. and Vorobjev, I. A. (1999). Experimental model for studying the primary cilia in tissue culture cells. Membr. Cell Biol. 12,895 -905.[Medline]
Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J.,
Zhang, Z., Miller, W. and Lipman, D. J.. (1997). Gapped BLAST
and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res. 25,3389
-3402.
Bailly, E., Doree, M., Nurse, P. and Bornens, M. (1989). p34cdc2 is located in both nucleus and cytoplasm; part is centrosomally associated at G2/M and enters vesicles at anaphase. EMBO J. 8,3985 -3995.[Medline]
Baker, E. J., Keller, L. R., Schloss, J. A. and Rosenbaum, J.
L. (1986). Protein synthesis is required for rapid
degradation of tubulin mRNA and other deflagellation-induced RNAs in
Chlamydomonas reinhardtii. Mol. Cell. Biol.
6, 54-61.
Berthold, P., Schmitt, R. and Mages, W. (2002). An engineered aph7' gene from Streptomyces hygroscopicus mediates dominant resistance against hygromycinB in Chlamydomonas reinhardtii. Protist 153,401 -412.[Medline]
Bornens, M., Paintrand, M., Berges, J., Marty, M. C. and Karsenti, E. (1987). Structural and chemical characterization of isolated centrosomes. Cell Motil. Cytoskeleton 8, 238-249.[CrossRef][Medline]
Deane, J. A., Cole, D. G., Seeley, E. S., Diener, D. R. and Rosenbaum, J. L. (2001). Localization of intraflagellar transport protein IFT52 identifies basal body transitional fibers as the docking site for IFT particles. Curr. Biol. 11,1586 -1590.[CrossRef][Medline]
Debuchy, R., Purton, S. and Rochaix, J.-D. (1989). The arginino succinate lyase gene of Chlamydomonas reinhardtii: an important tool for nuclear transformation and for correlating the the genetic and molecular map of the ARG7 locus.EMBO J. 8,2803 -2809.[Medline]
Dominguez, J. E., Buendia, B., Lopez-Otin, C., Antony, C., Karsenti, E. and Avila, J. (1994). A protein related to brain microtubule-associated MAP1B is a component of the mammalian centrosome. J. Cell Sci. 107,601 -611.[Abstract]
Dutcher, S. K. (1995a). Flagellar assembly in two hundred and fifty easy-to-follow steps. Trends in Genet. 11,398 -404.
Dutcher, S. K. (1995b). Purification of basal bodies and basal body complexes from Chlamydomonas reinhardtii.Methods Cell Biol. 47,323 -334.[Medline]
Dutcher, S. K. and Trabuco, E. C. (1998). The
UNI3 gene is required for assembly of basal bodies of Chlamydomonas
and encodes
-tubulin, a new member of the tubulin superfamily.
Mol. Biol. Cell 9,1293
-1308.
Ehler, L. L., Holmes, J. A. and Dutcher, S. K. (1995). Loss of spatial control of the mitotic spindle apparatus in a Chlamydomonas reinhardtii mutant strain lacking basal bodies. Genetics 141,945 -960.[Abstract]
Ellis, L., Clauser, E., Morgan, D. O., Edery, M., Roth, R. A. and Rutter, W. J. (1986). Replacement of insulin receptor tyrosine residues 1162 and 1163 compromises insulin-stimulated kinase activity and uptake of 2-deoxyglucose. Cell 45,721 -732.[CrossRef][Medline]
Fuhrmann, M., Oertel, W. and Hegemann, P. (1999). A synthetic gene coding for the green fluorescent protein (GFP) is a versatile reporter in Chlamydomonas reinhardtii. Plant J. 19,353 -361.[CrossRef][Medline]
Fuhrmann, M., Stahlberg, A., Govorunova, E., Rank, S. and
Hegemann, P. (2001). The abundant retinal protein of the
Chlamydomonas eye is not the photoreceptor for phototaxis and
photophobic responses. J. Cell Sci.
114,3857
-3863.
Fukuzawa, H., Miura, K., Ishizaki, K., Kucho, K.-I., Saito, T.,
Kohinata, T. and Ohyama, K. (2001). Ccm1, a regulatory gene
controlling the induction of a carbon-concentrating mechanism in
Chlamydomonas reinhardtii by sensing CO2 availability.
Proc. Natl. Acad. Sci. USA
98,5347
-5352.
Fuller, S. D., Gowen, B. E., Reinsch, S., Sawyer, A., Buendia,
B., Wepf, R. and Karsenti, E. (1995). The core of the
mammalian centriole contains
-tubulin. Curr.
Biol. 5,1384
-1393.[CrossRef][Medline]
Geimer, S., Teltenkotter, A., Plessmann, U., Weber, K. and Lechtreck, K. F. (1997). Purification and characterization of basal apparatuses from a flagellate green alga. Cell Mot. Cytoskeleton 37,72 -85.[CrossRef][Medline]
Ghirardi, M. L., Zhang, L., Lee, J. W., Flynn, T., Seibert, M., Greenbaum, E. and Melis, A. (2000). Microalgae: a green source of renewable H(2). Trends Biotechnol. 18,506 -511.[CrossRef][Medline]
Goldschmidt-Clermont, M. (1986). The two genes for the small subunit of RuBP carboxylase/oxygenase are closely linked in Chlamydomonas reinhardtii. Plant Mol. Biol. 6, 13-21.
Goodenough, U. W. (1992). Green yeast. Cell 70,533 -538.[CrossRef][Medline]
Harris, E. H. (1989). The Chlamydomonas Sourcebook. Academic Press, San Diego, CA.
Harris, E. H. (2001). Chlamydomonas as a model organism. Annu. Rev. Plant Physiol. Plant Mol. Biol. 52,363 -406.[CrossRef][Medline]
Hirono, M. and Yoda, A. (1997). Isolation and phenotypic characterization of Chlamydomonas mutants defective in cytokinesis. Cell Struct. Funct. 22, 1-5.[Medline]
Johnson, U. G. and Porter, K. R. (1968). Fine
structure of cell division in Chlamydomonas reinhardi. Basal bodies
and microtubules. J. Cell Biol.
38,403
-425.
Kindle, K. L. (1990). High-frequency nuclear
transformation of Chlamydomonas reinhardtii. Proc. Natl. Acad. Sci.
USA 87,1228
-1232.
Kozminski, K. G., Diener, D. R. and Rosenbaum, J. L. (1993). High level expression of nonacetylatable alpha-tubulin in Chlamydomonas reinhardtii. Cell Motil. Cytoskeleton 25,158 -170.[CrossRef][Medline]
Lechtreck, K.-F. and Grunow, A. (1999). Evidence for a direct role of nascent basal bodies during spindle pole initiation in the green alga Spermatozopsis similis.Protist 149,163 -181.
LeDizet, M. and Piperno, G. (1986). Cytoplasmic
microtubules containing acetylated
-tubulin in Chlamydomonas
reinhardtii: spatial arrangement and properties. J. Cell
Biol. 103,13
-22.
Lumbreras, V., Stevens, D. R. and Purton, S. (1998). Efficient foreign gene expression in Chlamydomonas reinhardtii mediated by an endogenous intron. Plant J. 14,441 -447.[CrossRef]
Maccioni, R. B. and Cambiazo, V. (1995). Role
of microtubule-associated proteins in the control of microtubule assembly.
Phys. Rev. 75,835
-861.
Mandelkow, E. and Mandelkow, E.-M. (1995). Microtubules and microtubule-associated proteins. Curr. Biol. 7,72 -81.
Marsh, J. L., Erfle, M. and Wykes, E. J. (1984). The pIC plasmid and phage vectors with versatile cloning sites for recombinant selection by insertional inactivation. Gene 32,481 -485.[CrossRef][Medline]
Marshall, W. F. and Rosenbaum, J. L. (2000). How centrioles work: lessons from green yeast. Curr. Opin. Cell Biol. 12,119 -125.[CrossRef][Medline]
Marshall, W. F. and Rosenbaum, J. L. (2001).
Intraflagellar transport balances continuous turnover of outer doublet
microtubules: implications for flagellar length control. J. Cell
Biol. 155,405
-414.
McElwain, K. B., Boynton, J. E. and Gilham, N. W. (1993). A nuclear mutation conferring thiostrepton resistance in Chlamydomonas reinhardtii affects a chloroplast ribosomal protein related to Escherichia coli ribosomal protein L11. Mol. Gen. Genet. 241,564 -572.[CrossRef][Medline]
McFadden, G. I. and Melkonian, M. (1986). Use of Hepes buffer for microalgal media and fixation for electron microscopy. Phycologia 25,551 -557.
Noble, M., Lewis, S. A. and Cowan, N. J.
(1989). The microtubule binding domain of microtubule-associated
protein MAP1B contains a repeated sequence motif unrelated to that of MAP2 and
tau. J. Cell Biol. 109,3367
-3376.
Ostrowski, L. E., Blackburn, K., Radde, K. M., Moyer, M. B.,
Schlatzer, D. M., Moseley, A. and Boucher, R. C. (2002). A
proteomic analysis of human cilia: identification of novel components.
Mol. Cell. Proteomics 1,451
-465.
Page, B. D. and Snyder, M. (1992). CIK1: a
developmentally regulated spindle pole body-associated protein important for
microtubule functions in Saccharomyces cerevisiae. Genes
Dev. 6,1414
-1429.
Paoletti, A. and Bornens, M. (1997). Organisation and functional regulation of the centrosome in animal cells. Prog. Cell Cycle Res. 3,285 -299.[Medline]
Pazour, G. J., Dickert, B. L., Vucica, Y., Seeley, E. S.,
Rosenbaum, J. L., Witman, G. B. and Cole, D. G. (2000).
Chlamydomonas IFT88 and its mouse homologue, polycystic kidney
disease gene tg737, are required for assembly of cilia and flagella.J. Cell Biol. 151,709
-718.
Piperno, G., LeDizet, M. and Chang, X. J.
(1987). Microtubules containing acetylated alpha-tubulin in
mammalian cells in culture. J. Cell Biol.
104,289
-302.
Ramos-Morales, F., Infante, C., Fedriani, C., Bornens, M. and
Rios, R. M. (1998). NA14 is a novel nuclear autoantigen with
a coiled-coil domain. J. Biol. Chem.
273,1634
-1639.
Reynolds, E. S. (1963). The use of lead citrate
at high pH as an electron-opaque stain in electron microscopy. J.
Cell Biol. 17,208
-212.
Rios, R. M., Tassin, A. M., Celati, C., Antony, C., Boissier, M.
C., Homberg, J. C. and Bornens, M. (1994). A peripheral
protein associated with the cis-Golgi network redistributes in the
intermediate compartment upon brefeldin A treatment. J. Cell
Biol. 125,997
-1013.
Robenek, H., Schmitz, G. and Greven, H. (1987). Cell surface distribution and intracellular fate of human beta-very low density lipoprotein in cultured peritoneal mouse macrophages: a cytochemical and immunocytochemical study. Eur. J. Cell Biol. 43,110 -120.[Medline]
Rochaix, J.-D. (1995). Chlamydomonas reinhardtii as the photosynthetic yeast. Annu. Rev. Genet. 29,209 -230.[CrossRef][Medline]
Rosenbaum, J. L., Moulder, J. E. and Ringo, D. L.
(1969). Flagellar elongation and shortening in
Chlamydomonas. The use of cycloheximide and colchicine to study the
synthesis and assembly of flagellar proteins. J. Cell
Biol. 41,600
-619.
Rosenbaum, J. L., Cole, D. G. and Diener, D. R.
(1999). Intraflagellar transport: the eyes have it. J.
Cell. Biol. 144,385
-388.
Rosenberg, U. B., Preiss, A., Seifert, E., Jackle, H. and Knipple, D. C. (1985). Production of phenocopies by Kruppel antisense RNA injection into Drosophila embryos. Nature 313,703 -706.[CrossRef][Medline]
Rost, B. and Sander, C. (1993). Prediction of protein secondary structure at better than 70% accuracy. J. Mol. Biol. 232,584 -599.[CrossRef][Medline]
Rost, B. and Sander, C. (1994). Conservation and prediction of solvent accessibility in protein families. Proteins 20,216 -226.[CrossRef][Medline]
Ruiz-Binder, N. E., Geimer, S. and Melkonian, M. (2002) In Vivo localization of centrin in the green alga Chlamydomonas reinhardtii. Cell Motil. Cytoskeleton 52, 43-55.[CrossRef][Medline]
Sager, R. and Granick, S. (1953). Nutritional Studies with Chlamydomonas reinhardtii. Annu. NY Acad. Sci. 56,831 -838.[Medline]
Salisbury, J. L. (1995). Centrin, centrosomes and mitotic spindle poles. Curr. Opin. Cell Biol. 7, 39-45.[CrossRef][Medline]
Salisbury, J. L., Baron, A. T. and Sanders, M. A. (1989). The centrin-based cytoskeleton of Chlamydomonas reinhardtii: distribution in interphase and mitotic cells. J. Cell Biol. 107,635 -641.
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Saraste, M., Sibbald, P. R. and Wittinghofer, A. (1990). The P-loop. A common motif in ATP- and GTP-binding proteins. Trends Biochem. Sci. 15,430 -434.[CrossRef][Medline]
Schloss, J. A., Silflow, C. D. and Rosenbaum, J. L.
(1984). mRNA abundance changes during flagellar regeneration in
Chlamydomonas reinhardtii. Mol. Cell. Biol.
4, 424-434.
Schlösser, U. G. (1994). SAG Sammlung von Algenkulturen at the University of Göttingen: Catalogue of strains. Bot. Acta 107,113 -186.
Schmitt, R., Fabry, S. and Kirk, D. L. (1992). In search of molecular origins of cellular differentiation of Volvox and its relatives. Int. Rev. Cytol. 139,189 -265.[Medline]
Schroda, M., Blocker, D. and Beck, C. F. (2000). The HSP70A promoter as a tool for the improved expression of transgenes in Chlamydomonas. Plant J. 21,121 -131.[CrossRef][Medline]
Silflow, C. D. and Lefebvre, P. A. (2001)
Assembly and motility of eukaryotic cilia and flagella. Lessons from
Chlamydomonas reinhardtii. Plant Physiol.
127,1500
-1507.
Silflow, C. D. and Rosenbaum, J. L. (1981).
Multiple
- and ß-tubulin genes in Chlamydomonas and
regulation of tubulin mRNA levels after deflagellation.
Cell 24,81
-88.[CrossRef][Medline]
Sizova, I. A., Fuhrmann, M. and Hegemann, P. (2001). A Streptonyces rimosus aphVIII gene coding for a new type phosphotransferase provides stable antibiotic resistance to Chlamydomonas reinhardtii. Gene 277,221 -229.[CrossRef][Medline]
Sloboda, R. D. (2002). A healthy understanding of intraflagellar transport. Cell. Motil. Cytoskeleton. 52,1 -8.[CrossRef][Medline]
Somanchi, A. and Moroney, J. V. (1999). As Chlamydomonas reinhardtii acclimates to low-CO2 conditions there is an increase in cyclophilin expression. Plant Mol. Biol. 40,1055 -1062.[CrossRef][Medline]
Suprenant, K. A., Dean, K., McKee, J. and Hake, S. (1993). EMAP, an echinoderm microtubule-associated protein found in microtubule-ribosome complexes. J. Cell Sci. 104,445 -450.[Abstract]
Vorobjew, I. A., Uzbekov, R. E., Komarova, Y. A. and Alieva, I. B. (2000). Gamma-tubulin distribution in interpahse and mitotic cells upon stabilization and depolymerization of microtubules. Membrane Cell Biol. 14,219 -235.[Medline]
Whyard, T. C., Cheung, W., Sheynkin, Y., Waltzer, W. C. and Hod, Y. (2000). Identification of RS as a flagellar and head sperm protein. Mol. Reprod. Dev. 55,189 -196.[CrossRef][Medline]
Wilkerson, C. G., King, S. M. and Witman, G. B. (1998). The 78,000 M(r) intermediate chain of Chlamydomonas outer arm dynein is a WD-repeat protein required for arm assembly. J. Cell Biol. 129,169 -178.
Wilson, I. A., Niman, H. L., Houghten, R. A., Cherenson, A. R., Connolly, M. L. and Lerner, R. A. (1984). The structure of an antigenic determinant in a protein. Cell 37,767 -778.[CrossRef][Medline]
Witman, G. B. (1986). Isolation of Chlamydomonas flagella and flagellar axonemes. Methods Enzymol. 134,280 -290.[Medline]
Wright, R. L., Chojnacki, B. and Jarvik, J. W.
(1983). Abnormal basal-body number, location, and orientation in
a striated fiber-defective mutant of Chlamydomonas reinhardtii. J.
Cell Biol. 96,1697
-1707.
Wright, R. L., Salisbury, J. and Jarvik, J. W.
(1985). A nucleus-basal body connector in Chlamydomonas
reinhardtii that may function in basal body localization or segregation.
J. Cell Biol. 101,1903
-1912.
Yagi, T. (2000). ADP-dependent microtubule translocation by flagellar inner-arm dyneins. Cell Struct. Funct. 25,263 -267.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
A. Errico, P. Claudiani, M. D'Addio, and E. I. Rugarli Spastin interacts with the centrosomal protein NA14, and is enriched in the spindle pole, the midbody and the distal axon Hum. Mol. Genet., September 15, 2004; 13(18): 2121 - 2132. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||