|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
doi: 10.1242/10.1242/jcs.00362
Research Article |
1 Department of Biochemistry, Institute of Medical Science, University of Tokyo,
4-6-1 Shirokanedai, Minato-ku, Tokyo 108-8639, Japan
2 Cancer Genomics, Institute of Medical Science, University of Tokyo, 4-6-1
Shirokanedai, Minato-ku, Tokyo 108-8639, Japan
3 CREST, Japan Science and Technology Corporation (JST), Minato-ku, Tokyo
108-8639, Japan
4 PRESTO, Japan Science and Technology Corporation (JST), Minato-ku, Tokyo
108-8639, Japan
5 Laboratory for Developmental Genomics, RIKEN Center for Developmental Biology,
Kobe, Hyogo 650-0047, Japan
6 Department of Biophysics and Biochemistry, Graduate School of Science,
University of Tokyo, Bunkyo-ku, Tokyo 113-0033, Japan
* Author for correspondence (e-mail: takenawa{at}ims.u-tokyo.ac.jp)
Accepted 8 January 2003
| Summary |
|---|
|
|
|---|
Key words: Caenorhabditis elegans, Arp2/3 complex, WASP family proteins, Cell migration, Ventral enclosure
| Introduction |
|---|
|
|
|---|
Cell migration occurs at several points during the development of
multicellular organisms (Bard,
1992
). Although proliferating stem cells are restricted to various
regions of the body, differentiated cells with specific functions migrate to
their proper location for function. However, the mechanism that drives cell
migration in the development of multicellular organisms remains poorly
understood. The Arp2/3 complex and WASP family proteins are the most likely
candidate molecules for directly driving these processes. In
Drosophila, the Arp2/3 complex, SCAR/WAVE and WASP proteins function
in actin dynamics. Drosophila Arp2/3 complex and SCAR/WAVE regulate
cell morphogenesis in blastomeres, CNS neurons, egg chamber and adult eyes
(Hudson and Cooley, 2002
;
Zallen et al., 2002
).
Drosophila WASP function in Notch-mediated cell lineage
determination (Ben-Yaacov et al.,
2001
). In spite of the genetic evidence presented for
Drosophila, C. elegans represents an excellent model system in which
to determine the function of genes in development, because, unlike
Drosophila, cell lineage is tractable and observation of entire cells
is possible. Here, we have investigated the function of the Arp2/3 complex and
WASP family proteins in C. elegans in cell migration.
| Materials and Methods |
|---|
|
|
|---|
Sequence analysis
The cDNA clones corresponding to C. elegans Arp3 (arx-1),
Arp2 (arx-2), p34Arc (arx-4), p21Arc (arx-5),
p20Arc (arx-6), p16Arc (arx-7) and N-WASP (wsp-1)
were kindly provided by Y. Kohara at the National Institute of Genetics,
Mishima, Japan. These clones are yk170f5 for arx-1, yk543a12 for
arx-2, yk277h3 for arx-4, yk508a3 for arx-5,
yk393h10 for arx-6, yk311a10 for arx-7, yk184g1 (WSP isoform
1) and yk9h5 (WSP-1 isoform2) for wsp-1. Sequences were confirmed by
Sequence kit (Amersham Pharmacia Biotech).
RNA-mediated interference (RNAI) and microinjection
For soaking RNAi, the cDNA clones for components of the Arp2/3 complex and
N-WASP (described above), previously cloned into pBluescript (pBS) vector,
were amplified by PCR using primers complementary to the T3 and T7 promoter
sequences. The resulting PCR products were used as templates for in vitro
transcription by T3 and T7 RNA polymerases (Stratagene). The resulting
complementary single-stranded RNAs were combined to form double-stranded RNA
(dsRNA) and extracted by phenol, phenol-chloroform and chloroform followed by
precipitation with 0.3 M sodium acetate (pH 5.2) and isopropanol. The
resulting dsRNA was used for RNAi and was administered by the soaking method
described previously (Maeda et al.,
2001
). Approximately 10 µg of dsRNA was dissolved in 5 µl
1xM9 (Mg2+ free), 3 mM spermidine (Wako, Osaka, Japan), 0.05%
gelatin and 0.12% DOTAP (Roche). L4 larvae were washed with M9 several times
and placed on an NGM plate without OP50 for 1 hour. Five worms were selected
and immersed in RNA solution for 24 hours and then allowed to recover by
incubation at 20°C on NGM plates for 36 hours before observation.
For feeding RNAi, the arx-1 cDNA (129-831) fragment was excised by SacI/SalI digestion of the yk221f3 construct and subsequently cloned into pPD129.36 (gift of A. Fire, Carnegie Institute, Washington, Baltimore). The construct was transformed into E. coli HT115(DE3) (obtained from CGC). After induction by IPTG, the bacterial cells were seeded on NGM plates containing 50 µg/ml ampicillin, 12.5 µg/ml tetracycline and 40 mM IPTG. L4 larvae were placed on the plates and allowed to lay eggs. As a control, L4 larvae were deposited on pPD129.36-transformed HT115(DE3).
For hypodermal cell-specific RNAi, cDNA fragments were cloned downstream of
the tissue-specific promoter as described previously
(Hoier et al., 2000
). First,
the sense and anti-sense strand of arx-1 cDNA (20-1278) and
wsp-1 cDNA (537-1116) were amplified by PCR and cloned into pBS. The
primer pairs used for the sense strand of arx-1 cDNA were:
5'senseBamHI: CGCGGATCCCGGCATGTGTGATCGACAATGG and
3'sensePstI: CCAATGCATTGGTTCTGCAGAGTAAGAGCTCCGAAAACTGG, and for
anti-sense strand: 5'anti-sensePstI:
AACTGCAGCGGCATGTGTGATCGACAATGG and 3'anti-senseBamHI:
CGCGGATCCAGTAAGAGCTCCGAAAACTGG. The primer pairs for sense strand of
wsp-1 cDNA were: WsSpe5':
GGACTAGTGATCCACTCCAACACGACAATTCG and WsPst3':
CCAATGCATTGGTTCTGCAGGCACCGCTTCCAATCGGAGCAGATG for anti-sense strand:
WsPst5': AACTGCAGGATCCACTCCAACACGACAATTCG and
WsSpe3': GGACTAGTGCACCGCTTCCAATCGGAGCAGATG. The resulting cDNA
fragments cloned into pBS were subcloned by XbaI/KpnI
digestion followed by insertion into the NheI/KpnI-digested
plasmid pPD95.86(BamHI)-lin-26p(+), which has a lin-26 promoter
region in pPD95.86 (gift of H. Qadota and K. Kaibuchi, Nagoya University,
Japan). As an expression marker, the GFP fragment of pEGFP-C1 (Invitrogen) was
digested by NheI/KpnI and subcloned into
NheI/KpnI-digested pPD95.86(BamHI)-lin-26p(+). The sense and
antisense constructs of arx-1 and wsp-1 cDNA, cloned
downstream of lin-26 promoter, were injected along with the GFP
marker in pPD95.86(BamHI)-lin-26p(+) into young adult worms. Progeny were
observed by DIC and confocal microscopy (Leica). To obtain better
identification of transgene-expressing embryos, embryos were stained with an
anti-GFP antibody (A6455, Molecular Probes, Oregon).
For overexpression of the VCA region, the wsp-1 VCA region
(1425-1794) was fused with VENUS (Nagai et
al., 2002
) (gift of Dr Miyawaki, RIKEN, Wako, Japan) at the WSP-1
VCA N-terminal, and subsequently cloned into pPD95.86(BamHI)-lin-26p(+). The
construct was injected into young adult worms, and the progeny were observed
by DIC and confocal microscopy (Leica).
Time-lapse recordings
Wild-type gravid hermaphrodites were cut transversely and the embryos
placed on a 5% agar pad in M9 solution. RNAi-treated embryos, as described
above, were collected from P0 hermaphrodites within 36 hours of the recovery
period following RNAi immersion. The specimen was placed on a glass slide
under a coverslip, sealed with Vaseline and its development was recorded by
DIC microscopy. A four-dimensional series of images of GFP expression was
recorded by a Multiphoton microscope as described previously
(Simske and Hardin, 2001
).
Antibodies and western blotting
Antibodies for ARX-1 and ARX-7 were obtained from rabbits immunized against
synthetic peptides CGPSICRYNPVFGALT and CFGHGAIMRVFSGRQRL, respectively.
Antisera were purified with activated CH-sepharose 4B beads (Pharmacia).
Rabbit WSP-1 antiserum was raised against amino acids 475 to 598,
corresponding to the VCA region of WSP-1. The antigen was first expressed as a
GST fusion protein. The GST moiety was removed by thrombin digestion, and the
resulting antigen was injected into rabbits. Antiserum was purified with
CNBr-sepharose beads (Pharmacia) covalently coupled to the antigen. The
specificity was examined by western blotting of total worm lysates. A
monoclonal antibody against actin (MAB1501) was purchased from Chemicon
(California), and its specificity for C. elegans actin was confirmed
by western blotting. For western blotting, the gravid hermaphrodites were
collected in M9 solution. Embryos were collected by treating adult
hermaphrodites with bleach solution (2.5% NaHypochlorite, 0.5 M NaOH). In
western blotting, total lysate or embryo extracts were run on a 12.5%
polyacrylamide gel, blotted and probed. Approximately the same amount of
embryo extract, judged from SDS-PAGE, was applied for the analysis of WSP-1
expression. Images were analyzed with NIH Image 1.62.
Immunostaining
Gravid hermaphrodites of wild-type or RNAi-treated P0 hermaphrodites within
36 hours of recovery from RNA solution were placed on poly-L-lysine-coated
slides (Sigma). A coverslip was overlaid, and pressure was applied to extrude
the embryo. The slide was placed on dry ice for at least 10 minutes.
Immediately after removal of the coverslip, the specimen was fixed with
methanol for 5 minutes and washed three times for 10 minutes in
phosphate-buffered saline (PBS) (125 mM NaCl; 16.6 mM
Na2HPO4; 8.40 mM NaH2PO4)
containing 0.1% Tween-20 (PBST). After blocking with PBST containing 20% fetal
bovine serum (FBS) and 1% skim milk for 1 hour at room temperature under a
coverslip, the specimen was incubated with a primary antibody diluted in PBST
with FBS and skim milk overnight at 4°C. Antibodies against WSP-1, ARX-1
and ARX-7 were diluted 1:500, whereas the anti-actin antibody was diluted
1:1000. Anti-LIN-26 and MH27 antibodies were diluted 1:1500. Slides were
washed three times for 10 minutes in PBST and then incubated with secondary
antibodies for 1 hour at room temperature. Secondary antibodies were either
AlexaFluor488-conjugated anti-rabbit IgG antibody (1:500, Molecular Probes) or
AlexaFluor594-conjugated anti-mouse IgG antibody (1:500, Molecular Probes).
Slides were washed three times in PBST and mounted using 25 mg/ml DABCO
(Sigma) in 9:1 glycerol: PBS. Detection was performed by confocal laser
scanning microscope (BioRad or Leica).
For immunostaining with labeled antibodies, anti-WSP-1 and anti-ARX-1 antibodies were labeled with Alexa Fluor 546 and Alexa Fluor 633 Protein Labeling Kit (Molecular Probes), respectively. Embryos were fixed and blocked as described above, then incubated with labeled antibodies overnight at 4°C. The dilutions were 1:100 for labeled anti-WSP-1 antibody and anti-ARX-1 antibody. The specimen were washed three times for 15 minutes in PBST then mounted and detected as described above.
Phalloidin staining
Wild-type or RNAi-treated embryos were collected by cutting gravid
hermaphrodites within 36 hours of recovery from RNA solution and were placed
on a poly-L-Lysine-coated slide. The embryos were then treated as described
previously (Williams-Masson et al.,
1997
). The fixed embryos were incubated with Rhodamine Phalloidin
(Molecular Probes) for 1 hour at room temperature and washed three times with
PBST. Embryos were mounted and viewed as described above.
Pyrene-actin assay
Pyrene-actin assay was performed as described previously
(Rohatgi et al., 1999
).
Briefly, Pyrene-labeled actin (9% final labeling) at 2 µM was added to 100
nM purified bovine N-WASP VCA or C. elegans WSP-1 VCA, 60 nM purified
Arp2/3 complex. Bovine N-WASP VCA and C. elegans WSP-1 VCA were
expressed as a GST fusion protein then purified with glutathione Sepharose 4B
beads (Pharmacia). Arp2/3 complex was purified as described previously
(Yamaguchi et al., 2002
). The
fluorescence was measured using a fluorescence spectrometer (Jasco).
| Results |
|---|
|
|
|---|
Essential role of Arp2/3 complex in C. elegans
morphogenesis
Next, we investigated Arp2/3 complex function in vivo by analysis of RNAi.
We examined six of the seven subunits of Arp2/3 complex by the RNAi-by-soaking
method (Maeda et al., 2001
;
Tabara et al., 1998
), and the
disruption of the expression of these genes by RNAi resulted in embryonic
arrest during morphogenesis, with a similar terminal phenotype. This finding
is consistent with the notion that the Arp2/3 complex functions as a
seven-subunit complex (Winter et al.,
1999
,Winter et al.,
1999
; Gournier et al.,
2001
; Robinson et al.,
2001
). Hereafter, the suppression of a given gene by RNAi will be
referred to by the gene followed by (RNAi), that is, arx-1(RNAi).
RNAi was embryonic lethal for 100% of arx-1(RNAi) (n=211),
100% of arx-2(RNAi) (n=254), 83% of arx-4(RNAi)
(n=234), 78% of arx-5(RNAi) (n=261), 88% of
arx-6(RNAi) (n=285) and 87% of arx-7(RNAi)
(n=296). To clarify at which point during development the Arp2/3
complex is essential, we observed RNAi-treated embryos under a DIC microscope
until each embryo died.
Defects in ventral enclosure by depletion of Arp2/3 complex
During C. elegans morphogenesis, dynamic changes in hypodermal
(external epithelial) cells occur in two distinguishable steps at
approximately 300 minutes after the first cleavage. First, the two pairs of
anterior contralateral hypodermal cells of the extreme ventral rows migrate
toward the ventral midline by elongating filopodia until they meet and form
junctions at the ventral midline. Second, eight pairs of posterior
contralateral hypodermal cells are then drawn together by actin contractile
forces to close and form junctions. Completion of these processes yields the
basic worm shape and is called ventral enclosure
(Priess and Hirsh, 1986
;
Raich et al., 1999
;
Simske and Hardin, 2001
;
Williams-Masson et al., 1997
).
At approximately 400 minutes, the embryo rotates 90° and begins elongation
of the body along the anterior-posterior axis, with rearrangement of
hypodermal cells and organogenesis of the pharynx and intestine
(Fig. 1A). Twitching, which
indicates muscle cell differentiation, is first observed at about 430
minutes.
|
Time-lapse observations of the lethal phenotype in embryos treated by RNAi
revealed that ventral enclosure was not complete. We also observed the
arrested embryos with AJM-1::GFP to visualize the shape of hypodermal cells.
AJM-1 is a component of the zonula adherens at the cell-cell junction and can
be used to visualize epithelial boundaries within the hypodermis during
enclosure (Podbilewicz and White,
1994
; Mohler et al.,
1998
; Koppen et al.,
2001
). Although alignment of hypodermal cells was observed on both
the left and right sides (indicated by arrowheads in
Fig. 1A-C), the hypodermal
cells did not migrate, resulting in failed ventral enclosure
(Fig. 1B,C). However,
organogenesis, monitored with AJM-1 (Fig.
1F,G), and muscle cell differentiation, monitored by twitching,
appeared to progress normally. The dying embryos exhibited distorted
hypodermal cells, suggesting that the major defects caused by depletion of
Arp2/3 complex by RNAi occur in cell migration during ventral enclosure
(Fig. 1E-G). We show only the
results of arx-2(RNAi) and arx-5(RNAi), but similar defects
were observed with arx-1(RNAi),arx-4(RNAi), arx-6(RNAi) and
arx-7(RNAi) (data not shown). Therefore, we conclude that the Arp2/3
complex plays an essential role in ventral enclosure in C.
elegans.
Involvement of Arp2/3 complex in hypodermal cell migration
Previous studies have helped to identify two classes of genes involved in
ventral enclosure. The first class of genes, including C. elegans
gex-2 (mammalian Sra-1) and gex-3 (mammalian HEM-2), are
responsible for initiation of hypodermal cell migration. The second class of
genes facilitates cell adhesion and includes genes such as hmp-1
(
-catenin) and hmp-2 (ß-catenin)
(Costa et al., 1998
). Mutants
of genes in this class are able to show some cell migration but either fail to
form cell-cell junctions or the embryo eventually ruptures during elongation
owing to weak adhesions between cells.
Analysis by DIC microscope (Fig.
1) could not completely identify the class to which the Arp2/3
complex belongs. It is possible that cells did not migrate or that cells did
migrate but that the junction was not formed, resulting in dysfunctional
cell-cell contacts. Therefore, we investigated whether there is a defect in
cell migration during ventral enclosure in embryos depleted of Arp2/3 complex
by studying the movement of epithelial cells by time-lapse observation of
GFP-fused AJM-1 protein using a multiphoton microscope
(Mohler et al., 1998
;
Mohler and White, 1998a
;
Mohler and White, 1998b
).
The AJM-1 protein clearly indicated the boundary of migrating cells in the
wild-type embryo (Simske and Hardin,
2001
) (Fig. 2A). In
arx-2(RNAi) embryos, the two pairs of anterior contralateral
hypodermal cells did not migrate towards the ventral side (see cells numbered
1 and 2 in Fig. 2B). The
posterior cells in arx-2(RNAi) embryos (including cells numbered 4 in
Fig. 2B) also showed defects in
migration. These arrested hypodermal cells failed to migrate, even during the
period when the wild-type embryos began body elongation and organogenesis
(Fig. 2B). We conclude that the
abnormality in morphogenesis in arx-2(RNAi) embryos is caused by a
defect in hypodermal cell migration not in the abnormal or incomplete
formation of cell-cell junctions.
|
To examine the actin filament of arrested hypodermal cells, we stained RNAi-treated embryos with phalloidin. In wild-type cells, filamentous actin accumulated at the leading edge (Fig. 3A-D). By contrast, accumulation of filamentous actin was reduced in arx-2(RNAi) embryos arrested at ventral enclosure (Fig. 3E-H).
|
Differentiation of hypodermal cells in embryos depleted of Arp2/3
complex
To clarify whether or not arrested hypodermal cells had differentiated, we
next examined the expression of hypodermal cell differentiation markers.
First, we stained RNAi-treated embryos with an anti-LIN-26 antibody. LIN-26 is
a zinc-finger transcription factor that is required for hypodermal cells to
acquire their proper fates (Labouesse et
al., 1996
). It is expressed in the nuclei among the hypodermal
cells, slightly before the migration of hypodermal cells during ventral
enclosure. Although the ventral hypodermal cells from arx-1(RNAi)
embryos were defective in migration, normal LIN-26 expression was observed for
these cells (Fig. 4Ad,f). Next,
we analyzed the expression of a seam cell marker by a SCM::GFP fusion protein.
In wild-type embryos, SCM::GFP is expressed in the nuclei of 20 seam cells
after the completion of ventral enclosure. We performed RNAi on embryos
expressing SCM::GFP then stained the embryos with phalloidin. The
arx-2(RNAi) embryo showed normal expression of SCM::GFP in the all of
the 20 nuclei of the seam cells (Fig.
4Bd,f). Despite junction formation failure at the ventral side
during ventral enclosure, seam cells are differentiated normally.
Additionally, we confirmed the normal localization of AJM-1 by observing an
AJM-1::GFP fusion protein by multiphoton microscopy
(Fig. 2). Slightly before
ventral enclosure, the normal localization of AJM-1 of embryos with depleted
Arp2/3 complexes was observed by immunostaining with an MH27 antibody, which
recognizes AJM-1 (data not shown; Fig.
4Ae). Together, these results revealed that the defect in cell
motility in RNAi-treated embryos was not a result of a defect occurring during
differentiation.
|
In concert with ventral enclosure, dorsal hypodermal cells are rearranged
by a process known as dorsal intercalation
(Podbilewicz and White, 1994
;
Simske and Hardin, 2001
). The
zinc finger protein, DIE-1, functions in dorsal intercalation but not in
ventral hypodermal cell migration (Heid et
al., 2001
). Some mutants, including gex-2 (mammalian
Sra-1), gex-3 (mammalian HEM-2)
(Soto et al., 2002
) and
apr-1 (tumor suppressor APC related)
(Hoier et al., 2000
), which
exhibit defects in ventral enclosure, also show defects in dorsal
intercalation. However, the pattern of AJM-1 on the dorsal side was normal in
arx-2(RNAi) embryos (Fig.
2E) as well as in embryos depleted of other Arp2/3 subunits by
RNAi (data not shown). Therefore, the Arp2/3 complex does not appear to be
involved in dorsal intercalation.
WASP family proteins in C. elegans
We then focused on the involvement of WASP family proteins in cell
migration (Pollard et al.,
2000
; Pantaloni et al.,
2001
; Takenawa and Miki,
2001
). In C. elegans, there are two WASP family proteins,
WSP-1 (C07G1.4) and WVE-1 (R06C1.3), which correspond to mammalian N-WASP and
WAVE, respectively. Since there are two verprolin homology (VPH) domains in
C07G1.4, this gene is thought to correspond to N-WASP, which is the only WASP
family protein with two VPH domains (Miki
et al., 1996
).
Analysis of transcripts corresponding to C07G1.4 revealed that there are two splicing variants of WSP-1 that would produce transcripts of 3.5 kb and 2.1 kb. Of 14 EST clones of C07G1.4, nine clones represented one variant (WSP-1 isoform 1) and five clones represented the other (WSP-1 isoform 2). In order to establish the existence of the splicing variants, we performed northern blot analysis on RNAs from embryos using probes against the 3'-terminal region, which is identical in both isoform 1 and 2. It revealed a major band at 2.1 kb and a minor band at 3.5 kb, suggesting that isoform 1 is the major variant (data not shown).
The open reading frame of WSP-1 isoform 1 predicts a protein of 598 amino
acids (approximately 65 kDa) with high homology (approximately 50%) to
mammalian N-WASP. Furthermore, the WSP-1 isoform 1 contains all of the domains
found in mammalian N-WASP (Miki et al.,
1996
) (Fig. 5A,B),
suggesting that the WSP-1 isoform 1 is the homologue of mammalian N-WASP.
|
In isoform 2 of WSP-1, the N-terminal region of the WSP-1 isoform 1, including the WASP homology 1 domain and IQ motif, was replaced with amino acids with no homology to any known proteins (Fig. 5A,B). We have not, so far, determined the methionine at which the translation begins. Translation may start at either of the methionines indicated by asterisks (*1 and *2) in Fig. 5A, with a 54 kDa and a 51 kDa protein being translated from the 1*-start and 2*-start sites, respectively. If neither of these methionines is the translation start, WSP-1 isoform 2 would be more than a 70 kDa protein containing more than 660 amino acids. In all of these cases, the WSP-1 isoform 2 contains all the domains present in mammalian N-WASP except the WH1 domain and IQ motif, which suggests that isoform 2 may also form a functional interaction with Cdc42, the Arp2/3 complex, as well as SH3-domain-containing proteins such as Ash/Grb2/SEM-5.
To determine whether these WSP-1 variants are translated into proteins, we raised a specific antibody against WSP-1 using the C-terminal VCA region as the antigen. Western blot analysis of mixed stage worm cell lysates using this antibody showed only the presence of a 65 kDa protein, indicating that the majority of WSP-1 appears to be the 65 kDa isoform 1 (Fig. 5C).
WSP-1 activates Arp2/3 complex in vitro
Because the C-terminal region (VCA domain) of WASP family proteins has been
shown to function as the Arp2/3-complex-activating domain in yeast and
mammals, we examined the ability of the VCA domain of WSP-1 to activate
Arp2/3-complex-mediated actin polymerization in vitro. In this assay, bovine
Arp2/3 complex was used and the activity of WSP-1 was compared to bovine
N-WASP VCA, which was included as a positive control. The VCA region of WSP-1
increased Arp2/3-complex-mediated actin polymerization
(Fig. 5D). Although actin
polymerization mediated by WSP-1 VCA was somewhat slower than that mediated by
bovine N-WASP VCA, this is probably due to differences in the specificities of
bovine N-WASP and C. elegans WSP-1 VCA for the bovine Arp2/3
complex.
Function of WSP-1 in ventral enclosure
We investigated the in vivo role of WSP-1 in ventral enclosure by using
RNAi. We synthesized dsRNA from cDNA encoding WSP-1 isoform 1 (yk184g1);
however both isoforms of WSP-1 mRNA are thought to be degraded owing to the
identical C-terminal region. RNAi-by-soaking with the dsRNA yielded several
phenotypes: 15% were embryonic lethal, 20% showed larval arrest and 20% were
sterile (n=134). Delivery of dsRNA by injection showed similar
results (data not shown). In order to clarify the relationship between the
Arp2/3 complex and WSP-1, we further examined the embryonic-lethal phenotype.
Although the arrested embryos possessed no obvious worm shape, they did
exhibit twitching, indicating muscle cell differentiation. The time-lapse
series by DIC microscopy revealed incomplete ventral enclosure
(Fig. 1D). AJM-1 protein
localization of the terminal RNAi embryos revealed a normal pharynx and
intestine; however, the distorted hypodermal cells did not cover the entire
body but instead accumulated around the periphery of the embryo
(Fig. 1H). We then investigated
the process under a multiphoton microscope and failed to observe hypodermal
migration in arrested embryos by wsp-1(RNAi)
(Fig. 2C). We also examined
filamentous actin formation in wsp-1(RNAi)-treated embryos and
observed a reduction in filamentous actin formation at the edge of the
hypodermal cells (Fig. 3I-L).
The edge of arrested hypodermal cells (indicated with arrows) does not show
filamentous actin accumulation. These phenotypes were similar to those of
arx-1(RNAi), arx-2(RNAi), arx-4(RNAi), arx-5(RNAi), arx-6(RNAi) and
arx-7(RNAi) embryos. The similarity in phenotypes suggests that the
Arp2/3 complex and WSP-1 function in the same signaling pathway in C.
elegans. In addition, abnormality of the dorsal side was not observed,
which is again similar to that seen in embryos depleted of Arp2/3 components
(data not shown). Obvious defects exhibited by the other 85% viable embryos
were not related to ventral enclosure (data not shown). We also treated
embryos with RNAi against both arx-2 and wsp-1, but this
treatment did not result in the observation of a different phenotype
(n=43). Finally, distribution of the differentiation markers, LIN-26,
SCM::GFP and AJM-1 were not affected by wsp-1(RNAi) (data not
shown).
Function of Arp2/3 complex and WSP-1 is cell autonomous
Previous investigations into the role of vab-1 and vab-2
suggested that the signaling pathway originating from the neuroblast guides
hypodermal cell migration during ventral enclosure
(George et al., 1998
;
Chin-Sang et al., 1999
). By
contrast, Drosophila WASP (Wsp) functions in the
Notch signaling pathway, which suggests that WASP also functions in
cell-cell signaling as well as in cell motility (Ben-Yaccov et al., 2001).
Therefore, we investigated whether the Arp2/3 complex and WSP-1 function cell
autonomously in hypodermal cell migration. First, we performed hypodermal
cell-specific RNAi for arx-1 and wsp-1 by expressing sense
and anti-sense RNA under the expression of the lin-26 promoter.
During embryogenesis, LIN-26 is expressed in hypodermal cells, in the deirid
sheath cells and transiently in the neuroblast ALM/BDU located mid-posterior
of the embryo (Labouesse et al.,
1996
). A plasmid, containing GFP under the expression of the
lin-26 promoter, was injected together with the RNAi constructs to
monitor lin-26-promoter-driven expression. Although injection of the
GFP marker did not result in a change of phenotype, we observed 100% embryonic
lethality in embryos expressing lin-26::arx-1 (n=22) and 63%
in embryos expressing lin-26::wsp-1 (n=11), respectively.
Immunostaining with anti-ARX-1 and anti-WSP-1 antibodies revealed that ARX-1
and WSP-1 are reduced in hypodermal cells, whereas other tissues expressed
ARX-1 or WSP-1 at normal levels (data not shown). Although lethal embryos
exhibited the structure of a pharynx and muscle formation, they did not
develop the normal worm shape (Fig.
6A,B; data not shown). These phenotypes are similar to those
observed for soaking RNAi against the Arp2/3 complex subunits and
wsp-1.
|
It has been previously been reported that overexpression of the VCA region
of N-WASP has a dominant-negative effect on the Arp2/3 complex
(Machesky and Insall, 1998
).
In order to investigate this in vivo in C. elegans, we expressed the
VCA region of WSP-1 under the control of the lin-26 promoter.
Overexpression of WSP-1 VCA region resulted in embryonic lethality, with a
defect in ventral enclosure. The lethal embryos showed the structure of a
pharynx and were twitching, indicating muscle formation, but did not develop
into a normal worm shape (data not shown). Together, these results suggest
that the function of the Arp2/3 complex and WSP-1 in ventral enclosure is cell
autonomous.
Localization of C. elegans ARX-1 and ARX-7 at hypodermal
cells during ventral enclosure
We attempted to raise antibodies against ARX-1, ARX-2, ARX-5 and ARX-7.
However, only antibodies against ARX-1 and ARX-7 were isolated successfully.
The specificities of these antibodies were examined by western blotting
mixed-staged C. elegans lysates. Bands at 48 kDa and 16 kDa were
detected with anti-ARX-1 and anti-ARX-7 antibodies, respectively
(Fig. 7A). Next, we
double-stained actin and either ARX-1 or ARX-7 with their respective
antibodies. During early embryogenesis, ARX-1 and ARX-7 were localized in the
cytoplasm of all of the cells (Fig.
7B,E). A lateral view showing expression of these proteins in
hypodermal cells during ventral enclosure in C. elegans embryos is
shown (Fig. 7C,F). ARX-1 and
ARX-7 were localized among a broad range of cells including the hypodermal
cells. The similarity in localization of ARX-1 and ARX-7 supports the
hypothesis that they form a complex. A reduction in the fluorescent
intensities in embryos treated for both arx-1(RNAi) and
arx-7(RNAi) confirmed the specificity of the staining against ARX-1
and ARX-7, respectively. In arx-1(RNAi) and arx-7(RNAi)
embryos, we did not observe any obvious changes in actin localization by using
an anti-actin antibody, although there was defect in actin filament formation
(Fig. 3,
Fig.
7Be,Cf,Ee,Ff,Fig.
7Be,Cf,Ee,Ff). To determine whether WSP-1 influences localization
of ARX-1 and ARX-7, we stained wsp-1(RNAi) embryos with anti-ARX-1
and anti-ARX-7 antibodies. However, no obvious change in the localization of
the Arp2/3 complex was observed in wsp-1(RNAi) embryos
(n>200) (Fig.
7Ci,Fi).
|
|
WSP-1 localizes at the periphery of cells
We next examined the localization of WSP-1
(Fig. 8). During early
embryogenesis, WSP-1 colocalized with actin at the blastomere boundary
(Fig. 8Aa-c). During ventral
enclosure, WSP-1 colocalized with actin at the periphery of cells, including
in hypodermal cells migrating to the ventral side
(Fig. 8Aj-m), suggesting that
WSP-1 functions in cell migration at cell boundaries. In wsp-1(RNAi)
embryos, WSP-1 protein levels were reduced and localization at boundaries was
diminished (Fig. 8Ad,n).
Reduction of the protein level of WSP-1 was observed in almost all the
RNAi-treated embryos, including those that would undergo normal embryogenesis.
Anti-actin staining of wsp-1(RNAi) embryos did not significantly
alter the actin skeleton compared to wild-type embryos
(Fig. 8Ae,o).
|
Determination of WSP-1 localization by Arp2/3 complex
To investigate whether WSP-1 and the Arp2/3 complex interact in vivo, we
first double-stained embryos expressing ajm-1::GFP with anti-WSP-1
antibodies conjugated to Alexa Fluor 546 and anti-ARX-1 antibodies conjugated
to Alexa Fluor 633. Colocalization of WSP-1 and ARX-1 was observed at the
leading edge of migrating hypodermal cells
(Fig. 9). We further examined
the localization of WSP-1 in embryos with disrupted Arp2/3 complexes. In 60%
of arx-5(RNAi)-treated embryos (n=55), localization of WSP-1
at the periphery of cells was disrupted. In these embryos, WSP-1 was partially
shifted to cell nuclei in blastomeres and migrating epithelial cells (data not
shown). Changes in localization of WSP-1 were not only observed in
arx-5(RNAi) but also in arx-1(RNAi) and arx-2(RNAi)
embryos (Fig. 8Ag,i,r,t,u; data
not shown). These findings suggest that the Arp2/3 complex is required for
WSP-1 localization at the periphery of cells, including at the leading edge of
migrating cells during ventral enclosure. WSP-1 and the Arp2/3 complex appear
to associate and function at cell boundaries during ventral enclosure in
C. elegans, and localization of WSP-1 is dependent on the Arp2/3
complex.
|
We examined the effect of molecules that regulate N-WASP on WSP-1
localization. The SH3 domain of Ash/Grb2/SEM-5 was the first N-WASP-binding
partner identified (Miki et al.,
1996
). SEM-5, the C. elegans homologue of mammalian
Ash/Grb2, has the conserved two SH3 domains. WSP-1 was localized at boundaries
in sem-5 (n2019 and n2030)
(Clark et al., 1992
), mutants
of sem-5 in which one or both SH3 domains are deleted (data not
shown). Cdc42 is the upstream regulator of N-WASP in mammals
(Miki et al., 1998a
). In the
C. elegans embryos depleted of the Cdc42 homologue
(cdc-42(RNAi)), WSP-1 was localized at boundaries during early cell
division in common with that in wildtype (data not shown). In other mutants
with ventral enclosure defects, including apr-1 (APC-related),
hmp-1 (
-catenin), hmp-2 (ß-catenin) and
hmr-1 (cadherin), WSP-1 localization at cell boundaries was also
maintained (data not shown).
Expression of WSP-1 is increased in arx-1(RNAi)
Next, we examined the amount of WSP-1 protein in arx-1(RNAi)
embryos by western blotting (Fig.
8B). To harvest the embryos required for western blotting we
deleted arx-1 using RNAi by feeding. We confirmed that
arx-1(RNAi) by feeding results in embryonic lethality (85%,
n=294) with similar phenotypes to those observed by RNAi by soaking.
The amount of ARX-1 was reduced in arx-1(RNAi) embryos whereas the
amount of actin remained the same in control and arx-1(RNAi) embryos.
In arx-1(RNAi) embryos, the anti-WSP-1 antibody recognized two bands,
at approximately 65 kDa and 72 kDa, that correspond with isoform1 and 2,
respectively. The intensity of the band of isoform 1 was four-fold stronger
than that of the band detected in the lysate of the control embryo, as
determined by densitometry, suggesting that expression of WSP-1 is increased
by the reduction of functional ARX-1.
Spindle orientation in wsp-1(RNAi) embryos
WSP-1 localization at cell boundaries suggests that WSP-1 functions in the
formation of cell polarity. WSP-1 has a conserved Cdc42-binding motif similar
to that of mammalian N-WASP and WASP. Thus, WSP-1 may function downstream of
Cdc42, like PAR proteins, in the formation of cell polarity. In wild-type
embryos, the one-cell embryo divides asymmetrically, producing the larger AB
blastomere and the smaller P blastomere. In the second division, the spindle
of the AB blastomere is oriented longitudinally, whereas it is oriented
horizontally in the P blastomere (Fig.
10A). However, cdc42(RNAi) embryos show abnormal
orientation of the spindles (Kay and
Hunter, 2001
; Gotta et al.,
2001
), such that spindles in both AB and P blastomeres are
oriented horizontally (Fig.
10C). On the other hand, the wsp-1(RNAi) embryos did not
show abnormal spindle orientation and divided asymmetrically, but later showed
defects in ventral enclosure (n=7,
Fig. 10B). Viable embryos did
not show abnormal spindle positioning (n=43, data not shown). We also
confirmed that the proper asymmetric cell division occurred even in the
presence of reduced WSP-1 protein levels
(Fig. 8Ad,f). Together, the
results of these RNAi experiments suggest that WSP-1 does not contribute to
spindle orientation during early development of C. elegans.
|
| Discussion |
|---|
|
|
|---|
In the present study, we demonstrated that the Arp2/3 complex is essential for cell migration during ventral enclosure. WSP-1 functions with the Arp2/3 complex to drive cell migration, most probably by inducing actin polymerization, and these actions are likely to be cell autonomous in hypodermal cells. In addition, hypodermal cell differentiation was shown to be normal before and after ventral enclosure, indicating that WSP-1 and the Arp2/3 complex are not involved in cell differentiation. Furthermore, the Arp2/3 complex and WSP-1 seemed to form a complex at the leading edge of hypodermal cells and the results of in vitro actin polymerization assays indicate that the WSP-1-Arp2/3 pathway is likely to be conserved in C. elegans and mammals. On the basis of these results, we conclude that the Arp2/3 complex and WSP-1 are necessary for the actin-mediated generation of forces needed for cell migration during ventral enclosure and that these factors function cell autonomously.
During ventral enclosure, two remarkable events occur. One is hypodermal
cell migration, and the other is formation of cell adhesions. In this study,
we provide evidence that the C. elegans Arp2/3 complex and WSP-1
function in cell migration. Various strategies have been used to identify the
genes involved in ventral enclosure, and cells with mutations in many of these
genes show some cell migration but fail to form cell-cell junctions, or the
embryo ruptures during elongation owing to weak adhesions between cells. These
mutants include apr-1 (tumor suppressor APC related), hmp-1
(
-catenin), hmp-2 (ß-catenin) and hmr-1
(cadherin), all of which encode cell adhesion molecules involved in junction
formation during ventral enclosure. Another gene, mab-2 (semaphorin)
(Roy et al., 2000
), is needed
for proper cell-cell contact, and disruption of this gene leads to embryo
rupture. To date, there is little information regarding molecules involved in
the initial process of hypodermal cell migration during ventral enclosure,
with gex-2 (mammalian Sra-1) or gex-3 (mammalian HEM-2)
being the lone identified genes directly involved in cell migration and dorsal
intercalation during ventral enclosure
(Soto et al., 2002
). Mutations
in these genes lead to defects in cell migration and dorsal intercalation.
With the similarities in phenotypes and the possible involvement of Rho family
small GTPases, which govern the signaling cascade in reorganization of actin
cytoskeletons, the relationship between WSP-1, GEX-2 and GEX-3 in C.
elegans ventral enclosure requires further study. Another class of
mutants defective in ventral enclosure are vab-1 (ephrin receptor
protein-tyrosine kinase) (George et al.,
1998
) and vab-2 (ephrin)
(Chin-Sang et al., 1999
), which
function in neuroblasts. Mutation of these genes results in improperly
positioned neuronal cells, which presumably disrupt a signaling pathway
required for hypodermal cell migration, or the leakage of neural cells, which
blocks hypodermal cell migration. Although it might be because neuronal cells
are resistant to RNAi, depletion of Arp2/3 complex or wsp-1 did not
cause any defects in neural cells, which would inhibit the hypodermal cell
migration.
In fact, ARX-1 and ARX-2 have high homology to actin. The cDNA sequence of arx-2 that we used as a template for dsRNA synthesis in RNAi experiments has a region at the 3'-terminal with 90% homology to act-2, one of the five actin genes in C. elegans. Although this high homology may result in the disruption of actin, the labeling of actin was not reduced significantly in arx-2(RNAi) embryos (Fig. 8Ah,s). Thus, the phenotype of arx-2(RNAi) embryos is thought to be due solely to the disruption of ARX-2.
When RNAi against wsp-1 was driven under the expression of the lin-26 promoter, lin26::wsp-1(RNAi), embryonic lethality was as high as 63% (n=11); soaking or injection of RNAi against wsp-1 only yielded 15% embryonic lethality. A likely explanation is inefficient RNAi by soaking or injection. Although immunofluorescence confirmed that the levels of WSP-1 were reduced after soaking RNAi, it is possible that a small amount of WSP-1 remained beyond the limits of immunofluorescent detection. In addition, it should also be taken into account that only a small number of embryos expressing lin26::wsp-1(RNAi) could be detected owing to the difficulty in detecting the GFP expression marker. In this regard, it is important to consider that greater detectable GFP expression under lin-26 promoter could reflect a greater amount of dsRNA expression, and this is the cause of the higher embryonic lethality seen for RNAi under the expression of the lin-26 promoter.
A second explanation is the existence of alternative signaling pathways that direct the Arp2/3 complex during ventral enclosure. In lin-26::wsp-1(RNAi), which resulted in a high frequency of embryonic lethality, a sudden decrease of WSP-1 may not be compensated for by other proteins. WAVE (WVE-1), another WASP family member, is a candidate for regulating the Arp2/3 complex, but wve-1(RNAi) did not cause a detectable altered phenotype. Following double RNAi against wsp-1 and wve-1, there was no increase in embryonic lethality observed (data not shown). However, we cannot conclude that WVE-1 is not involved in ventral enclosure, because the efficiency of RNAi is also dependent on the target gene.
Depletion of the Arp2/3 complex or WSP-1 did not result in arrest during
early embryogenesis. During ventral enclosure, filamentous actin formation is
greatly reduced by the depletion of Arp2/3 complex or WSP-1; however, actin
accumulation and changes in cell shape were still observed in the ventral
hypodermal cells. Immunostaining and western blotting indicated that the
expression of actin did not change during RNAi against Arp2/3 complex subunits
or wsp-1. Cultured cells injected with an antibody inhibiting the
function of the Arp2/3 complex were reported to have a normal cell shape, but
were unable to form lamellipodia or filopodia
(Bailly et al., 2001
).
Furthermore, fibroblasts from N-WASP-deficient mice have normal actin
cytoskeletons; however, they were defective in some types of filopodia
formation (Lommel et al.,
2001
; Snapper et al.,
2001
). Together, these findings suggest that there may be other
factors that regulate actin cytoskeleton reorganization independently from the
Arp2/3 complex.
Although the Arp2/3 complex has been established as the nucleation core in
actin polymerization, Arp2/3-complex-independent mechanisms of actin
polymerization have recently been identified. Formin, a conserved Rho-GTPase
effector among eukaryotes, is predicted to function in cytokinesis, polarized
growth and stress fiber formation by activating actin assembly independently
from the Arp2/3 complex (Evangelista et
al., 2002
; Pruyne et al.,
2002
; Sagot et al.,
2002
). In addition to formin, Ena/VASP regulates cell motility by
binding to actin directly to promote barbed end elongation with binding to
actin directly (Bear et al.,
2002
). Although the Arp2/3-complex-independent pathways also
function in C. elegans from cytokinesis to morphogenesis, they may
not nucleate actin as efficiently as Arp2/3-dependent pathways in dynamic
reorganization of the actin cytoskeleton. Thus, defects due to disruption of
Arp2/3 complex and WSP-1 might first appear at ventral enclosure with dynamic
cell migration.
It is also possible that the Arp2/3 complex, WSP-1 or WVE-1 functions in
other processes. Since RNAi does not represent disruption of the gene and is
rather a means to inhibit gene expression, the method does not always yield
complete disruption of gene expression. The nervous system, which requires
cell motility during development, is resistant to RNAi
(Tavernarakis et al., 2000
).
Furthermore, in our analysis, RNAi was performed on L4 and adult animals by
soaking, feeding or microinjection of plasmid-based dsRNA under the expression
of the lin-26 promoter. Taking these considerations into account, we
may not have detected all of the functions of the Arp2/3 complex, WSP-1 or
WVE-1. In Drosophila, disruption of the Arp2/3 complex or WAVE/SCAR
causes abnormalities during oogenesis. These mutants have defects in the ring
canal, an actin-dependent structure that functions as a bridge for the flow of
cytoplasm from the nurse cell to the oocyte
(Hudson and Cooley, 2002
;
Zallen et al., 2002
). Although
C. elegans does not have an obvious structure corresponding to the
ring canal, it is possible that Arp2/3, WSP-1 or WVE-1 in C. elegans
may be involved in oogenesis, since maternal proteins may ameliorate the
effect of RNAi in oogenesis in our procedure. In Drosophila, a mutant
of WASP has been isolated and characterized. In Drosophila, Wsp
functions in a Notch-mediated signaling pathway involved in cell
lineage decision, in particular in the central nervous system and mesoderm
(Ben-Yaacov et al., 2001
).
However, we did not detect a phenotype related to cell linage decision.
By western blotting and immunostaining, we found that the expression of
WSP-1 protein is affected by the expression of ARX-1 and, furthermore, stable
localization of WSP-1 requires binding to the Arp2/3 complex from early cell
division to morphogenesis. WSP-1 expression is enhanced when Arp2/3 complex is
decreased. These results indicate that there is a feedback system inducing
WSP-1 expression when the Arp2/3 complex is absent. Immunostaining results
suggest an interaction between the Arp2/3 complex and WSP-1 in vivo. In
mammals, activated WASP and N-WASP bind to the Arp2/3 complex, and this might
indicate that WSP-1 is activated during early cell division as well as during
ventral enclosure. However, it is unclear why WSP-1 localizes in cell nuclei
in embryos depleted of the Arp2/3 complex, because no nuclear N-WASP-binding
molecule has been reported. WSP-1 may be recruited to nuclei in concert with
its increased expression. WSP-1 may function in the rearrangement of cortical
actin filaments during early cell divisions, although we did not detect a
phenotype associated with this period. The localization of the Arp2/3 complex
in wsp-1(RNAi) embryos was not affected. We assume there is
additional machinery that influences the localization of the Arp2/3 complex.
The dependency of WSP-1 on Arp2/3 for localization, and not vice versa, raises
several questions about the relationship between Arp2/3 complex and WSP-1
localization. One is that WSP-1 and the Arp2/3 complex are both contained
within a huge protein complex, and the Arp2/3 complex might determine the
localization of this putative complex. In this regard, it is notable that the
N-WASP regulator in mammals does not affect WSP-1 localization. Although the
most characterized pathway in mammals is activation of WASP by Cdc42, Cdc42
does not influence WSP-1 localization in early cell divisions of C.
elegans. However, during ventral enclosure, cdc42(RNAi) strongly
influenced cells to arrest during early cell divisions, and this prevented us
from examining Cdc42 function at a later stage. It has been reported that
C. elegans Cdc42 (CDC-42) localizes to the periphery of hypodermal
cells during morphogenesis, and this may influence WSP-1 localization
(Chen et al., 1996
). Similarly,
in Drosophila, Cdc42 is not required for regulation of Wsp
during cell lineage determination (Tal et
al., 2002
). Another candidate that may activate WSP-1 is
Ash/Grb2/SEM-5. Although sem-5 mutants have been isolated in C.
elegans, no abnormality in ventral enclosure was observed. WSP-1
localization is also normal in sem-5 mutants (n2019 and
n2030), suggesting that SEM-5 is not a regulator of WSP-1 in ventral
enclosure. Therefore, the regulation of the Arp2/3-WASP pathway in C.
elegans remains unclear.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bailly, M., Ichetovkin, I., Grant, W., Zebda, N., Machesky, L. M., Segall, J. E. and Condeelis, J. (2001). The F-actin side binding activity of the Arp2/3 complex is essential for actin nucleation and lamellipod extension. Curr. Biol. 11,620 -625.[CrossRef][Medline]
Bard, J. (1992). Morphogenesis. Oxford: Oxford University Press.
Bear, J. E., Svitkina, T. M., Krause, M., Schafer, D. A., Loureiro, J. J., Strasser, G. A., Maly, I. V., Chaga, O. Y., Cooper, J. A., Borisy, G. G. et al. (2002). Antagonism between Ena/VASP proteins and actin filament capping regulates fibroblast motility. Cell 109,509 -521.[CrossRef][Medline]
Ben-Yaacov, S., le Borgne, R., Abramson, I., Schweisguth, F. and
Schejter, E. D. (2001). Wasp, the
Drosophila Wiskott-Aldrich syndrome gene homologue, is required for
cell fate decisions mediated by Notch signaling. J. Cell
Biol. 152,1
-13.
Blanchoin, L., Amann, K. J., Higgs, H. N., Marchand, J. B., Kaiser, D. A. and Pollard, T. D. (2000). Direct observation of dendritic actin filament networks nucleated by Arp2/3 complex and WASP/Scar proteins. Nature 404,1007 -1011.[CrossRef][Medline]
Chen, W., Chen, S., Yap, S. F. and Lim, L.
(1996). The Caenorhabditis elegans p21-activated kinase
(CePAK) colocalizes with CeRac1 and CDC42Ce at hypodermal cell boundaries
during embryo elongation. J. Biol. Chem.
271,26362
-26368.
Chin-Sang, I. D., George, S. E., Ding, M., Moseley, S. L., Lynch, A. S. and Chisholm, A. D. (1999). The ephrin VAB-2/EFN-1 functions in neuronal signaling to regulate epidermal morphogenesis in C. elegans. Cell 99,781 -790.[CrossRef][Medline]
Clark, S. G., Stern, M. J. and Horvitz, H. R. (1992). C. elegans cell-signaling gene sem-5 encodes a protein with SH2 and SH3 domains. Nature 356,340 -344.[CrossRef][Medline]
Costa, M., Raich, W., Agbunag, C., Leung, B., Hardin, J. and
Priess, J. R. (1998). A putative catenin-cadherin system
mediates morphogenesis of the Caenorhabditis elegans embryo.
J. Cell Biol. 141,297
-308.
Derry, J. M., Ochs, H. D. and Francke, U. (1994). Isolation of a novel gene mutated in Wiskott-Aldrich syndrome. Cell 78,635 -644.[CrossRef][Medline]
Evangelista, M., Pruyne, D., Amberg, D. C., Boone, C. and Bretscher, A. (2002). Formins direct Arp2/3-independent actin filament assembly to polarize cell growth in yeast. Nat. Cell Biol. 4,32 -41.[CrossRef][Medline]
Fields, S., Kohara, Y. and Lockhart, D. J.
(1999). Functional genomics. Proc. Natl. Acad. Sci.
USA 96,8825
-8826.
George, S. E., Simokat, K., Hardin, J. and Chisholm, A. D. (1998). The VAB-1 Eph receptor tyrosine kinase functions in neural and epithelial morphogenesis in C. elegans.Cell 92,633 -643.[CrossRef][Medline]
Gotta, M., Abraham, M. C. and Ahringer, J. (2001). CDC-42 controls early cell polarity and spindle orientation in C. elegans. Curr. Biol. 11,482 -488.[CrossRef][Medline]
Gournier, H., Goley, E. D., Niderstrasser, H., Trinh, T. and Welch, M. D. (2001). Reconstitution of human Arp2/3 complex reveals critical roles of individual subunits in complex structure and activity. Mol. Cell 8,1041 -1052.[CrossRef][Medline]
Heid, P. J., Raich, W. B., Smith, R., Mohler, W. A., Simokat, K., Gendreau, S. B., Rothman, J. H. and Hardin, J. (2001). The zinc finger protein DIE-1 is required for late events during epithelial cell rearrangement in C. elegans. Dev. Biol. 236,165 -180.[CrossRef][Medline]
Hoier, E. F., Mohler, W. A., Kim, S. K. and Hajnal, A.
(2000). The Caenorhabditis elegans APC-related gene
apr-1 is required for epithelial cell migration and Hox gene
expression. Genes Dev.
14,874
-886.
Hudson, A. M. and Cooley, L. (2002). A subset
of dynamic actin rearrangements in Drosophila requires the Arp2/3
complex. J. Cell Biol.
156,677
-687.
Kay, A. J. and Hunter, C. P. (2001). CDC-42 regulates PAR protein localization and function to control cellular and embryonic polarity in C. elegans. Curr. Biol. 11,474 -481.[CrossRef][Medline]
Koppen, M., Simske, J. S., Sims, P. A., Firestein, B. L., Hall, D. H., Radice, A. D., Rongo, C. and Hardin, J. D. (2001). Cooperative regulation of AJM-1 controls junctional integrity in Caenorhabditis elegans epithelia. Nat. Cell Biol. 3,983 -991.[CrossRef][Medline]
Labouesse, M., Hartwieg, E. and Horvitz, H. R. (1996). The Caenorhabditis elegans LIN-26 protein is required to specify and/or maintain all non-neuronal ectodermal cell fates. Development 122,2579 -2588.[Abstract]
Lommel, S., Benesch, S., Rottner, K., Franz, T., Wehland, J. and Kuhn, R. (2001). Actin pedestal formation by enteropathogenic Escherichia coli and intracellular motility of Shigella flexneri are abolished in N-WASP-defective cells. EMBO Rep. 2,850 -857.[CrossRef][Medline]
Machesky, L. M. and Insall, R. H. (1998). Scar1 and the related Wiskott-Aldrich syndrome protein, WASP, regulate the actin cytoskeleton through the Arp2/3 complex. Curr. Biol. 8,1347 -1356.[CrossRef][Medline]
Machesky, L. M., Mullins, R. D., Higgs, H. N., Kaiser, D. A.,
Blanchoin, L., May, R. C., Hall, M. E. and Pollard, T. D.
(1999). Scar, a WASp-related protein, activates nucleation of
actin filaments by the Arp2/3 complex. Proc. Natl. Acad. Sci.
USA 96,3739
-3744.
Maeda, I., Kohara, Y., Yamamoto, M. and Sugimoto, A. (2001). Large-scale analysis of gene function in Caenorhabditis elegans by high-throughput RNAi. Curr. Biol. 11,171 -176.[CrossRef][Medline]
Miki, H., Miura, K. and Takenawa, T. (1996). N-WASP, a novel actin-depolymerizing protein, regulates the cortical cytoskeletal rearrangement in a PIP2-dependent manner downstream of tyrosine kinases. EMBO J. 15,5326 -5335.[Medline]
Miki, H., Sasaki, T., Takai, Y. and Takenawa, T. (1998a). Induction of filopodium formation by WASP-related actin-depolymerizing protein N-WASP. Nature 391, 93-96.[CrossRef][Medline]
Miki, H., Suetsugu, S. and Takenawa, T. (1998b). WAVE, a novel WASP-family protein involved in actin reorganization induced by Rac. EMBO J. 17,6932 -6941.[CrossRef][Medline]
Mohler, W. A. and White, J. G. (1998a). Stereo-4-D reconstruction and animation from living fluorescent specimens. Biotechniques 24,1006 -1010, 1012.[Medline]
Mohler, W. A. and White, J. G. (1998b). Multiphoton laser scanning microscopy for four-dimensional analysis of C. elegans embryonic development. Optics Express 3, 325-331.
Mohler, W. A., Simske, J. S., Williams-Masson, E. M., Hardin, J. D. and White, J. G. (1998). Dynamics and ultrastructure of developmental cell fusions in the Caenorhabditis elegans hypodermis. Curr. Biol. 8,1087 -1090.[CrossRef][Medline]
Nagai, T., Ibata, K., Park, E. S., Kubota, M., Mikoshiba, K. and Miyawaki, A. (2002). A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications. Nat. Biotechnol. 20,87 -90.[CrossRef][Medline]
Pantaloni, D., Boujemaa, R., Didry, D., Gounon, P. and Carlier, M. F. (2000). The Arp2/3 complex branches filament barbed ends: functional antagonism with capping proteins. Nat. Cell. Biol. 2,385 -391.[CrossRef][Medline]
Pantaloni, D., le Clainche, C. and Carlier, M. F.
(2001). Mechanism of actin-based motility.
Science 292,1502
-1506.
Podbilewicz, B. and White, J. G. (1994). Cell fusions in the developing epithelial of C. elegans. Dev. Biol. 161,408 -424.[CrossRef][Medline]
Pollard, T. D., Blanchoin, L. and Mullins, R. D. (2000). Molecular mechanisms controlling actin filament dynamics in nonmuscle cells. Annu. Rev. Biophys. Biomol. Struct. 29,545 -576.[CrossRef][Medline]
Priess, J. R. and Hirsh, D. I. (1986). Caenorhabditis elegans morphogenesis: the role of the cytoskeleton in elongation of the embryo. Dev. Biol. 117,156 -173.[CrossRef][Medline]
Pruyne, D., Evangelista, M., Yang, C., Bi, E., Zigmond, S.,
Bretscher, A. and Boone, C. (2002). Role of formins in actin
assembly: nucleation and barbed-end association.
Science 297,612
-615.
Raich, W. B., Agbunag, C. and Hardin, J. (1999). Rapid epithelial-sheet sealing in the Caenorhabditis elegans embryo requires cadherin-dependent filopodial priming. Curr. Biol. 9,1139 -1146.[CrossRef][Medline]
Reboul, J., Vaglio, P., Tzellas, N., Thierry-Mieg, N., Moore, T., Jackson, C., Shin-i, T., Kohara, Y., Thierry-Mieg, D., Thierry-Mieg, J. et al. (2001). Open-reading-frame sequence tags (OSTs) support the existence of at least 17,300 genes in C. elegans. Nat. Genet. 27,332 -336.[CrossRef][Medline]
Robinson, R. C., Turbedsky, K., Kaiser, D. A., Marchand, J. B.,
Higgs, H. N., Choe, S. and Pollard, T. D. (2001). Crystal
structure of Arp2/3 complex. Science
294,1679
-1684.
Rohatgi, R., Ma, L., Miki, H., Lopez, M., Kirchhausen, T., Takenawa, T. and Kirschner, M. W. (1999). The interaction between N-WASP and the Arp2/3 complex links Cdc42-dependent signals to actin assembly. Cell 97,221 -231.[CrossRef][Medline]
Roy, P. J., Zheng, H., Warren, C. E. and Culotti, J. G. (2000). mab-20 encodes Semaphorin-2a and is required to prevent ectopic cell contacts during epidermal morphogenesis in Caenorhabditis elegans. Development 127,755 -767.[Abstract]
Sagot, I., Klee, S. K. and Pellman, D. (2002). Yeast formins regulate cell polarity by controlling the assembly of actin cables. Nat. Cell Biol. 4, 42-50.[Medline]
Simske, J. S. and Hardin, J. (2001). Getting into shape: epidermal morphogenesis in Caenorhabditis elegans embryos. Bioessays 23,12 -23.[CrossRef][Medline]
Snapper, S. B., Takeshima, F., Anton, I., Liu, C. H., Thomas, S. M., Nguyen, D., Dudley, D., Fraser, H., Purich, D., Lopez-Ilasaca, M. et al. (2001). N-WASP deficiency reveals distinct pathways for cell surface projections and microbial actin-based motility. Nat. Cell Biol. 3,897 -904.[CrossRef][Medline]
Soto, M. C., Qadota, H., Kasuya, K., Inoue, M., Tsuboi, D.,
Mello, C. C. and Kaibuchi, K. (2002). The GEX-2 and GEX-3
proteins are required for tissue morphogenesis and cell migrations in C.
elegans. Genes Dev. 16,620
-632.
Suetsugu, S., Miki, H. and Takenawa, T. (1999). Identification of two human WAVE/SCAR homologues as general actin regulatory molecules which associate with Arp2/3 complex. Biochem. Biophys. Res. Commun. 260,296 -302.[CrossRef][Medline]
Suetsugu, S., Miki, H., Yamaguchi, H., Obinata, T. and Takenawa, T. (2001). Enhancement of branching efficiency by the actin filament-binding activity of N-WASP/WAVE2. J. Cell Sci. 114,4533 -4542.
Symons, M., Derry, J. M., Karlak, B., Jiang, S., Lemahieu, V., Mccormick, F., Francke, U. and Abo, A. (1996). Wiskott-Aldrich syndrome protein, a novel effector for the GTPase CDC42Hs, is implicated in actin polymerization. Cell 84,723 -734.[CrossRef][Medline]
Tabara, H., Grishok, A. and Mello, C. C.
(1998). RNAi in C. elegans: soaking in the genome
sequence. Science 282,430
-431.
Takenawa, T. and Miki, H. (2001). WASP and WAVE family proteins: key molecules for rapid rearrangement of cortical actin filaments and cell movement. J. Cell Sci. 114,1801 -1809.[Abstract]
Tal, T., Vaizel-Ohayon, D. and Schejter, E. D. (2002). Conserved interactions with cytoskeletal but not signaling elements are an essential aspect of Drosophila WASp function. Dev. Biol. 243,260 -271.[CrossRef][Medline]
Tavernarakis, N., Wang, S. L., Dorovkov, M., Ryazanov, A. and Driscoll, M. (2000). Heritable and inducible genetic interference by double-stranded RNA encoded by transgenes. Nat. Genet. 24,180 -183.[CrossRef][Medline]
Williams-Masson, E. M., Malik, A. N. and Hardin, J. (1997). An actin-mediated two-step mechanism is required for ventral enclosure of the C. elegans hypodermis. Development 124,2889 -2901.[Abstract]
Winter, D. C., Choe, E. Y. and Li, R. (1999).
Genetic dissection of the budding yeast Arp2/3 complex: a comparison of the in
vivo and structural roles of individual subunits. Proc. Natl. Acad.
Sci. USA 96,7288
-7293.
Winter, D., Lechler, T. and Li, R. (1999). Activation of the yeast Arp2/3 complex by bee1p, a WASP-family protein. Curr. Biol. 9,501 -504.[CrossRef][Medline]
Yamaguchi, H., Miki, H. and Takenawa, T. (2002). Two verprolin homology domains increase the Arp2/3 complex-mediated actin polymerization activities of N-WASP and WAVE1 C-terminal regions. Biochem. Biophys. Res. Commun. 297,214 -219.[CrossRef][Medline]
Zallen, J. A., Cohen, Y., Hudson, A. M., Cooley, L., Wieschaus,
E. and Schejter, E. D. (2002). SCAR is a primary regulator of
Arp2/3-dependent morphological events in Drosophila. J. Cell
Biol. 156,689
-701.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
M. Alexander, K. K. M. Chan, A. B. Byrne, G. Selman, T. Lee, J. Ono, E. Wong, R. Puckrin, S. J. Dixon, and P. J. Roy An UNC-40 pathway directs postsynaptic membrane extension in Caenorhabditis elegans Development, March 15, 2009; 136(6): 911 - 922. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Schmidt, N. Marcus-Gueret, A. Adeleye, J. Webber, D. Baillie, and E. G. Stringham The cell migration molecule UNC-53/NAV2 is linked to the ARP2/3 complex by ABI-1 Development, February 15, 2009; 136(4): 563 - 574. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Shakir, K. Jiang, E. C. Struckhoff, R. S. Demarco, F. B. Patel, M. C. Soto, and E. A. Lundquist The Arp2/3 Activators WAVE and WASP Have Distinct Genetic Interactions With Rac GTPases in Caenorhabditis elegans Axon Guidance Genetics, August 1, 2008; 179(4): 1957 - 1971. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yae, V. W. Keng, M. Koike, K. Yusa, M. Kouno, Y. Uno, G. Kondoh, T. Gotow, Y. Uchiyama, K. Horie, et al. Sleeping beauty transposon-based phenotypic analysis of mice: lack of arpc3 results in defective trophoblast outgrowth. Mol. Cell. Biol., August 1, 2006; 26(16): 6185 - 6196. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Semba, K. Iwaya, J. Matsubayashi, H. Serizawa, H. Kataba, T. Hirano, H. Kato, T. Matsuoka, and K. Mukai Coexpression of Actin-Related Protein 2 and Wiskott-Aldrich Syndrome Family Verproline-Homologous Protein 2 in Adenocarcinoma of the Lung Clin. Cancer Res., April 15, 2006; 12(8): 2449 - 2454. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Di Nardo, G. Cicchetti, H. Falet, J. H. Hartwig, T. P. Stossel, and D. J. Kwiatkowski Arp2/3 complex-deficient mouse fibroblasts are viable and have normal leading-edge actin structure and function PNAS, November 8, 2005; 102(45): 16263 - 16268. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||