|
|
![]() |
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 30 March 2004
doi: 10.1242/jcs.01062
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
C-adaptin
University of Heidelberg, Department of Cell Biology, Heidelberg Institute for Plant Sciences, 69120 Heidelberg, Im Neuenheimer Feld 230, Germany
* Author for correspondence (e-mail: susanne_h.holstein{at}urz.uni-heidelberg.de)
Accepted 17 December 2003
| Summary |
|---|
|
|
|---|
-adaptin interacts with various network proteins that are in turn required for the budding of the coated pits. The process of clathrin-mediated endocytosis in plants has not been dissected at the molecular level, nor have the members of an analogous uptake machinery been functionally described. In this respect, we have investigated the AP180 and
-adaptin orthologs from Arabidopsis thaliana: At-AP180 and At-
C-Ad. Both plant proteins display the same structural features as their mammalian counterparts and fulfill the same basic functions. To identify their interacting partners, the ear region of At-
C-Ad and the C-terminal region of At-AP180 were used as fusion proteins in pull-down experiments and plasmon-resonance measurements. At-
C-Ad binds several mammalian endocytic proteins, and its interaction with At-AP180 requires the DPF motif. At-AP180 functions as a clathrin assembly protein that promotes the formation of cages with an almost uniform size distribution. Deletion of the single DLL motif abolished the assembly activity of At-AP180 almost completely, but did not affect its binding to triskelia, suggesting the existence of additional binding determinants.
Key words:
-Adaptin, AP180, Network-proteins, Endocytic clathrin-machinery, Clathrin reassembly
| Introduction |
|---|
|
|
|---|
Dissection of each single step during the process of CME has revealed that distinct subsets of cytosolic endocytic network proteins are required for efficient clathrin and cargo recruitment (Brodsky et al., 2001; Higgins and McMahon, 2002
). Thus, the various components of the clathrin machinery can be divided into two groups. The first group comprises the true coat components: clathrin, the AP2 complex, AP180, auxilin and HIP1/HIP1R (Kirchhausen, 1999; Kirchhausen, 2000a
; Engqvist-Goldstein et al., 2001; Scheele et al., 2001
), whereas the second group consists of cytosolic network proteins (e.g. eps15, amphiphysin, epsin and dynamin), which associate only transiently with the coat proteins, but also with each other in order to perform their functions (Kichhausen, 2000b; Slepnev and DeCamilli, 2000
). A cross-section through a clathrin-coated vesicle (CCV) therefore reveals a three-layered structure: the outer coat layer of clathrin triskelia is connected via the middle layer of AP2 complexes to the inner layer of integral proteins of the vesicle membrane (Pearse et al., 2000
).
Of the four mammalian AP complexes the AP2 complex, which is exclusively associated with endocytic CCV, is the best characterized (Brett et al., 2002
; Collins et al., 2002
). Like the others, it is a heterotetrameric complex consisting of two large (
A- or
C-, ß2-adaptin,
100 kDa), one medium (µ2-adaptin,
50 kDa) and one small subunit (
2-adaptin,
20 kDa) (Kirchhausen, 1999). With the exception of the small subunit, all the others have well-described functions assigned to their specific domains. Accordingly, the C-terminal ear domain of
C-adaptin serves as a binding platform for several network proteins, which in turn contain specific
C-ear-domain binding motifs (DPF, DPW or FXDXF) in a variable number and composition (Owen et al., 1999
; Brett et al., 2002
). Likewise, the monomeric neuronal coat protein AP180 also contains within its C-terminal disordered region several consensus binding sites for the
C-adaptin ear domain and also for clathrin (Morgan et al., 2000
; Kalthoff et al., 2002
). Since AP180 was discovered independently in several laboratories, it was formerly designated NP185 (Kohtz and Puszkin, 1988
) and F1-20 (Zhou et al., 1992
), as well as AP3 (Keen, 1987
). The commonly used name AP180 (Ahle and Ungewickell, 1986
) reflects its electrophoretic mobility in SDS gels, where it migrates as a polypeptide double its size (Morris et al., 1993
). AP180 is exclusively found in neuronal cells, where it plays a crucial role in synaptic vesicle formation (Morgan et al., 1998
; Yao et al., 2002
), but it also promotes the assembly of uniform size clathrin cages in vitro (Ahle and Ungewickell, 1986
; Ye and Lafer, 1995b
). Its non-neuronal homolog CALM is less efficient as a clathrin assembly protein (Dreyling et al., 1996
; Tebar et al., 1999
). Like their mammalian AP180 homologs, UNC-11 from Caenorhabditis elegans (Nonet et al., 1999
) and LAP from Drosophila (Zhang et al., 1998
) are also implicated in CME. The N-terminal region of AP180 displays an epsin-N-terminal-homology (ENTH) domain, which enables the protein to bind specifically to PM-localized phosphatidylinositol-(4,5)-bisphosphate (Itoh et al., 2001
). Thus, AP180 is supposed to play an important role in the first step of clathrin-coated pit initiation in that it tethers clathrin to the PM (Ford et al., 2001
). Another group of mammalian ENTH-domain-containing proteins also involved in endocytosis are the epsins. These resemble AP180, not only in their structural features, but also in their capacity to assemble clathrin triskelia (Kalthoff et al., 2002
) and to bind to
-adaptin (Wang et al., 1995
), but they can not be co-purified with clathrin-coat components in a CCV fraction (Chen et al., 1998
).
While mammalian CME has been dissected at the molecular level, the situation in plant cells differs remarkably. In fact, a controversial debate has gone on over decades as to whether endocytosis might be possible at all in intact plant cells. Turgor pressure has often been considered to be the main obstacle, but the turning point in this discussion was brought about by the realization that at low turgor pressures and for small vesicles (<100 nm), endocytosis is thermodynamically feasible. Because, in addition, turgor fluctuates considerably under field conditions, it is no longer considered to be an absolute factor preventing the occurrence of endocytosis in plants (for reviews see Low and Chandra, 1994
; Hawes et al., 1995
; Marcote et al., 2000
; Holstein, 2002
).
Against this background it is not surprising that only little is known about clathrin-dependent endocytosis in plant cells. CCP have been reported at the plant PM and they are especially numerous in actively growing cells with a high PM turnover rate such as root hairs and pollen tubes (Emons and Traas, 1986
; Blackbourn and Jackson, 1996
; Hepler et al., 2001
). Nevertheless, despite the fact that some features of receptor-mediated endocytosis also seem to apply to plants, this process has not been proven unequivocally. Thus, the cargo of plant endocytic CCV still has to be identified. Signalling receptors, most of which belong to the large group of receptor protein kinases (McCarty and Chory, 2000
), are probable candidates for CME, as some of them contain the conserved YXXØ internalization motif that allows for interaction with the respective adaptins (overview in Holstein, 2002
; Happel et al., 2004
). Although the uptake of electron-dense markers via CCP at the plant PM has been reported (overview in Low and Chandra, 1994
) clathrin has not been connected to plant endocytosis events at the molecular level despite the fact that orthologs of several coat components have been described: a plant clathrin heavy chain (CHC) (Blackbourn and Jackson, 1996
), a plant clathrin light chain (CLC) (Scheele and Holstein, 2002
), ß-adaptins (Holstein et al., 1994
; Holstein and Happel, 2000
), µ-adaptins (Happel et al., 1997
; Happel et al., 2004
) and also plant
-adaptins (Boehm and Bonifacino, 2001
). In addition, the existence of homologs to other components of the mammalian clathrin machinery might qualify them as plant network-protein candidates (Lam et al., 2001
; Holstein, 2002
).
To obtain a first insight into the existence of a clathrin-based endocytosis machinery in plants, we have functionally characterized the Arabidopsis orthologs of two key proteins involved in mammalian endocytosis: AP180 and
C-adaptin. We show that the plant
C-adaptin homolog binds to several mammalian network proteins and also to plant At-AP180, and depends thereby on the DPF-motif. Furthermore, the clathrin assembly activity of At-AP180 has been shown, which requires the presence of a single consensus clathrin binding/assembly motif.
| Materials and Methods |
|---|
|
|
|---|
Sequence analysis
For the protein structure homology modeling the automated Swissmodel server with the mouse PDB 1KY6 file as a template was used. Casein kinase 2 substrate sites were detected by analysis of the At-AP180 sequence using the Prosite database. The best alignment of two sequences was performed with the LALIGN algorithm version. 2.0 (Huang and Miller, 1991
).
Primer
To obtain the AP180 full-length cDNA the forward primer including a NcoI-site: 5'CATGCCATGGCATGGACGACGAGGACAATGCCGAGCAAGC3' and the reverse primer containing a BamHI-site: 5'CGGGATCCCGTCAACTCAAGTGCTTGGCTATGATCTTTTTCTGG3' were used. To obtain the full-length At-
C-Ad clone the forward primer with a KpnI-site: 5'GGGGTACCCCATGACCGGAATGAGAGGTCT CTCCG3' and the reverse primer also containing a KpnI-site: 5'GGGGTACCCCGAAGTAAGCCAGCAAGCATAGCTCC3' were used. The At-
C-h-ear construct was obtained by adding the forward primer containing a SmaI-site: 5'TCCCCCGGG- GACTCAAGTGCTTGGCTATGATCTTTTTCTGG3' and the reverse primer also containing a SmaI-site: 5'TCCCCCGGGGACTCAAGTGCTTGGCTATGATCTTTTTCTGG3'. For At-
C-Ad-h
-ear amplification, the forward primer harboring an EcoRI-site: 5'GGAATTCCAAAGCTTCTTATGCACGCTCAACCCCC3' and the reverse primer also harboring an EcoRI-site: 5'GGAATTCCTCAGCTTTGATTG CCAATG GATATGAGG3' were used.
Site-directed mutagenesis
Site-directed mutagenesis was performed according to the manufacturer's instruction using the QuikChange Site-Directed Mutagenesis Kit from Stratagene (Heidelberg, Germany).
Fusion protein constructs
All steps that require kits were performed according to the manufacturers' instructions. Total RNA was isolated from Arabidopsis thaliana wild-type var. Columbia leaves using the RNAeasy Plant Mini Kit (Qiagen, Hilden, Germany). The cDNA was obtained from 1 µg total RNA using the AMV reverse transcriptase (Roche, Mannheim, Germany). The cDNA was subsequently used as a template to construct the following clones in PCR reactions. The 1985 bp fragment full-length At-AP180 clone was obtained with its specific primers and cloned into the pGEMT-easy vector (Promega, Mannheim, Germany) for amplification and commercial sequencing purposes (MWG, Eberswalde, Germany). To obtain the histidine fusion protein (H6-At-AP180), the At-AP180 full-length clone was then inserted into the NcoI and BamHI sites of pET30a vector (Novagen, Schwalbach, Germany). Its truncated version, At-AP180
ENTH, was obtained by releasing the first 1030 bp by digestion of a sequence-internal SacI site and the vector NotI site. The 956 bp C-terminal fragment was subcloned into the pET30b vector (Novagen, Schwalbach, Germany) and subsequently cleaved using EcoRI and NotI. The fragment was ligated into the corresponding sites of the pGEX-4T3 vector (Amersham-Pharmacia Biotech, Freiburg, Germany) to obtain the GST-At-AP180
ENTH clone.
The full-length At-
C-Ad clone (3039 bp) as well as the At-
C-Ad-h-ear and the At-
C-Ad-h
ear fragments were produced using the respective primers given above. All three PCR-fragments were subsequently cloned into the pGEMT-easy vector. To obtain the GST-At-
C-Ad-h-ear construct digestion with SmaI released the 1437 bp fragment, which was then inserted into the SmaI-site of pGEX4T-2 vector. To obtain the GST-fusion-protein of the truncated version, At-
C-Ad-h
ear, digestion with EcoRI released the 669 bp fragment, which was then inserted into pGEX4T-3 vector.
Expression and purification of fusion-proteins
H6- and GST-fusion proteins were expressed and purified as described previously (Scheele and Holstein, 2002
), with the following modifications. For induction IPTG was added to a final concentration of 1 mM or 0.5 mM for H6- and GST-fusion proteins, respectively. Induction occured at room temperature for 3 hours.
For the optimal purification of H6-At-AP180
ENTH, the cytosolic supernatant obtained after the ultracentrifugation step was purified as described elsewhere (Kalthoff, 2003
). The resulting supernatant was then incubated with 5 ml of 50% Ni-NTA beads. Protein solutions were changed into buffer G (see below) and then gelfiltered via a Superdex 200 column connected to a FPLC with a flow rate of 0.5 ml/minute. The fractions were analyzed on a Coomassie-stained gel and the positive fractions were pooled and used after protein concentration was determined (Bradford, 1976
).
Pull-down experiments
For binding, both the GST- and the H6-fusion proteins were changed into binding buffer G (25 mM Hepes, pH 7.1, 125 mM K+-acetate, 5 mM Mg2+-acetate) using PD-10 columns (Amersham-Pharmacia Biotech, Freiburg, Germany). For each binding experiment 10 µl packed glutathione-sepharose (GSH) beads were prepared according to the manufacturer's instructions (Amersham-Pharmacia Biotech, Freiburg, Germany) and subsequently incubated with 20 µg of the respective GST-fusion protein for 1 hour at 4°C. 7 µg of the H6-At-AP180
ENTH construct or 5 µg stripped clathrin from pig CCV were added to the pre-incubated GSH-beads, filled up to 200 µl final volume and incubated for 1 hour at 4°C on a rotator. The beads were washed five times with 300 µl buffer G and the final pellet was resuspended in 20 µl sample buffer (Laemmli, 1970
). The samples were boiled at 95°C for 1 minute and subjected to SDS-PAGE. From each supernatant 1/40 volume and from each pellet 1/4 volume were loaded on a gel-slot. Each binding assay was independently performed three times each with three samples.
Reassembly of clathrin triskelia
Clathrin reassembly was performed in a total volume of 250 µl with 40 µg clathrin alone or in the presence of 3.6 µg GST-At-AP180
ENTH or 2.1 µg H6-At-AP180
ENTH when equimolar concentrations (238 nM) were required. Dialysis was overnight against buffer S (0.1 M Mes, pH 6.5, 0.5 mM MgCl2, 1 mM EGTA, 0.02% NaN3). The cages were obtained in the pellets after centrifugation at 120,000 g for 20 minutes in a S45A Sorvall rotor and resuspended in 100 µl buffer S. From both, the supernatant and the pellet, 80 µl-aliquots were prepared for SDS-PAGE by adding 4x concentrated sample buffer (Laemmli, 1970
).
Electron microscopy
Aliquots of 20 µl from the pellets were used for negative staining that was performed as described elsewhere (Depta and Robinson, 1986
). The electron micrographs were taken at 80 kV using a Philips CM10 electron microscope.
Gel electrophoresis, western blotting and protein determination
SDS-gradient gels (10-19%) were prepared as previously described (Holstein et al., 1996
). Proteins were blotted onto nitrocellulose (Towbin et al., 1979
) and visualized with the Supersignal West Pico ECL kit (Pierce, Rockford, USA). Protein concentrations were determined according to Bradford (Bradford, 1976
).
Antibodies
Primary antibodies used in immunoblots were: H6-antibody in a 1:2000 dilution and a GST-antibody at a 1:1000 dilution (both from Amersham-Pharmacia Biotech, Freiburg, Germany). The monoclonal antibody directed against mammalian CHC (BD, Transduction Laboratories, Franklin Lakes, USA) was used in 1:500 dilution. The antibodies, given with the respective final dilutions, against mammalian amphiphysin (1:10,000), epsin (1:1000), AP180 (1:2000), dynamin (1:1000), and eps15 (1:1000) were a gift from E. Ungewickell (Medical School, Hannover, Germany). Secondary antibodies against mouse, rabbit or goat coupled to horseradish peroxidase, were obtained from Sigma (Taufkirchen, Germany) and used in final concentrations of 1:10,000.
Gelfiltration on Superose 6/FPLC
CCV were isolated from pig brain as described elsewhere (Lindner, 1994
). To remove the coat proteins from mammalian CCV, approx. 1 mg was incubated in final 3 mM EDTA and 0.5 M Tris/bufferA (0.1 M Mes, pH 6.4, 0.5 mM MgCl2, 1 mM EGTA, 1 mM EDTA) for 30 minutes at 4°C. Centrifugation for 1 hour at 120,000 g in a T12.50 rotor then separated the soluble coat proteins from the vesicle membranes. About 0.5 mg/0.5 ml coat proteins were applied on a Superose 6 column connected to a FPLC (Amersham-Pharmacia Biotech, Freiburg, Germany). The flow rate was 0.3 ml/minute and the fraction size was 0.5 ml. Each fraction was analyzed on immunoblots. Calibration of Superose 6 column was performed before using the molecular weight marker kit (MW-GF-1000) from Sigma (Deisenhofen, Germany).
Surface plasmon-resonance (SPR) analysis
Association of H6-At-AP180
ENTH with the GST-fusion proteins of At-
C-Ad was analyzed in real-time by surface plasmon-resonance (SPR) using a BIAcore 3000 biosensor (BIAcore AB, Freiburg, Germany) and is described in detail elsewhere (Jonsson et al., 1999). In brief, an anti-GST monoclonal antibody (BIAcore AB, Freiburg, Germany) was immobilized on all four flow cells of a CM-5 sensor chip. The antibody-coated chip was subsequently used to capture the GST-fusion proteins at a flow rate of 5 µl/minute followed by the analysis of H6-At-AP180 construct binding. All interaction experiments were performed with buffer G (see above) at a flow rate of 20 µl/minute. Association for 1 minute was followed by dissociation for 1 minute during which the buffer was perfused. A short pulse injection (15 seconds) of 20 mM NaOH/0.5% SDS was used to regenerate the sensor chip surface after each experimental cycle. H6-AT-AP180
ENTH was used at a final concentration ranging from 125 to 1000 nM. The association constant ka, the dissociation konstant kd and the equilibrium constant kD=kd/ka were calculated using BIAcore kinetic evaluation software, assuming pseudo first order kinetics A+B
AB.
| Results |
|---|
|
|
|---|
C-adaptin
-(At5g22770, NM_122183) and
C-adaptin (At5g22780, NM_122184) homologs, which share a 98.5% identity at the amino acid level. Using RT-PCR, we have isolated the full-length
C-adaptin clone (At-
C-Ad) which codes for a gene product of 1013 amino acids with a predicted relative molecular mass (Mr) of 112.29x103. The mammalian and plant orthologs not only share the same tripartite organization, but also display a 72.6% overall similarity at the amino acid level (Fig. 1A). Compared with the mouse
C ear region (Owen et al., 1999
C-Ad (residues 718S-1013L) shows the same bilobal structure comprising the N-terminal sandwich domain (718S-855K), and the extreme C-terminal platform subdomain (856F-973L) (Fig. 1B,C).
|
Sequence analysis of the At-
C-Ad ear region revealed further that the critical residues within its C-terminal platform domain required for the DPF/W-motif (867F-937R) and for the overlapping FXDXF-motif binding (867F-949R), as well as the residues in the N-terminal sandwich domain required for the specific DPW-motif binding (749G-813Q), are almost totally conserved (Fig. 1C,D) (Brett et al., 2002
). While the DPF/W and DPW binding sites each contain one homologous exchange, the FXDXF-binding site contains three exchanges, of which two are homologous (Fig. 1C,D). In particular, those residues within the DPF/W-motif, which have been shown to be absolutely crucial for network-protein interactions (mouse 837F, 905R, 840W) (Owen et al., 1999
), are totally conserved within the plant
C-adaptin sequence (868F, 937R, 871W).
As the binding sites for the three consensus motifs are located within the two C-terminal subdomains, two GST constructs of At-
C-Ad comprising these regions were created (Fig. 1A). Both constructs lack the trunk portion but comprise the complete hinge region. The one construct containing in addition the full ear region (residues 536K-1013L) is named GST-At-
C-h-ear, whereas the second construct that lacks the extreme C-terminal 255 amino acids and therefore the two subdomains but comprises the residues 536K-759Q is thus named GST-At-
C-h
ear. This latter construct was used to prove that the same subdomains in plant
C-adaptin were also required for network-protein binding (control) and also to reveal putative binding sites that might be located within the hinge domain. The GST-fusion proteins were purified either as a 77 kDa (GST-At-
C-h-ear) or as a 50 kDa (GST-At-
C-h
ear) protein as shown in the Coomassie-stained gel (Fig. 1E). To show the conserved function of the C-terminal ear region of plant
C-adaptin, the two constructs were used in pull-down experiments together with pig brain cytosol, which served as a source of components of the mammalian endocytic clathrin machinery. After incubation, the protein composition of the pellets and corresponding supernatants were analyzed on immunoblots using the respective antibodies. The binding of the mammalian network proteins were observed exclusively in the presence of the full-length ear region from Arabidopsis
C-adaptin but neither when its truncated version lacking both subdomains were used nor when GST alone were used (Fig. 2). Although binding of eps15 to the ear region of plant
C-adaptin is complete, AP180 and amphiphysin bind to a lesser degree and dynamin I gave by far the faintest signal. Surprisingly, mammalian epsin did not bind at all. However, these findings indicate that the C-terminal 265 residues comprising the two subdomains of plant
C-adaptin are also required for network-protein binding, showing that plant
C-adaptin, like its mammalian counterpart, can generally function as a binding partner for cytosolic network proteins.
|
Characterization of an Arabidopsis AP180 homolog
From the three best binding partners of At-
C-ad, we decided to isolate the plant homolog of AP180, as mammalian AP180 also functions as a clathrin assembly protein. These two features, in addition to its lipid binding capacity, qualify it to function as a tether in the early steps of CCV budding. Therefore, AP180 can be regarded as another key protein in the clathrin endocytosis machinery.
A database search in the Arabidopsis genome revealed several candidates of ENTH-domain-containing proteins. Subsequent multiple sequence alignment with mammalian AP180 homologs showed further that the similarities were exclusively restricted to the ENTH-domains located within the N-terminal regions of all proteins compared. Unlike the ENTH-domain of epsin 1, which is also considered to be important for coat formation (Kalthoff et al., 2002
), the ENTH-domain of AP180 is not able to tubulate liposomes in vitro, and is therefore sometimes referred to as an ANTH-domain, containing a lysine-rich signature motif (K/GA(T/I)(X6)(P/L/V) KXK(H/Y) (Kay et al., 1999
; Ford et al., 2001
). Thus, to verify its relationship with animal AP180s and to distinguish it from mammalian epsins we searched for a plant AP180 homolog that completely lacks the ENTH-signature motif of epsins (Ford et al., 2002
) but which instead contains the ANTH-signature motif of AP180 homologs.
The ENTH domain of the Arabidopsis clone At1g05020 (NM_100381) contains the first part of the ANTH-motif (42KAT(X6)P) and probably also its second part, but only at a farther distance (67KKSH). Nevertheless, it reveals the highest similiarities to the ANTH domains of the AP180 homologs CALM (71%), AP180 (63%), LAP (61%) and UNC-11 (58%), but only a lower degree of similarity to mammalian epsins of around 55% (data not shown). Like other non-neuronal AP180 homologs, the plant clone investigated contains only a low number of consensus interaction sites required for the interaction with clathrin (442DLL) and
C-adaptin (473DPW, 608DPF), as well as with other interacting network proteins (547NPF) (Fig. 3A). Therefore, it was considered a true AP180 homolog and was named At-AP180, because the neuronal AP180 protein is the eponymous homolog of this group.
|
The At-AP180 full-length clone was also isolated using the RT-PCR approach as for
C-adaptin. At-AP180 consists of 653 amino acids with a predicted Mr of 72x103 and is thus of the same size as CALM (Kim and Kim, 2000
) (Fig. 3A). We took advantage of the fact that all four consensus binding motifs are located within the C-terminal residues 336S-653S in order to create a construct lacking the hydrophobic ENTH-domain (At-AP180
ENTH) to improve the protein yield for interaction studies. This construct was expressed either as a histidine- or as a GST-fusion protein (H6/GST-At-AP180
ENTH) (Fig. 3A,B). As expected, the expression levels of the truncated H6-At-AP180 construct exceeded the yield of the purified full-length histidine-fusion protein by at least tenfold (Fig. 3B). It was possible to improve the purification of H6-At-AP180
ENTH even further by simply boiling the solution as described for mammalian AP180 (Kalthoff et al., 2002
; Kalthoff, 2003
). The successful application of this purification step already indicated that the motifs are also most probably harbored within a disordered region of At-AP180 that displays little or no conventional secondary structure. Furthermore, the full-length H6-At-AP180, as well as its truncated version H6-At-AP180
ENTH, have higher apparent molecular masses in SDS gels (100 kDa and 55 kDa, respectively) than the primary sequence predicts (72 kDa and 34.5 kDa, respectively).
At-AP180 is a binding-partner of
C-adaptin
To gain an insight into the existence of a clathrin machinery in plants at the molecular level, the interaction of the two key protein homologs, At-AP180 and At-
C-Ad, was investigated. Therefore, H6-At-AP180
ENTH was incubated with the two GST constructs of the plant
C-adaptin ear region (Fig. 4A). Binding was exclusively observed in the presence of the complete ear region but not with the truncated version of At-
C-Ad nor when GST alone was added, showing that the binding site for plant AP180 is located within the extreme C-terminal ear region (760G-1013L) of plant
C-adaptin.
|
As At-AP180 contains two
-ear consensus binding motifs, we investigated whether both motifs (473DPW and 608DPF) contributed equally to the binding. Therefore, we repeated the binding experiment with alanine exchange mutants of either motif (Fig. 4B). While alanine mutation of the DPF-motif reduced binding to the At-
C-Ad ear region significantly, the DPW/AAA mutation seemed not to affect the binding at all, displaying almost the same binding affinity as the wild-type At-AP180
ENTH construct (Fig. 4A,B). Thus, we conclude that the 608DPF-motif of At-AP180 is obviously crucial for binding to the ear region of plant
C-adaptin, whereas the 473DPW-motif is not.
Plasmon-resonance measurements were performed next to explore the degree of binding affinity between plant
C-adaptin and At-AP180. In these experiments, the GST-fusion proteins comprising either the complete ear region or the truncated version of At-
C-Ad were coupled to CM-5 chips via GST antibodies, while the H6-At-AP180
ENTH construct was passed over the sensor surface to monitor the binding. With an equilibrium rate constant of 35 nM, which is lower than the controls GST (680 nM) and GST-
C-h-
-ear (682 nM) by a factor of 19, the binding affinity between At-AP180
ENTH and the At-
C-Ad ear construct is rather high (Fig. 5A). Lowering the amounts of the At-AP180 construct by a factor of four and eight, respectively, reduced binding to the full ear construct, indicating that it is concentration dependent (Fig. 5B). Taken together, the C-terminal region of At-AP180 binds via its 608DPF-motif to the C-terminal ear region of plant
C-adaptin.
|
At-AP180
ENTH functions in clathrin assembly
We next investigated whether At-AP180 also functions as a clathrin assembly protein. To this end, we tested first whether its C-terminal region comprising the single conserved 442DLL-clathrin assembly motif (Morgan et al., 2000
) is able to bind to clathrin. Thus, the fusion-protein GST-At-AP180
ENTH was used in a pull-down experiment with cytosolic clathrin isolated from suspension cultured Arabidopsis cells (Fig. 6). A complete shifting of CHC to the pellet fraction after centrifugation was observed exclusively in the presence of GST-At-AP180
ENTH, but not in the control, attesting a specific interaction. To explore the role of the DLL-motif in regard to clathrin binding we mutated the motif into alanine residues and repeated the binding experiment. Binding of the DLL/AAA mutant occured to almost the same extent as was observed for the wild-type construct, indicating that At-AP180 clearly contains, in addition, clathrin binding motifs other than the consensus DLL-motif so far described. Nevertheless, these findings show unequivocally that the C-terminal region of At-AP180 functions in clathrin binding.
|
An important function of mammalian AP180 and its non-neuronal counterpart CALM is their ability to assemble clathrin triskelia into cages (McMahon, 1999
). As with other mammalian clathrin assembly proteins, AP180 is also thought to promote clathrin assembly by cross-linking triskelia via multivalent interactions between its repeated DLL-motifs and complementary binding sites in the clathrin terminal domain. As the single conserved 442DLL clathrin binding motif of At-AP180 is not essential for clathrin binding we were eager to determine whether At-AP180
ENTH might also function as an assembly protein like its mammalian ortholog. To test this, we isolated coat proteins from pig brain CCV which were subjected to Superose 6 gelfiltration to separate the triskelia completely from endogenous AP180. We made sure that the triskelia were completely devoid of endogenous AP180 by screening the gelfiltration fractions with the respective antibody (Fig. 7A). Those fractions lacking endogenous AP180 were subsequently used in all reassembly experiments. To show their assembly activity, two plant AP180 constructs were used: H6-At-AP180
ENTH, which was added in various stoichiometric amounts, and its DLL/AAA-mutated version (GST-At-AP180
ENTH-DLL/AAA), which still contains clathrin binding activity. Clathrin alone served as a control for spontaneous self-assembly under these conditions. The distribution of clathrin between supernatant, containing soluble triskelia, and pellet, containing assembled cages, were observed in SDS-gels and immunoblots (Fig. 7B). The clathrin triskelia alone displayed only a low tendency of self-aggregation (Fig. 7B), but the addition of H6-At-AP180
ENTH converted the triskelia into a fast sedimenting species. Half-molar amounts of H6-At-AP180
ENTH were already sufficient to induce some assembly, which could be further increased by adding equimolar amounts of H6-At-AP180
ENTH. With a threefold molar excess of the H6-At-AP180
ENTH construct all of the clathrin ended up in the pellet. The same amount of H6-At-AP180
ENTH when incubated alone remained in the supernatant indicating that its presence in the pellet is exclusively due to its specific CHC binding (Fig. 7B). The DLL/AAA mutant of At-AP180
ENTH no longer contained assembly activity, which indicates that the single consensus DLL-motif of At-AP180 plays a crucial role in the assembly process. Furthermore, thorough investigation of the reassembly experiments by electron microscopy revealed that clathrin triskelia, which were assembled as a result of spontaneous self-aggregation of clathrin (Fig. 8A) or in the presence of the DLL/AAA mutant of At-AP180
ENTH (Fig. 8C), were of negligible number compared with the high number of uniform-sized cages that assembled only in the presence of H6-At-AP180
ENTH (Fig. 8B). Moreover, those cages assembled without the aid of the DLL-motif seem to be more irregular in shape and somewhat larger compared with those assembled in the presence of the DLL-motif (close-ups in Fig. 8A,B,C). Analysis of the distribution of the cage size assembled with the help of the DLL-motif revealed further that from a total of 131 counted cages, 122 (93%) were between 70 nm and 90 nm in diameter, thus displaying an almost uniform size distribution (Fig. 8D). From these data we conclude that the single conserved clathrin assembly motif of At-AP180 plays a crucial role during clathrin assembly, although its mutation has no effect on clathrin binding. Therefore, plant AP180 obviously contains clathrin binding motifs that do not correspond to the consensus motifs decribed so far from mammalian clathrin binding proteins.
|
|
| Discussion |
|---|
|
|
|---|
-adaptin, the specific subunit of the AP2 complex, which is exclusively associated with endocytic CCV, and AP180, which displays the strongest clathrin assembly activity but also regulates the size of cages.
At-
C-Ad is a binding partner for cytosolic network proteins
We have isolated the cDNA clone of Arabidopsis
C-adaptin, one of the two genes coding for plant
-adaptins that are almost identical at the amino acid level. This situation corresponds to that of mammals, which also have two
-adaptin genes sharing an overall identity of 84% one coding for the ubiquitiously expressed
C-adaptin and the other one for the brain-specific variant
A-adaptin (Robinson, 1989
; Ball et al., 1995
).
Owen and co-workers (Owen et al., 1999
) previously investigated the binding sites of the mouse
-ear subdomains using the
CL-construct (see Fig. 1C). We prepared an analogous construct of the Arabidopsis
C-adaptin ear region, GST-At-
C-h-ear, and its truncated version, GST-At-
C-h
ear, which lacks both ear subdomains. Using the pull-down approach to study protein-protein interactions, we have shown that GST-At-
C-h-ear was also capable of interacting with the same mammalian network proteins from brain cytosol as described for the mouse
CL-construct (Owen et al., 1999
), but with only one exception: epsin. Interestingly, epsin contains only DPW-motifs for its interaction with
-adaptin, whereas all four mammalian binding partners of At-
C-Ad lack the DPW-motif. They contain instead two DPF- and three FXDXF-motifs in the case of AP180, one of each motif in the case of amphiphysin, 15 DPF-motifs in the case of eps15, and only a single DPF-motif in the case of dynamin I.
In our pull-down experiments the number of DPF-binding motifs per protein reflects its binding intensity, as shown for the mammalian
CL-construct (Owen et al., 1999
). As the DPW-motifs of epsin have been shown to interact with both the DPF/W and the specific DPW-sites in the mouse
CL-construct (Owen et al., 1999
), our result was somehow surprising, because the specific bindig site for the DPW-motif within the At-
C-Ad sequence reveals the same high degree of conservation as does the binding site for the DPF/W-motif. Therefore, it is reasonable to assume that the binding to the plant
C-ear at the DPW-specific site alone is of too low affinity and is thus not detectable under these conditions. However, binding to the DPF/W-site might probably be competed by the DPF-motif interaction of other proteins (e.g. eps15) as we used cytosol as a source for binding partners and not single purified proteins. However, it is clear that At-
C-Ad is functionally conserved and is able to serve as a binding partner for network proteins of the clathrin machinery containing an active DPW/F-binding site.
At-
C-Ad binds to plant AP180
As in mammals, recombinant At-AP180
ENTH (see below) also binds directly to the plant
-ear region as shown in pull-down experiments and plasmon-resonance measurements. A relative high binding affinity with an equilibrium constant of 35 nM between At-
C-Ad and At-AP180
ENTH was detected. Thus, plant AP180 obviously binds with a reasonable high affinity to plant
C-adaptin. In addition, the plasmon-resonance measurements confirmed the data already obtained by the pull-down experiments namely, that the hinge region of plant
C-adaptin lacks extra binding sites as the kD value for the binding to GST-
C-h
ear was the same as for the GST control.
Plant AP180 contains neither a FXDXF-motif nor a WDW-motif, the latter only recently having been described to interact with
-ear and also with the terminal domain of CHC (Scheele et al., 2003
), but instead contains one DPW- and one DPF-motif. Therefore, the next question we addressed was whether the DPF-motif, which is the minimum of
-ear binding-motif resemblance between plant and mammalian AP180 proteins, is crucial for binding. While alanine mutations of the DPW-motif had almost no impact on binding, the mutation of DPF by alanine reduced the binding significantly. Thus, the DPF-motif is clearly required for the interaction with plant
C-adaptin, whereas the DPW-motif is not. This was also shown by the failure of mammalian epsin to bind to the At-
C-Ad ear-region. Taken together, the plant
C-adaptin ear region is not only able to bind to several mammalian network proteins, all of which contain DPF-motifs, but it also binds directly to At-AP180 with a rather high affinity. The failure of the DPF/AAA mutant of the At-AP180
ENTH construct to bind to At-
C-ear underlined the importance of the DPF-motif for this interaction.
Features of At-AP180
Several putative Arabidopsis homologs of AP180 were previously taken into account in ENTH sequence comparison studies of mammalian proteins, but these plant homologs have not been functionally characterized (Ford et al., 2001
). The plant sequences either lacked the consensus motif for
-adaptin (Gupta and Gray, 1999
) or for clathrin binding (Mao et al., 2001
), and therefore obviously do not meet the criteria to fulfill the functions of an AP180 homolog.
We have isolated an Arabidopsis AP180 clone that contains within its ENTH domain part of the ANTH-domain signature motif, which is present in all AP180 homologs. In addition, the plant clone harbors clathrin and
-ear consensus binding motifs, which are functionally active in our protein interaction studies. Furthermore, the C-terminal region of At-AP180 also seems to lack a conventional secondary structure like the mammalian AP180 (Kalthoff et al., 2002
), since the H6-At-AP180
ENTH construct is functionally intact after boiling, a feature that has simplified its purification process (Kalthoff, 2003
). Although the plant AP180 does not contain an acidic stretch in its middle portion, At-AP180 resembles the neuronal AP180 in that its isoelectric point is also very acidic (4.75 vs 5.1) (Morris et al., 1993
). Thereby, the acidic part is restricted to its C-terminal half (residues 337-658 with a pI of 3.9), which is in total agreement with the high solubility of the At-AP180
ENTH construct and its abnormal behaviour in SDS-gels. At-AP180 further resembles its non-neuronal AP180 homologs, in that it contains an 547NPF-motif, which is required for interactions with EH-domain-containing network proteins. An NPF-motif is not present in the neuronal AP180 protein.
Further sequence analysis has revealed that from the four putative casein kinase 2 substrate sites within At-AP180, one is adjacent to the DLL-motif (442DLLSLD), whereas another is close to the DPF-motif (608DPFTTFE) and a third overlaps with the FS-motif (T622FSE), which has recently been described as a clathrin interacting motif of auxilin (Scheele et al., 2003
). Thus, it is possible that At-AP180 interactions are regulated via phosphorylation of these motifs, given that a casein kinase 2-like activity is associated with plant CCV (Drucker et al., 1996
).
At-AP180 is a clathrin assembly protein
An important feature of AP180 (Lindner and Ungewickell, 1992; Ye and Lafer, 1995a
; Ye and Lafer, 1995b
), CALM (Kim and Kim, 2000
; Kim et al., 2000
), LAP (Zhang et al., 1998
) and epsin 1 (Kalthoff et al., 2002
) is the ability to assemble clathrin triskelia into cages. Hence, a homogenous population of clathrin cages is only formed in the presence of mammalian AP180 (Ahle and Ungewickell, 1986
; Morris et al., 1993
; Ye and Lafer, 1995a
). Like their mammalian homologs, LAP and UNC-11 are also able to maintain the size of synaptic vesicles (Zhang et al., 1998
; Nonet et al., 1999
). The clathrin binding motif, which in the case of rat AP180 and its homologs is the DLL-motif, is also found in various other clathrin binding proteins, e.g. HIP1 (Legendre-Guillemin et al., 2002
) and auxilin (Scheele et al., 2003
).
An investigation of the C-terminal 317 residues of the At-AP180 sequence revealed, in addition to the DLL-motif, two further clathrin interacting motifs (622FS, 608DPF), which have only recently been discovered (Scheele et al., 2003
) and were therefore not considered in our investigations. Thus, At-AP180, like LAP and CALM, obviously lacks the high number of DLL motifs that are present in the neuronal AP180 homolog (Morgan et al., 2000
).
As in yeast (Wendland and Emr, 1998
) and mammals (Ye and Lafer, 1995a
), the clathrin assembly activity of the plant AP180 also resides within its C-terminal region (At-AP180
ENTH). So, mutating the single DLL-motif into alanine residues seems to have had no effect on the binding activity of At-AP180
ENTH towards clathrin but abolished its assembly function almost completely.
How do our results fit with the current understanding of clathrin assembly mediated by the five DLL-motifs and the seven variations of this motif in rat AP180? These numerous motifs are thought to cross-link the triskelia in order to assemble them, as progressive deletion caused the loss of clathrin assembly activity (Morgan et al., 2000
). This assumption is supported by the studies on auxilin by Scheele and co-workers (Scheele et al., 2003
), who have claimed that a single DLL-motif is not sufficient for assembly functions. On the basis of our findings it is tempting to speculate that the DLL-motif is highly conserved between species and functions as an assembly regulating motif, whereas other motifs only contribute to clathrin binding. In animal AP180s the clathrin binding motifs are also DLL-motifs, whereas in plant AP180, with the exception of the FS- and DPF-motif, they obviously do not match any of the described clathrin binding consensus motifs such as consensus clathrin box motifs I or II (Lafer, 2002
) or clathrin TD binding-motifs such as WDW or NWQ (Scheele et al., 2003
). It would be difficult to imagine how the plant homolog fulfills its functions if motifs other than the so far described clathrin consensus binding motifs do not facilitate the clathrin binding. In this regard, the FS- and the DPF-motif of At-AP180 are promising candidates. Our systematical screening of the At-AP180 C-terminal residues might eventually reveal additional CHC-binding motifs in the near future.
However, the significance of the DLL-motif was also shown in our electron micrographs, which show cages of regular size only in the presence of the single DLL-motif, whereas in its absence the cages seem to be of a more irregular shape. Because larger quantities of clathrin were required for our experiments, we used the more readily available mammalian CHC for the clathrin assembly studies. CHC are highly conserved proteins and also contain functionally conserved domains, as shown previously by their interaction with the plant CLC (Scheele and Holstein, 2002
). The use of mammalian CHC was also favored by the consideration to show unequivocally the assembly effect of the recombinant plant At-AP180. CHC completely devoid of endogeneous AP180 were therefore a prerequisite. This condition was fulfilled only when mammalian clathrin was used, as a monoclonal antibody specific for mammalian AP180 allowed us to monitor the successful separation. Unlike rat AP180, which functions in a 1:1 stoichiometry, At-AP180
ENTH drove triskelia completely into cages only when present in excess. This might be due to the lack of the ENTH-domain in the plant construct, which in mammalian AP180 and CALM contains an additional clathrin binding site of a type I clathrin box motif (Ye and Lafer, 1995a
; Tebar et al., 1999
). Whether the N-terminus of At-AP180 might also bind to triskelia and probably support assembly, as does the N-terminus of CALM (Kim and Kim, 2000
), has not been tested. However, At-AP180
ENTH was also capable of maintaining a narrow size distribution of cages that matches perfectly with those described for the mammalian AP180 activity (Ahle and Ungewickell, 1986
; Morris et al., 1993
; Ye and Lafer, 1995a
). The ability of plant AP180 to create a cage population within a narrow size range fits perfectly the requirements of plant endocytosis in intact plant cells, as thermodynamic considerations have revealed that the maximum size of endocytic vesicles may not exceed 100 nm (Gradmann and Robinson, 1989
). We cannot claim that plant AP180 is alone responsible for regulating cage size as other plant assembly proteins have so far not been investigated. In our studies, clathrin alone displayed a very low tendency of aggregation, which corresponds to the situation when the DLL/AAA mutation of At-AP180
ENTH was used, suggesting once again an assembly regulating function for the DLL-motif during cage assembly.
Taken together, our data point to the existence of an endocytosis clathrin machinery in plants. Because there are only two highly related
-adaptin genes in Arabidopsis, and the plant
C-adaptin homolog displays the same basic function as its mammalian counterpart, which, in turn, is the specific subunit of the endocytosis-specific AP2 complex, one can proceed from the assumption that the plant
C-adaptin might also be involved in plant CME. The
C-adaptin binding and clathrin assembly activities of the plant AP180 homolog only supports this notion. The specific interactions of both proteins put them without doubt in the context of clathrin-dependent endocytosis in plants.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Ahle, S. and Ungewickel, E. (1986). Purification and properties of a new clathrin assembly-protein. EMBO J. 5, 3143-3149.[Medline]
Ball, C. L., Hunt, S. P. and Robinson, M. S. (1995). Expression and localization of
-adaptin isoforms. J. Cell Sci. 108, 2865-2875.[Abstract]
Blackbourn, H. D. and Jackson, A. P. (1996). Plant clathrin heavy chain. Sequence analysis and restricted localisation in growing pollen tubes. J. Cell Sci. 109, 777-787.[Abstract]
Boehm, M. and Bonifacino, J. S. (2001). Adaptins, the final recount. Mol. Biol. Cell 12, 2907-2920.
Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248-254.[CrossRef][Medline]
Brett, T. J., Traub, L. M. and Fremont, D. H. (2002). Accessory protein recruitment motifs in clathrin-mediated endocytosis. Structure 10, 797-809.[Medline]
Brodski, F. M., Chen, C.-Y., Knuehl, C., Towler, M. C. and Wakeham, D. E. (2001). Biological basket weaving: Formation and function of clathrin-coated vesicles. Annu. Rev. Cell Dev. Biol. 17, 517-568.[CrossRef][Medline]
Cavalli, V. Corti, M. and Gruenberg, J. (2001). Endocytosis and signaling cascades: a close encounter. FEBS Lett. 498, 190-196.[CrossRef][Medline]
Chen, H., Fre, S., Slepnev, V. I., Capua, M. R., Takei, K., Butler, M. H., Di Fiore, P. P. and De Camilli, P. (1998). Epsin is an EH-domain-binding-protein implicated in clathrin-mediated endocytosis. Nature 394, 793-797.[CrossRef][Medline]
Collins, B. M., McCoy, A. J., Kent, H. M., Evans, P. R. and Owen, D. J. (2002). Molecular architecture and functional model of the endocytic AP2 complex. Cell 109, 523-535.[CrossRef][Medline]
Depta, H. and Robinson, D. G. (1986). The isolation and enrichment of coated vesicles from suspension-cultured carrot cells. Protoplasma 130, 162-170.[CrossRef]
Dreyling, M. H., Martinez-Climent, J. A., Zheng, M., Mao, J., Rowley, J. D. and Bohlander, S. K. (1996). The t(10;11)(p13;q14) in the U937 cell line results in the fusion of the AF10 gene and CALM, encoding a new member of the AP-3 clathrin assembly-protein family. Proc. Natl. Acad. Sci. USA 93, 4804-4809.
Drucker, M., Happel, N. and Robinson, D. G. (1996). Localization and properties of kinases in clathrin-coated vesicles from zucchini hypocotyls. Eur. J. Biochem. 240, 570-575.[Medline]
Emons, A. M. C. and Traas, J. A. (1986). Coated pits and coated vesicles on the plasma membrane of plant cells. Eur. J. Cell Biol. 41, 57-64.
Engqvist-Golstein, A. E. Y., Warren, R. A., Kessels, M. M., Keen, J. H., Heuser, J. and Drubin, D. G. (2001). The actin-binding-protein HIP1R associates with clathrin during early stages of endocytosis and promotes clathrin assembly in vitro. J. Cell Biol. 154, 1209-1223.
Ford, M. G. J., Pearse, B. M. F., Higgins, M. K., Vallis, Y., Owen, D. J., Gibson, A., Hopkins, C. R., Evans, P. R. and McMahon, H. T. (2001). Simultaneous binding of PtdIns(4,5)P2 and clathrin by AP180 in the nucleation of clathrin lattices on membranes. Science 291, 1051-1055.
Ford, M. G. J., Millis, I. G., Peter, B. J., Vallis, Y., Praefcke, G. J. K., Evans, P. R. and McMahon, H. T. (2002). Curvature of clathrin-coated pits driven by epsin. Nature 419, 361-366.[CrossRef][Medline]
Gradmann, D. and Robinson, D. G. (1989). Does turgor prevent endocytosis in plants? Plant Cell Env. 12, 151-154.[CrossRef]
Gruenberg, J. (2001). The endocytic pathway: a mosaic of domains. Nat. Rev. Mol. Cell Biol. 2, 721-730.[CrossRef][Medline]
Gupta, R. and Gray, J. C. (1999). Characterization of a single-copy Arabidopsis gene encoding a protein showing limited similarity to the N-terminus of the mammalian clathrin-assembly-protein AP180. DNA Res. 6, 51-55.[Abstract]
Happel, N., Robinson, D. G. and Holstein, S. E. H. (1997). An Arabidopsis thaliana cDNA clone (Accession No. AF009631) is homologous to the micro-adaptin of clathrin-coated vesicle Adaptor complexes. Plant Physiol. PGR, 97-168.
Happel, N., Hoening, S., Neuhaus, J.-M., Paris, N., Robinson, D. G. and Holstein, S. E. H. (2004). Arabidopsis µA-adaptin interacts with the tyrosine-motif of the vacuolar sorting receptor VSR-PS1. Plant J. 37, 678-693.[CrossRef][Medline]
Hawes, C., Crooks, K., Coleman, J. and Satiat-Jeunemaitre, B. (1995). Endocytosis in plants: fact or artefact? Plant Cell and Environ. 18, 1245-1252.
Hepler, P. K., Vidali, L. and Cheung, A. Y. (2001). Polarized cell growth in higher plants. Annu. Rev. Cell Dev. Biol. 17, 159-187.[CrossRef][Medline]
Higgins, M. K. and McMahon, H. T. (2002). Snap-shots of clathrin-mediated endocytosis. Trends Biochem. Sci. 27, 257-263.[CrossRef][Medline]
Holstein, S. E. H., Drucker, M. and Robinson, D. G. (1994). Identification of a ß-type adaptin in plant clathrin-coateded vesicles. J. Cell Sci. 107, 945-953.[Abstract]
Holstein, S. E. H., Ungewickell, H. and Ungewickell, E. (1996). Mechanism of clathrin basket dissociation: separate functions of protein domains of the DnaJ homologue auxilin. J. Cell Biol. 135, 925-937.
Holstein, S. E. H. and Happel, N. (2000). Isolation of clathrin-coated vesicle beta adaptin homologs (Acc. No. AF216385, AF216386, AF216387) from Arabidopsis thaliana. Plant Physiol. PGR, 00-028.
Holstein, S. E. H. (2002). Clathrin and plant endocytosis. Traffic 3, 614-620.[CrossRef][Medline]
Huang, X. and Miller, W. (1991). A time-efficient, linear-space local similarity algorithm. Adv. Appl. Math. 12, 373-381.
Itoh, T., Koshiba, S., Kigawa, T., Kikuchi, A., Yokoyama, S. and Takenawa, T. (2001). Role of ENTH domain in phosphatidylinositol-4,5-bisphosphate binding and endocytosis. Science 291, 1047-1051.
Jonsson, U., Fagerstam, L., Ivarsson, B., Johnsson, B., Karlsson, R., Lundh, K., Lofas, S., Persson, B., Roos, H. and Ronnberg, I. (1991). Real-time biospecific interaction analysis using surface plasmon-resonance and a sensor chip technology. Biotechniques 11, 620-627.[Medline]
Kalthoff, C., Alves, J., Urbanke, C., Knorr, R. and Ungewickell, E. J. (2002). Unusual structure organization of the endocytic proteins AP180 and epsin1. J. Biol. Chem. 277, 8209-8216.
Kalthoff, C. (2003). A novel strategy for the purification of recombinantly expressed unstructured protein domains. J. Chrom. B. 786, 247-254.[CrossRef]
Kay, B. K., Yamabhai, M., Wendland, B. and Emr, S. D. (1999). Identification of a novel domain shared by putative components of the endocytic and cytoskeletal machinery. Protein Sci. 8, 435-438.[Medline]
Keen, J. H. (1987). Clathrin assembly-proteins: affinity purification and a model for coat assembly. J. Cell Biol. 105, 1989-1998.
Kim, H.-L. and Kim, J.-A. (2000). Purification of clathrin assembly-protein from rat liver. Exp. Mol. Med. 32, 222-226.[Medline]
Kim, J.-A., Kim, S.-R., Jung, Y.-K., Woo, S. Y., Seoh, J.-Y., Hong, Y.-S. and Kim, H.-L. (2000). Properties of GST-CALM expressed in E. coli. Exp. Mol. Med. 32, 93-99.[Medline]
Kirchausen, T. (1999). Adaptors for clathrin-mediated Traffic. Annu. Rev. Cell Dev. Biol. 15, 705-732.[CrossRef][Medline]
Kirchhausen, T. (2000a). Clathrin. Annu. Rev. Biochem. 69, 699-727.[CrossRef][Medline]
Kirchhausen, T. (2000b). Three ways to make a vesicle. Nature Rev. 1, 187-198.[CrossRef]
Kohtz, D. S. and Puszkin, S. (1988). A neuronal protein (NP185) associated with clathrin-coated vesicles. J. Biol. Chem. 263, 7418-7425.
Laemmli, U. K. (1970). Cleavage of structural protein during the assembly of the head of the bacteriophage T4. Nature 227, 680-685.[CrossRef][Medline]
Lafer, E. M. (2002). Clathrin-protein interactions. Traffic 3, 513-520.[CrossRef][Medline]
Lam, B. C.-H., Sage, T. L., Bianchi, F. and Blumwald, E. (2001). Role of SH3-domain.-containing proteins in clathrin-mediated vesicle trafficking in Arabidopsis. Plant Cell 13, 2499-2512.
Legendre-Guillemin, V., Metzker, M., Charbonneau, M., Gan, L., Chopra, V., Philie, J., Hayden, M. R. and McPherson, P. S. (2002). HIP1 and HIP12 display differential binding to F-actin, AP2, and clathrin. J. Biol Chem. 277, 19897-19904.
Linder, R. and Ungewickell, E. (1992). Clathrin-associated proteins of bovine brain coated vesicles. J. Biol. Chem. 267, 16567-16573.
Lindner, R. (1994). Purification of clathrin-coated vesicles from bovine brain, liver, and adrenal gland. Cell Biology: A Laboratory Handbook, pp. 525-530. New York: Academic Press.
Low, P. S. and Chandra, S. (1994). Endocytosis in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 45, 609-631.[CrossRef]
Mao, Y., Chen, J., Maynard, J. A., Zhang, B. and Quiocho, F. A. (2001). A novel all helix fold of the AP180 amino-terminal domain for phosphoinositide binding and clathrin assembly in synaptic vesicle endocytosis. Cell 104, 433-440.[CrossRef][Medline]
Marcote, M. J., Gu, F., Gruenberg, J. and Aniento, F. (2000). Membrane transport in the endocytic pathway: animal versus plant cells. Protoplasma 210, 123-132.[CrossRef]
McCarty, D. R. and Chory, J. (2000). Conservation and innovation in plant signalling pathways. Cell 103, 201-209.[CrossRef][Medline]
McMahon, H. T. (1999). Endocytosis: An assembly-protein for clathrin cages. Curr. Biol. 9, R332-R335.[CrossRef][Medline]
Mellman, I. (1996). Endocytosis and molecular sorting. Annu. Rev. Cell Dev. Biol. 12, 575-625.[CrossRef][Medline]
Morgan, J. R., Womack, M., Zhao, X., Prasad, K., Augustine, G. J. and Lafer, E. M. (1998). Clathrin assembly is required for synaptic vesicle recycling. Abstr. Soc. Neurosci. 24, 76.
Morgan, J. R., Prasad, K., Hao, W., Augustine, G. J. and Lafer, E. M. (2000). A conserved clathrin assembly-motif essential for synaptic vesicle endocytosis. J. Neurosci. 20, 8667-8676.
Morris, S. A., Schröder, S., Plessmann, U., Weber K. and Ungewickell, E. (1993). Clathrin assembly-protein AP180: primary structure, domain organization and identification of a clathrin binding-site. EMBO J. 12, 667-675.[Medline]
Nonet, M. L., Holgado, A. M., Brewer, F., Serpe, C. J., Norbeck, B. A., Holleran, J., Wei, L., Hartwieg, E., Jorgensen, E. M. and Alfonso, A. (1999). UNC-11, a Caenorrhabditis elegans AP180 homologue, regulates the size and protein composition of synaptic vesicles. Mol. Biol. Cell 10, 2343-2360.
Owen, D. J., Valli, Y., Noble, M. E. M., Hunter, J. B., Dafforn, T. R., Evans, P. R. and McMahon, H. T. (1999). A structural explanation for the binding of multiple ligands by the
-Adaptin appendage domain. Cell 97, 805-815.[CrossRef][Medline]
Pearse, B. M. F., Smith, C. J. and Owen, D. J. (2000). Clathrin-coat construction in endocytosis. Curr. Opin. Struct. Biol. 10, 220-228.[CrossRef][Medline]
Robinson, M. S. (1989). Cloning of cDNAs encoding two related 100-kD coated vesicle proteins (
-adaptins). J. Cell Biol. 108, 833-842.
Scheele, U., Kalthoff, C. and Ungewickell, E. (2001). Multiple interactions of auxilin 1 with Clathrin and the AP-2 adaptor complex. J. Biol. Chem. 276, 36131-36138.
Scheele, U. and Holstein, S. E. H. (2002). Functional evidence for the identification of an Arabidopsis clathrin light chain polypeptide. FEBS Lett. 514, 355-360.[CrossRef][Medline]
Scheele, U., Alves, J., Frank, R., Düwel, M., Kalthoff, C. and Ungewickell, E. (2003). Molecular and functional characterization of clathrin and AP-2 binding determinants within a disordered domain of auxilin. J. Biol. Chem. 278, 25357-25368.
Slepnev, V. I. and De Camilli, P. (2000). Accessory factors in clathrin-dependent synaptic vesicle endocytosis. Nature Rev. 1, 161-172.[CrossRef]
Tebar, F., Bohlander, S. and Sorkin, A. (1999). Clathrin assembly lymphoid myeolid leukemia (CALM) protein: localization in endocytic-coated pits, interactions with clathrin, and the impact of overexpression on clathrin-mediated traffic. Mol. Biol. Cell 10, 2687-2702.
Towbin, H., Staehelin, T. and Gordon, J. (1979). Electrophoretic transfer from polyacrylamide gels to nitrocellulose sheets: Procedure and some applications. Proc. Natl. Acad. Sci. USA 76, 4350-4354.
Wang, L.-H., Südhof, T. C. and Anderson, R. G. W. (1995). The appendage domain of
-adaptin is a high affintiy binding-site for dynamin. J. Biol. Chem. 270, 10079-10083.
Wendland, B. and Emr, S. D. (1998). Pan1p, Yeast eps15, functions as a multivalent adaptor that coordinates protein-protein interactions essential for endocytosis. J. Cell Biol. 141, 71-84.
Yao, P. J., Coleman, P. D. and Calkins, D. J. (2002). High-resolution localization of clathrin assembly-protein AP180 in the presynaptic terminals of mammalian neurons. J. Comp. Neurol. 447, 152-162.[CrossRef][Medline]
Ye, W. and Lafer, E. M. (1995a). Clathrin binding and assembly activities of expressed domains of the synapse-specific clathrin assembly-protein AP-3. J. Biol. Chem. 270, 10933-10939.
Ye, W. and Lafer, E. M. (1995b). Bacterially expressed F1-20/AP-3 assembles clathrin into cages with a narrow size distribution: Implications for the regulation of quantal size during neurotransmission. J. Neurosci. Res. 41, 15-26.[CrossRef][Medline]
Zhang, B., Koh, Y. H., Beckstead, R. B., Budnik, V., Ganetzky, B. and Bellen, H. J. (1998). Synaptic vesicle size and number are regulated by a clathrin adaptor protein required for endocytosis. Neuron 21, 1465-1475.[CrossRef][Medline]
Zhou, S., Sousa, R., Tannery, N. H. and Lafer, E. M. (1992). Characterization of a novel synapse-specific protein. II. cDNA cloning and sequence analysis of the F1-20 protein. J. Neurosci. 12, 2144-2155.[Abstract]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
D. G. Robinson, L. Jiang, and K. Schumacher The Endosomal System of Plants: Charting New and Familiar Territories Plant Physiology, August 1, 2008; 147(4): 1482 - 1492. [Full Text] [PDF] |
||||
![]() |
C. A. Konopka, S. K. Backues, and S. Y. Bednarek Dynamics of Arabidopsis Dynamin-Related Protein 1C and a Clathrin Light Chain at the Plasma Membrane PLANT CELL, May 1, 2008; 20(5): 1363 - 1380. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Samaj, F. Baluska, B. Voigt, M. Schlicht, D. Volkmann, and D. Menzel Endocytosis, Actin Cytoskeleton, and Signaling Plant Physiology, July 1, 2004; 135(3): 1150 - 1161. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||