|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 4 March 2003
doi: 10.1242/jcs.00366
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
1 Research Division for Human Life Sciences, Seoul National University, 28
Yongon-Dong, Chongno-Gu, Seoul 110-744, Korea
2 Department of Dermatology, Seoul National University College of Medicine, 28
Yongon-Dong, Chongno-Gu, Seoul 110-744, Korea
* Author for correspondence (e-mail: gcpark{at}snu.ac.kr)
Accepted 14 January 2003
| Summary |
|---|
|
|
|---|
Key words: Sphingosine-1-phosphate, Melanogenesis, Microphthamia, ERK, MITF
| Introduction |
|---|
|
|
|---|
Melanogenesis is regulated by at least three melanocyte-specific enzymes,
tyrosinase, tyrosinase-related protein 1 (TRP1) and tyrosinase-related protein
2 (TRP2) (Kobayashi et al.,
1994
; Prota, 1988
;
Yokoyama et al., 1994
). Among
these enzymes, tyrosinase is the rate-limiting enzyme and catalyses the
hydroxylation of tyrosine to 3,4-dihydroxyphenylalanine (DOPA) and the
oxidation of DOPA to dopaquinone (Hearing
and Jimenez, 1989
). Thus, the upregulation of tyrosinase was
proposed to be responsible for increased melanin production
(Hearing and Tsukamoto, 1991
).
For these reasons, we started to study the effects of the sphingolipid
metabolite S1P, on melanin synthesis and tyrosinase activity.
Microphthalmia-associated transcription factor (MITF) is a transcription
factor having an essential basic helix-loop-helix-leucine zipper structure,
and is believed to regulate melanocyte pigmentation, proliferation, and
survival (Hodgkinson et al.,
1993
; Steingrimsson et al.,
1994
). Actually, mutations of the MITF gene in humans are known to
cause abnormal pigmentation of the skin and hair, as observed in Waardenburg
Syndrome type IIA (Hughes et al.,
1994
; Tachibana,
1997
; Tassabehji et al.,
1994
). In addition, it has been reported that MITF is a major
transcriptional regulator of the melanogenic enzymes, tyrosinase, TRP-1 and
TRP-2 (Bentley et al., 1994
;
Bertolotto et al., 1998b
;
Yasumoto et al., 1997
;
Yavuzer et al., 1995
).
Furthermore, cAMP elevating agents such as
-melanocyte-stimulating
hormone (
-MSH), forskolin or isobutylmethylxanthine stimulate melanin
synthesis (Englaro et al.,
1995
; Hunt et al.,
1994
; Jimenez et al.,
1988
). Also, it is well known that
-MSH potently induces
the expression of MITF (Bertolotto et al.,
1998a
; Bertolotto et al.,
1998b
; Price et al.,
1998
). Thus, we investigated the effects of S1P on MITF
regulation.
The ERK pathway is a major signaling cascade and plays a crucial role in
cell growth control (Marshall,
1995
). Interestingly, ERK is also known to be involved in the
regulation of cell differentiation, although this depends on cell type
(Cowley et al., 1994
;
Sale et al., 1995
). Recently,
it was reported that the inhibition of the ERK pathway induces B16 melanoma
cell differentiation and increases tyrosinase activity, suggesting that the
ERK signaling pathway regulates melanogenesis
(Englaro et al., 1998
).
Furthermore, it was shown that the activation of ERK by c-Kit stimulation
phosphorylates MITF at serine 73 (Hemesath
et al., 1998
), and that the phosphorylation of MITF at serine 73
is followed by MITF ubiquitination and degradation
(Xu et al., 2000
). Several
lines of evidence suggest that S1P regulates the ERK signaling pathway
(Cuvillier et al., 1996
;
Van Brocklyn et al., 2000
).
Therefore, we hypothesized that S1P may control melanogenesis via the ERK
pathway. In this study, we investigated the effects of S1P on melanogenesis in
Mel-Ab cells. In particular, we analyzed changes in the ERK signaling pathway
and the accompanying MITF regulation.
| Materials and Methods |
|---|
|
|
|---|
Cell cultures
Mel-Ab cell line is a mouse-derived spontaneously immortalized melanocyte
cell line that produces large amounts of melanin
(Dooley et al., 1994
). Mel-Ab
cells were incubated in DMEM supplemented with 10% fetal bovine serum (FBS),
100 nM TPA, 1 nM CT, 50 µg/ml streptomycin and 50 µg/ml penicillin at
37°C in 5% CO2.
Cell viability assay
Cell viability was determined using a crystal violet assay
(Dooley et al., 1994
). After
incubating with the test substances for 24 hours, the culture medium was
removed and replaced with 0.1% crystal violet in 10% ethanol. Cells were then
stained for 5 minutes at room temperature and rinsed four times. The crystal
violet retained by adherent cells was then extracted with 95% ethanol.
Absorbance was determined at 590 nm using an ELISA reader (Molecular Devices,
Sunnyvale, CA).
Measurement of melanin contents and microscopy
Melanin contents were measured as described previously
(Tsuboi et al., 1998
) with
slight modification. Briefly, cells were treated with the test substances in
DMEM containing 2% FBS for 5 days. Cell pellets were dissolved in 1 ml of 1 N
NaOH at 100°C for 30 minutes and centrifuged for 20 minutes at 16,000
g. Optical densities (OD) of the supernatants were measured at
400 nm using an ELISA reader. Standard curves of synthetic melanin (0 to 300
µg/ml) were prepared in triplicate for each experiment. Before melanin
content was measured, the cells were observed under a phase contrast
microscope (Olympus Optical, Tokyo, Japan) and photographed with a digital
color video camera TK-C1380 (JVC, Yokohama, Japan) supported by Image-Pro®
Plus software (Media Cybernetics, Silver Spring, MD).
Tyrosinase activity
Tyrosinase activity was determined as previously described
(Busca et al., 1996
) with
slight modification. Briefly, Mel-Ab cells were cultured in 60 mm dishes.
After incubating with test substances in DMEM containing 2% FBS for 5 days,
the cells were washed with ice-cold PBS and lysed with phosphate buffer (pH
6.8) containing 1% Triton X-100. Cells were then disrupted by freezing and
thawing, and the lysates were clarified by centrifugation at 10,000
g for 5 minutes. After quantifying protein levels and
adjusting concentrations with lysis buffer, 90 µl of each lysate,
containing the same amount of protein, was placed in a 96-well plate, and 10
µl of 10 mM L-DOPA was then added to each well. Control wells contained 90
µl of lysis buffer and 10 µl of 10 mM L-DOPA. Following incubation at
37°C, absorbance was measured every 10 minutes for at least 1 hour at 475
nm using an ELISA reader. A cell-free assay system was used to test for direct
effects on tyrosinase activity. Seventy microliters of phosphate buffer
containing various concentrations of test substances were mixed with 20 µl
of human tyrosinase extracted from primary cultured human melanocytes, as 20
µg of total protein and 10 µl of 10 mM L-DOPA. Following incubation at
37°C, absorbance was measured at 475 nm. As a positive control, 80 µl
phosphate buffer were mixed with 10 µl of 10 µg/ml mushroom tyrosinase
and 10 µl of 10 mM L-DOPA.
Immunoprecipitation assay
Cells were grown in 100 mm culture dishes, starved of serum for 48 hours,
treated with S1P as indicated, lysed on ice for 10 minutes in lysis buffer (20
mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM
sodium pyrophosphate, 1 mM ß-glycerolphosphate, 1 mM
Na3VO4, 1 µg/ml leupeptin and 1 mM
phenylmethylsulfonyl fluoride) and centrifuged at 20,000 g for
10 minutes at 4°C in a microcentrifuge. The lysates were
immunoprecipitated using an antibody against ERK1/2 and protein A agarose
beads, which were washed three times with cell lysis buffer to eliminate
nonspecific binding. The level of MITF protein was measured by
immunoblotting.
Western blot analysis
Cells were grown in 100 mm culture dishes, starved of serum for 48 hours,
and treated with test substances as indicated. They were then lysed in cell
lysis buffer [62.5 mM Tris-HCl (pH 6.8), 2% SDS, 5% ß-mercaptoethanol, 2
mM phenylmethylsulfonyl fluoride, protease inhibitors (CompleteTM, Roche,
Mannheim, Germany), 1 mM Na3VO4, 50 mM NaF and 10 mM
EDTA]. Ten micrograms of protein per lane was separated by SDS-polyacrylamide
gel electrophoresis and blotted onto nitrocellulose membranes, which were
saturated with 5% dried milk in Tris-buffered saline containing 0.4% Tween 20.
Blots were incubated with the appropriate primary antibodies at a dilution of
1:1000, and then further incubated with horseradish peroxidase-conjugated
secondary antibody. Bound antibodies were detected using an enhanced
chemiluminescence plus kit (Amersham International, Little Chalfont, UK).
Reverse transcription-polymerase chain reaction (RT-PCR)
Total RNA was isolated from the cells using an RNeasy Mini Kit (Qiagen,
Valencia, CA). Then, 1 µg of RNA was reverse transcribed using the ImProm
II Reverse Transcription System (Promega, Madison, WI). The cDNA obtained was
amplified with primers to the mouse MITF gene exons 5-8 (5' exon 5
CCCGTCTCTGGAAACTTGATCG and 3' exon 8 CTGTACTCTGAGCAGCAGGTG). The PCR
conditions were 30 cycles of: 94°C for 1 minute, 57°C for 1 minute and
72°C for 2 minutes (Weilbaecher et
al., 1998
), and the resulting 414 bp PCR products were visualized
by electrophoretic separation on 1.5% agarose gels and ethidium bromide
staining. Specific primers for actin were added as a control.
Statistics
Differences between results were assessed for significance using the
Student's t-test.
| Results |
|---|
|
|
|---|
|
Tyrosinase is a rate-limiting enzyme in melanin synthesis. To investigate the effect of S1P on pigmentation, we determined the tyrosinase activity, and found that a significant decrease in tyrosinase activity was induced by S1P at concentrations higher than 1 µM (Fig. 2A). The melanin contents of the Mel-Ab cells were also measured. In untreated cells, a constitutive level of pigment was readily detected (20-30 pg/cell). As shown in Fig. 2B, the melanin contents of cells decreased significantly in the S1P range 1-10 µM. Moreover, melanin reduction by S1P was accompanied by a parallel decrease in tyrosinase activity. These results indicate that S1P regulates tyrosinase, and subsequently inhibits melanin synthesis in Mel-Ab cells. To allow comparisons of the hypopigmenting effects of S1P, kojic acid, which is well known to affect melanin formation in melanocytes and melanoma cells, was added at concentrations from 1 to 100 µM. As expected, kojic acid reduced the amount of melanin production (Fig. 2C). Interestingly, the inhibitory effect of S1P (1-10 µM) on melanin synthesis was greater than that of kojic acid at concentrations in the 1-100 µM range.
|
To determine whether S1P can inhibit tyrosinase directly, we compared the effect of S1P with that of kojic acid on tyrosinase in a cell-free system, as described above in Materials and Methods, by using human tyrosinase extracted from primary cultured human melanocytes. As shown in Fig. 2D, kojic acid inhibited tyrosinase activity significantly in the cell-free system. In contrast, S1P did not suppress human tyrosinase, indicating that S1P does not inhibit tyrosinase activity directly. We repeated the experiment with mushroom tyrosinase (monophenol monooxygenase, EC 1.14.18.1) and obtained the same result (data not shown).
S1P induces MITF degradation and stimulates the ERK pathway
Because S1P reduced tyrosinase activity and melanin synthesis, we further
hypothesized that S1P may affect the expression of MITF, which plays an
important role in melanogenesis. To prove this hypothesis, we studied MITF
levels after S1P treatment. MITF appeared as a doublet before treatment. S1P
treatment induced an initial MITF mobility shift at 2 minutes, and the shift
maintained at least until 10 minutes (Fig.
3A). Following this shift, MITF protein levels decreased slowly
over the course of several hours.
|
Previous studies have demonstrated that ERK phosphorylation by steel factor
triggered MITF degradation (Hemesath et
al., 1998
; Wu et al.,
2000
). Therefore, it was of some interest to determine whether S1P
could influence the ERK pathway. As shown in
Fig. 3A, S1P induced the
sustained activation of ERK. Moreover, the mobility shift of MITF corresponded
to strong ERK phosphorylation. We also investigated events upstream of ERK and
found that S1P stimulated the phosphorylation of MEK (MAPK/ERK kinase). The
kinetics of MEK and ERK activation after S1P stimulation showed similar
patterns (Fig. 3A).
Since a decreased MITF gene expression may be responsible for a diminished level of MITF protein, we examined whether S1P has an effect on MITF transcription. Reverse transcription PCR assays using MITF-specific primers produced a 414 bp fragment corresponding to the MITF mRNA. However, we did not observe a lower level of this PCR fragment in S1P-treated cells (Fig. 3B), while the levels of MITF protein dropped significantly (Fig. 3A). Thus, we suggest that the MITF protein reduction by S1P may be due to MITF degradation, not to suppressed MITF gene expression.
Inhibition of the ERK pathway by PD98059 abrogates S1P-induced
hypopigmentation
In a recent report, we showed that the sustained activation of ERK could
lead to the inhibition of melanin synthesis in human melanocytes
(Kim et al., 2002
). Therefore,
we further studied whether the ERK signaling pathway is related to the
regulation of pigmentation. Thus, we investigated the effect of PD98059, a
specific inhibitor of the ERK pathway, on melanogenesis. Control and
PD98059-treated cells were exposed to S1P for 5 days, and cells were
photographed under a phase contrast microscope
(Fig. 4A). The melanin pigment
was found mainly in the cytoplasm surrounding the nucleus. As we expected from
the observed reductions in tyrosinase activity and melanin synthesis after S1P
treatment, the S1P-treated cells were much less pigmented than the control
cells. In contrast, we observed highly pigmented Mel-Ab cells after PD98059
treatment. Furthermore, PD98059 restored the S1P-induced hypopigmentation to
normal pigmentation. We also measured tyrosinase activity and melanin
synthesis after treatment with PD98059. Consistent with the microscopic
inspection, PD98059 treatment resulted in a significant stimulation of
tyrosinase activity and melanin synthesis in Mel-Ab cells, suggesting that the
inhibition of ERK may stimulate tyrosinase activity and melanin synthesis
(Fig. 4B,C). Conversely, S1P
seemed to inhibit tyrosinase activity and melanin synthesis by activating ERK,
since S1P led to the sustained activation of ERK
(Fig. 3A). Our results also
show that the PD98059 pretreatment abolished the inhibitory effect of S1P on
tyrosinase activity and melanin synthesis
(Fig. 4B,C). These results
suggest that the ERK pathway plays a critical role in melanogenesis.
|
The relationship between the ERK pathway and MITF in Mel-Ab
cells
We examined whether ERK phosphorylation by S1P would induce MITF
degradation, and thus investigated the nature of the interaction between ERK
and MITF by immunoprecipitation. As shown in
Fig. 5A, MITF was detected in
the ERK immunoprecipitated complex from S1P-treated cells. Moreover, a marked
level of mobility-shifted MITF was observed 10 minutes after S1P treatment
when ERK was strongly activated (Fig.
5A). This finding shows that S1P induces the formation of a
complex between ERK and MITF, and suggests that phosphorylated ERK may be
responsible for MITF phosphorylation and degradation.
|
In the next experiment, Mel-Ab cells were pretreated with 20 µM of PD98059 to inhibit ERK phosphorylation. PD98059 was found to markedly inhibit the S1P-induced activation of ERK (Fig. 5B), and the S1P-dependent mobility shift of MITF, which was expected to appear 10 minutes after S1P treatment (Fig. 5B). Furthermore, we also found that PD98059 abrogated S1P-induced MITF degradation, and that it restored the tyrosinase and TRP-1 downregulation by S1P at 180 minutes (Fig. 5C). These results indicate that a reduction in MITF level is correlated with reduced tyrosinase and TRP-1 levels, and that these responses can be blocked by PD98059 treatment. Our results show that S1P inhibits melanin synthesis via ERK activation. In addition, S1P-induced MITF phosphorylation and degradation are considered to be mediated by the MEK/ERK signaling pathway. From these results, we can conclude that S1P inhibits melanin synthesis through ERK activation and subsequent MITF degradation.
| Discussion |
|---|
|
|
|---|
Several reports have indicated that the ERK signaling pathway is involved
in the regulation of melanogenesis in melanocytes. It has been reported that
UVA radiation-induced melanogenesis is associated with the activation of ERK
in human melanocytes (Yanase et al.,
2001
). Moreover, the ERK signaling pathway is activated during
cAMP-induced melanogenesis in B16 melanoma cells
(Englaro et al., 1995
). These
studies suggest that the activation of ERK may increase melanin synthesis.
However, PD98059, a specific inhibitor of the ERK pathway, increased the
amount and the activity of tyrosinase. Moreover, the activation of the ERK
pathway, and the presence of constitutive active mutants of Ras and MEK, led
to the inhibition of tyrosinase gene transcription
(Englaro et al., 1998
). It was
also reported that infection with the v-Ha-ras oncogene decreases
melanogenesis in murine melanocytes
(Tsukamoto et al., 1992
). In a
recent report, the inhibition of MEK activity with anthrax lethal toxin showed
dramatic melanin production in human melanoma cells
(Koo et al., 2002
). In
agreement with these studies, we also demonstrated that PD98059 augments
melanin production in human melanocytes
(Kim et al., 2002
). In the
present study, PD98059 treatment was also found to increase tyrosinase
activity and melanin synthesis in Mel-Ab cells. These findings support our
hypothesis that the inhibition of the ERK pathway induces melanin synthesis;
in other words, the activation of the ERK pathway may be responsible for the
inhibition of melanogenesis. Actually, S1P is a well-known lipid mediator that
stimulates the ERK signaling pathway and then regulates cell proliferation
(Cuvillier et al., 1996
;
Van Brocklyn et al., 2000
). In
our experiments, S1P clearly stimulated MEK and ERK activation and inhibited
melanin synthesis in Mel-Ab cells, supporting our hypothesis. Interestingly,
S1P strongly suppressed the proliferation of Mel-Ab cells (D.-S.K.,
unpublished), although the ERK pathway was markedly activated. However, it was
also proposed that the kinetics of ERK are important in determining cellular
response (Alblas et al., 1998
).
Therefore, the sustained activation of the ERK signaling pathway may play an
important role in the regulation of melanogenesis and in the proliferation of
Mel-Ab cells.
Previous studies have shown that the Akt signaling pathway is important in
the regulation of melanogenesis in G361 melanoma cells
(Oka et al., 2000
) and that
specific inhibition of the Akt pathway by LY294002 stimulates melanin
synthesis in mouse B16 melanoma cells
(Busca et al., 1996
;
Khaled et al., 2002
).
Therefore, we also examined whether the Akt signaling pathway is involved in
melanin production in our cell system, because we found that S1P activates the
Akt pathway in Mel-Ab cells (D.-S.K., unpublished). Thus, we examined the
effect of LY294002, a phosphatidylinositol 3-kinase inhibitor, which blocks
the Akt signaling pathway. We observed that LY294002 treatment increased
melanin synthesis slightly, but that its effect was much less than that of
PD98059 treatment (data not shown). These results indicate that the ERK
pathway plays a critical role in the regulation of melanin synthesis, and that
the activation of Akt by S1P may also contribute to the inhibition of
melanogenesis. Thus, it appears that a complex network of signaling pathways,
including the ERK pathway, may regulate melanogenesis. The involvement of the
Akt pathway in melanogenesis remains to be elucidated.
MITF plays a critical role in melanogenesis, as the major transcriptional
regulator of tyrosinase (Bentley et al.,
1994
; Busca and Ballotti,
2000
; Tachibana,
2000
). Decreased MITF gene expression is known to lead to the
downregulation of melanocyte differentiation markers
(Jimenez-Cervantes et al.,
2001
). Our results show that the activation of ERK after S1P
treatment is correlated with the phosphorylation and degradation of MITF. In
accordance with reduced MITF, tyrosinase and TRP-1 protein were also reduced.
Furthermore, PD98059 abolished the S1P-induced inhibition of tyrosinase
activity and melanin synthesis and the phosphorylation and degradation of
MITF. These results indicate that the inhibition of melanogenesis by S1P is
probably due to the result of the stimulatory action of S1P on the ERK
pathway. Recent studies have demonstrated that ERK phosphorylates MITF at
serine 73 (Hemesath et al.,
1998
), and that the phosphorylation of MITF at serine 73 is
responsible for MITF ubiquitination and degradation
(Xu et al., 2000
). Moreover,
c-Kit activation triggered MITF degradation through the phosphorylation of
MITF by ERK (Wu et al., 2000
).
In the present study, we also showed that PD98059 treatment prevented MITF
phosphorylation and degradation. Thus, we suggest that S1P stimulates the ERK
pathway and subsequently induces MITF phosphorylation and degradation via the
activation of ERK, which leads to a reduced tyrosinase level and decreased
melanogenesis.
Sphingosine was reported to inhibit protein kinase C (PKC) and is believed
to be a negative regulator of cell signaling
(Hannun and Bell, 1987
).
However, sphingosine stimulated the proliferation of quiescent 3T3 fibroblasts
and Rat-1 fibroblasts (Gomez-Munoz et al.,
1995
; Zhang et al.,
1990
). In the present study, sphingosine showed a cytotoxic effect
upon Mel-Ab cells, which may have been due to its detergent properties
(Stoffel and Bister, 1973
) or
its inhibition of PKC (Merrill and
Stevens, 1989
). Moreover, DMS was found to potently inhibit
sphingosine kinase and PKC (Igarashi et
al., 1989
). Thus, the inhibition of both sphingosine kinase and
PKC by DMS may explain its strong cytotoxic effect.
In summary, we demonstrate for the first time the hypopigmenting effect of S1P. Moreover, our results show that increased ERK activation by S1P leads to MITF phosphorylation and degradation, which in turn are responsible for decreased melanin synthesis.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Alblas, J., Slager-Davidov, R., Steenbergh, P. H., Sussenbach, J. S. and van der Burg, B. (1998). The role of MAP kinase in TPA-mediated cell cycle arrest of human breast cancer cells. Oncogene 16,131 -139.[CrossRef][Medline]
Bentley, N. J., Eisen, T. and Goding, C. R.
(1994). Melanocyte-specific expression of the human tyrosinase
promoter: activation by the microphthalmia gene product and role of the
initiator. Mol. Cell Biol.
14,7996
-8006.
Bertolotto, C., Abbe, P., Hemesath, T. J., Bille, K., Fisher, D.
E., Ortonne, J. P. and Ballotti, R. (1998a). Microphthalmia
gene product as a signal transducer in cAMP-induced differentiation of
melanocytes. J. Cell Biol.
142,827
-835.
Bertolotto, C., Busca, R., Abbe, P., Bille, K., Aberdam, E.,
Ortonne, J. P. and Ballotti, R. (1998b). Different cis-acting
elements are involved in the regulation of TRP1 and TRP2 promoter activities
by cyclic AMP: pivotal role of M boxes (GTCATGTGCT) and of microphthalmia.
Mol. Cell Biol. 18,694
-702.
Busca, R. and Ballotti, R. (2000). Cyclic AMP a key messenger in the regulation of skin pigmentation. Pigment Cell Res. 13,60 -69.[CrossRef][Medline]
Busca, R., Bertolotto, C., Ortonne, J. P. and Ballotti, R.
(1996). Inhibition of the phosphatidylinositol
3-kinase/p70(S6)-kinase pathway induces B16 melanoma cell differentiation.
J. Biol. Chem. 271,31824
-31830.
Cowley, S., Paterson, H., Kemp, P. and Marshall, C. J. (1994). Activation of MAP kinase kinase is necessary and sufficient for PC12 differentiation and for transformation of NIH 3T3 cells. Cell 77,841 -852.[CrossRef][Medline]
Cuvillier, O., Pirianov, G., Kleuser, B., Vanek, P. G., Coso, O. A., Gutkind, S. and Spiegel, S. (1996). Suppression of ceramide-mediated programmed cell death by sphingosine-1-phosphate. Nature 381,800 -803.[CrossRef][Medline]
Dooley, T. P., Gadwood, R. C., Kilgore, K. and Thomasco, L. M. (1994). Development of an in vitro primary screen for skin depigmentation and antimelanoma agents. Skin Pharmacol. 7,188 -200.[Medline]
Englaro, W., Rezzonico, R., Durand-Clement, M., Lallemand, D.,
Ortonne, J. P. and Ballotti, R. (1995). Mitogen-activated
protein kinase pathway and AP-1 are activated during cAMP-induced
melanogenesis in B-16 melanoma cells. J. Biol. Chem.
270,24315
-24320.
Englaro, W., Bertolotto, C., Busca, R., Brunet, A., Pages, G.,
Ortonne, J. P. and Ballotti, R. (1998). Inhibition of the
mitogen-activated protein kinase pathway triggers B16 melanoma cell
differentiation. J. Biol. Chem.
273,9966
-9970.
Gomez-Munoz, A., Waggoner, D. W., O'Brien, L. and Brindley, D.
N. (1995). Interaction of ceramides, sphingosine, and
sphingosine 1-phosphate in regulating DNA synthesis and phospholipase D
activity. J. Biol. Chem.
270,26318
-26325.
Hannun, Y. A. and Bell, R. M. (1987).
Lysosphingolipids inhibit protein kinase C: implications for the
sphingolipidoses. Science
235,670
-674.
Hearing, V. J. and Jimenez, M. (1989). Analysis of mammalian pigmentation at the molecular level. Pigment Cell Res. 2,75 -85.[Medline]
Hearing, V. J. and Tsukamoto, K. (1991). Enzymatic control of pigmentation in mammals. FASEB J. 5,2902 -2909.[Abstract]
Hemesath, T. J., Price, E. R., Takemoto, C., Badalian, T. and Fisher, D. E. (1998). MAP kinase links the transcription factor Microphthalmia to c-Kit signalling in melanocytes. Nature 391,298 -301.[CrossRef][Medline]
Hodgkinson, C. A., Moore, K. J., Nakayama, A., Steingrimsson, E., Copeland, N. G., Jenkins, N. A. and Arnheiter, H. (1993). Mutations at the mouse microphthalmia locus are associated with defects in a gene encoding a novel basic-helix-loop-helix-zipper protein. Cell 74,395 -404.[CrossRef][Medline]
Hughes, A. E., Newton, V. E., Liu, X. Z. and Read, A. P. (1994). A gene for Waardenburg syndrome type 2 maps close to the human homologue of the microphthalmia gene at chromosome 3p12-p14.1. Nat. Genet. 7,509 -512.[CrossRef][Medline]
Hunt, G., Todd, C., Cresswell, J. E. and Thody, A. J. (1994). Alpha-melanocyte stimulating hormone and its analogue Nle4DPhe7 alpha-MSH affect morphology, tyrosinase activity and melanogenesis in cultured human melanocytes. J. Cell Sci. 107,205 -211.[Abstract]
Igarashi, Y., Hakomori, S., Toyokuni, T., Dean, B., Fujita, S., Sugimoto, M., Ogawa, T., el-Ghendy, K. and Racker, E. (1989). Effect of chemically well-defined sphingosine and its N-methyl derivatives on protein kinase C and src kinase activities. Biochemistry 28,6796 -6800.[CrossRef][Medline]
Jimenez, M., Kameyama, K., Maloy, W. L., Tomita, Y. and Hearing,
V. J. (1988). Mammalian tyrosinase: biosynthesis, processing,
and modulation by melanocyte-stimulating hormone. Proc. Natl. Acad.
Sci. USA 85,3830
-3834.
Jimenez-Cervantes, C., Martinez-Esparza, M., Perez, C., Daum, N., Solano, F. and Garcia-Borron, J. C. (2001). Inhibition of melanogenesis in response to oxidative stress: transient downregulation of melanocyte differentiation markers and possible involvement of microphthalmia transcription factor. J. Cell Sci. 114,2335 -2344.[Medline]
Khaled, M., Larribere, L., Bille, K., Aberdam, E., Ortonne, J.
P., Ballotti, R. and Bertolotto, C. (2002). Glycogen synthase
kinase 3beta is activated by cAMP and plays an active role in the regulation
of melanogenesis. J. Biol. Chem.
277,33690
-33697.
Kim, D. S., Kim, S. Y., Moon, S. J., Chung, J. H., Kim, K. H., Cho, K. H. and Park, K. C. (2001). Ceramide inhibits cell proliferation through Akt/PKB inactivation and decreases melanin synthesis in Mel-Ab cells. Pigment Cell Res. 14,110 -115.[CrossRef][Medline]
Kim, D. S., Kim, S. Y., Chung, J. H., Kim, K. H., Eun, H. C. and Park, K. C. (2002). Delayed ERK activation by ceramide reduces melanin synthesis in human melanocytes. Cell Signal 14,779 -785.[CrossRef][Medline]
Kobayashi, T., Urabe, K., Winder, A., Jimenez-Cervantes, C., Imokawa, G., Brewington, T., Solano, F., Garcia-Borron, J. C. and Hearing, V. J. (1994). Tyrosinase related protein 1 (TRP1) functions as a DHICA oxidase in melanin biosynthesis. EMBO J. 13,5818 -5825.[Medline]
Koo, H. M., VanBrocklin, M., McWilliams, M. J., Leppla, S. H.,
Duesbery, N. S. and Woude, G. F. (2002). Apoptosis and
melanogenesis in human melanoma cells induced by anthrax lethal factor
inactivation of mitogen-activated protein kinase kinase. Proc.
Natl. Acad. Sci. USA 99,3052
-3057.
Marshall, C. J. (1995). Specificity of receptor tyrosine kinase signaling: transient versus sustained extracellular signal-regulated kinase activation. Cell 80,179 -185.[CrossRef][Medline]
Merrill, A. H., Jr and Stevens, V. L. (1989). Modulation of protein kinase C and diverse cell functions by sphingosinea pharmacologically interesting compound linking sphingolipids and signal transduction. Biochim. Biophys. Acta 1010,131 -139.[Medline]
Mishima, Y., Hatta, S., Ohyama, Y. and Inazu, M. (1988). Induction of melanogenesis suppression: cellular pharmacology and mode of differential action. Pigment Cell Res. 1,367 -374.[CrossRef][Medline]
Oka, M., Nagai, H., Ando, H., Fukunaga, M., Matsumura, M., Araki, K., Ogawa, W., Miki, T., Sakaue, M., Tsukamoto, K. et al. (2000). Regulation of melanogenesis through phosphatidylinositol 3-kinase-Akt pathway in human G361 melanoma cells. J. Invest. Dermatol. 115,699 -703.[CrossRef][Medline]
Price, E. R., Horstmann, M. A., Wells, A. G., Weilbaecher, K.
N., Takemoto, C. M., Landis, M. W. and Fisher, D. E. (1998).
alpha-Melanocyte-stimulating hormone signaling regulates expression of
microphthalmia, a gene deficient in Waardenburg syndrome. J. Biol.
Chem. 273,33042
-33047.
Prota, G. (1988). Some new aspects of eumelanin chemistry. Prog. Clin. Biol. Res. 256,101 -124.[Medline]
Pyne, S. and Pyne, N. J. (2000). Sphingosine 1-phosphate signalling in mammalian cells. Biochem. J. 349,385 -402.[CrossRef][Medline]
Sale, E. M., Atkinson, P. G. and Sale, G. J. (1995). Requirement of MAP kinase for differentiation of fibroblasts to adipocytes, for insulin activation of p90 S6 kinase and for insulin or serum stimulation of DNA synthesis. EMBO J. 14,674 -684.[Medline]
Spiegel, S. (1999). Sphingosine 1-phosphate: a prototype of a new class of second messengers. J. Leukocyte Biol. 65,341 -344.[Abstract]
Steingrimsson, E., Moore, K. J., Lamoreux, M. L., Ferre-D'Amare, A. R., Burley, S. K., Zimring, D. C., Skow, L. C., Hodgkinson, C. A., Arnheiter, H., Copeland, N. G. et al. (1994). Molecular basis of mouse microphthalmia (mi) mutations helps explain their developmental and phenotypic consequences. Nat. Genet. 8, 256-263.[CrossRef][Medline]
Stoffel, W. and Bister, K. (1973). Stereospecificities in the metabolic reactions of the four isomeric sphinganines (dihydrosphingosines) in rat liver. Hoppe Seylers Z. Physiol. Chem. 354,169 -181.[Medline]
Tachibana, M. (1997). Evidence to suggest that expression of MITF induces melanocyte differentiation and haploinsufficiency of MITF causes Waardenburg syndrome type 2A. Pigment Cell Res. 10,25 -33.[CrossRef][Medline]
Tachibana, M. (2000). MITF: a stream flowing for pigment cells. Pigment Cell Res. 13,230 -240.[CrossRef][Medline]
Tassabehji, M., Newton, V. E. and Read, A. P. (1994). Waardenburg syndrome type 2 caused by mutations in the human microphthalmia (MITF) gene. Nat. Genet. 8, 251-255.[CrossRef][Medline]
Tsuboi, T., Kondoh, H., Hiratsuka, J. and Mishima, Y. (1998). Enhanced melanogenesis induced by tyrosinase gene-transfer increases boron-uptake and killing effect of boron neutron capture therapy for amelanotic melanoma. Pigment Cell Res. 11,275 -282.[CrossRef][Medline]
Tsukamoto, K., Ueda, M. and Hearing, V. J. (1992). Melanogenesis in murine melanocytes is suppressed by infection with the v-rasHa oncogene. Pigment Cell Res. Suppl. 2,181 -184.[Medline]
Van Brocklyn, J. R., Graler, M. H., Bernhardt, G., Hobson, J.
P., Lipp, M. and Spiegel, S. (2000). Sphingosine-1-phosphate
is a ligand for the G protein-coupled receptor EDG-6.
Blood 95,2624
-2629.
Weilbaecher, K. N., Hershey, C. L., Takemoto, C. M., Horstmann,
M. A., Hemesath, T. J., Tashjian, A. H. and Fisher, D. E.
(1998). Age-resolving osteopetrosis: a rat model implicating
microphthalmia and the related transcription factor TFE3. J. Exp.
Med. 187,775
-785.
Wu, M., Hemesath, T. J., Takemoto, C. M., Horstmann, M. A.,
Wells, A. G., Price, E. R., Fisher, D. Z. and Fisher, D. E.
(2000). c-Kit triggers dual phosphorylations, which couple
activation and degradation of the essential melanocyte factor Mi.
Genes Dev. 14,301
-312.
Xu, W., Gong, L., Haddad, M. M., Bischof, O., Campisi, J., Yeh, E. T. and Medrano, E. E. (2000). Regulation of microphthalmia-associated transcription factor MITF protein levels by association with the ubiquitin-conjugating enzyme hUBC9. Exp. Cell Res. 255,135 -143.[CrossRef][Medline]
Yanase, H., Ando, H., Horikawa, M., Watanabe, M., Mori, T. and Matsuda, N. (2001). Possible involvement of ERK 1/2 in UVA-induced melanogenesis in cultured normal human epidermal melanocytes. Pigment Cell Res. 14,103 -109.[CrossRef][Medline]
Yasumoto, K., Yokoyama, K., Takahashi, K., Tomita, Y. and
Shibahara, S. (1997). Functional analysis of
microphthalmia-associated transcription factor in pigment cell-specific
transcription of the human tyrosinase family genes. J. Biol.
Chem. 272,503
-509.
Yavuzer, U., Keenan, E., Lowings, P., Vachtenheim, J., Currie, G. and Goding, C. R. (1995). The Microphthalmia gene product interacts with the retinoblastoma protein in vitro and is a target for deregulation of melanocyte-specific transcription. Oncogene 10,123 -134.[Medline]
Yokoyama, K., Suzuki, H., Yasumoto, K., Tomita, Y. and Shibahara, S. (1994). Molecular cloning and functional analysis of a cDNA coding for human DOPAchrome tautomerase/tyrosinase-related protein-2. Biochim. Biophys. Acta 1217,317 -321.[Medline]
Zhang, H., Buckley, N. E., Gibson, K. and Spiegel, S.
(1990). Sphingosine stimulates cellular proliferation via a
protein kinase C-independent pathway. J. Biol. Chem.
265, 76-81.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
M. D. Onken, L. A. Worley, M. D. Long, S. Duan, M. L. Council, A. M. Bowcock, and J. W. Harbour Oncogenic Mutations in GNAQ Occur Early in Uveal Melanoma Invest. Ophthalmol. Vis. Sci., December 1, 2008; 49(12): 5230 - 5234. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ohguchi, Y. Banno, Y. Akao, and Y. Nozawa Involvement of Phospholipase D1 in Melanogenesis of Mouse B16 Melanoma Cells J. Biol. Chem., January 30, 2004; 279(5): 3408 - 3412. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||