|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online May 4, 2004
doi: 10.1242/10.1242/jcs.01085
Research Article |



1 Laboratoire de Biochimie et Biophysique des Systèmes Intégrés (UMR 5092 CNRS-CEA-UJF)
2 Laboratoire d'Immunochimie (U548 INSERM-CEA-UJF), Département Réponse et Dynamique Cellulaires, CEA-Grenoble, 38054 Grenoble CEDEX 9, France
Authors for correspondence (e-mail: umr5092{at}dsvsud.cea.fr; immuno{at}dsvgre.cea.fr)
Accepted 6 January 2004
| Summary |
|---|
|
|
|---|
Key words: Dendritic cell, NADPH oxidase, ROS, Superoxide anion
| Introduction |
|---|
|
|
|---|
During the course of an investigation on the comparative distribution of the NADPH oxidase components in different types of leukocyte cells, we found that murine DCs are equipped with all the components of the oxidase complex. Whereas DCs were found to express p47phox, p67phox, p40phox, p22phox and the deglycosylated form of Nox2, O2 and H2O2 production was barely detectable under conditions known to be effective in the case of neutrophils. Here, we demonstrate the presence in DC membranes of an inhibitory factor that is responsible for the lack of NADPH oxidase activation, and provide evidence for the relief of the oxidase inhibition after a few hours contact with microbial pro-inflammatory ligands, e.g. lipopolysaccharide (LPS) and pansorbin (PSB). Anti-CD40, an antibody that mimics a contact with T cells, and polyinosinic polycytidylic acid (poly I:C), an analogue of double-stranded RNA (dsRNA), could replace the pro-inflammatory ligands although the oxidase response was less acute.
| Materials and Methods |
|---|
|
|
|---|
S) were from Roche (Meylan, France). Hydrogen peroxide 30% (v/v) and the fluorSaveTM reagent were from Calbiochem (La Jolla, CA). Protein A-horseradish peroxidase conjugate was from Biorad (Ivry sur Seine, France). Cy3 donkey anti-rabbit IgGs were from the Jackson Immunoresearch laboratories (West Grove, PA). The enhanced chemiluminescence (ECL) detection kit and polyinosinic polycytidylic acid (poly I:C) were from Amersham Pharmacia Biotech (Orsay, France). Nitrocellulose membranes were from Schleicher & Schuell (Ecquevilly, France).
Antibodies
Polyclonal antisera directed against the C-terminal sequences of both human gp91phox (anti-gp91phox) and p22phox (anti-p22phox) were obtained from G. Brandolin (CEA-Grenoble, France) and used as previously described (Doussière et al., 1993
). Preparation of polyclonal antibodies directed against the full length p40phox protein (anti-p40phox), the C-terminal 18 amino acid residues of p47phox (anti-p47Cter) and the full length p67phox protein (anti-p67phox) were reported previously (Fuchs et al., 1997
). Monoclonal anti-CD40 and anti-MHC II antibodies were from Pharmingen (San Diego, CA).
Culture of dendritic cells from splenic progenitors
DCs derived from BALB/c murine splenic progenitors were grown in an Iscove DMEM medium supplemented with 10% fetal calf serum (FCS), GM-CSF and Flt-3 ligand (Flt-3L) as previously described (Berthier et al., 2000
; Martinon-Ego et al., 2001
). On day 12, the cell population consisted of approximately 60% immature DCs, 30% mature DCs and 10% macrophages as assessed by flow cytometry analysis with anti-MHC II antibodies. Macrophage contaminants were removed by plastic adhesion for 1 hour in fresh culture medium, immediately before harvesting the cells for biochemical investigations. The contaminating macrophages in the final DC preparation were estimated to be less than 1%.
DC isolation from mouse spleen (sDCs)
In some experiments, sDCs were directly isolated from BALB/c mouse spleen. In others, to increase the yield of sDCs, peritoneal injections in BALB/c mice were performed daily for nine consecutive days with 10 µg of recombinant human Flt-3L (human Chinese Hamster Ovary cell derived, kindly provided by Immunex, Seattle, WA). In both cases, sDCs were purified as described (Maldonado-Lopez et al., 2001
; Rizzitelli et al., 2002
). The spleen tissue was treated with collagenase in Ca2+/Mg2+-free medium to dissociate the cells. The low density cells enriched in DCs were separated by centrifugation on a Nycodenz gradient (Nycomed, Oslo, Norway) and withdrawn. They were incubated with biotinylated anti-CD11c antibodies and streptavidin magnetic microbeads (Miltenyi Biotec, Paris, France), and then purified using the MACS isolation kit. The CD11c+ cell population contained 95-97% sDCs; most of them (>95%) were in an immature state.
Preparation of cytosolic and membrane fractions
DCs were washed with PBS pH 7.4 that consisted of 137 mM NaCl, 2.7 mM KCl, 8.1 mM Na2HPO4, 1.5 mM KH2PO4, supplemented with 10 µg/ml leupeptin and 1 mM diisopropylfluorophosphate. The cell suspension at a concentration of 108 cells/ml was placed on ice, and the cells were disrupted by sonication four times for 30 seconds at 10 W output. After a 5 minute centrifugation at 10,000 g, the supernatant fraction was withdrawn and centrifuged at 300,000 g for 30 minutes at 4°C in a TL-100 centrifuge. The supernatant was referred to as cytosol, and the membranes were resuspended in an equal volume of PBS. A purified membrane fraction of DCs was prepared as follows. After sonication, the cell particles were subfractionated by a 30 minute centrifugation at 150,000 g on a sucrose gradient consisting of two sucrose layers of 15% and 40% (w/v) in 50 mM Tris-HCl pH 7.4 supplemented with 1 mM EDTA. The cytosolic fraction corresponded to the supernatant fluid. The membrane fraction was collected at the 15-40% sucrose interface, diluted 2.5 times with PBS and pelleted by centrifugation for 30 minutes at 300,000 g in a TL-100 rotor. Membrane and cytosolic fractions from neutrophils were prepared as described (Doussière et al., 1996
). Protein concentration was assayed with the bicinchoninic acid reagent (Pierce, Bezons, France) in the presence of 0.1% sodium dodecyl sulfate (SDS), using bovine serum albumin as standard.
KCl extract and ß-OG extract of DC membranes
The KCl extract of DC membranes was prepared as follows. DC membranes (2 mg protein) in 1.5 ml of 0.5 M KCl were subjected to ultrasonic irradiation at 10 W output at 4°C for 1 minute, with one second interruption every second. Membranes were sedimented by centrifugation at 300,000 g for 20 minutes in a TL-100 rotor. The supernatant referred to as KCl extract was dialyzed overnight against 10 mM phosphate buffer (pH 7.2) and 1.5 mM NaCl (phosphate/NaCl medium), and then concentrated by freeze-drying to a volume of 110 µl. The ß-OG extract of DC membranes was prepared as follows. DC membranes (2 mg protein) were incubated with ß-OG (1% final concentration) in a volume of 240 µl for 15 minutes at 0°C. The mixture was supplemented with 0.5 M KCl (final volume 3.4 ml) to lower the concentration of ß-OG to about 0.07%, and centrifuged at 300,000 g for 20 minutes in the TL-100 rotor. The supernatant referred to as ß-OG extract was dialyzed overnight against the phosphate/NaCl medium, and then concentrated to a volume of 110 µl.
Immunoprecipitation assays and immunoblotting
The p67phox, p47phox and p40phox proteins were immunoprecipitated using 30 µl of anti-p67phox antiserum, as described (Fuchs et al., 1997
; Grandvaux et al., 2001
). To reveal the
and ß subunits of DC flavocytochrome b558, two antibodies directed to the C terminal regions of the two corresponding subunits of the human protein were used (Doussière et al., 1993
). The immunocomplexes, as well as 100 µg of cytosolic or membrane proteins (see above), were solubilized in Laemmli's depolymerisation buffer, loaded on a 12% polyacrylamide gel, subjected to SDS-PAGE and then electrotransferred to a nitrocellulose membrane. For protein immunodetection, the membrane was blocked for 1 hour at room temperature in PBS supplemented with 0.1% Tween 20 (T-PBS) and 5% nonfat dried milk. After three washes with T-PBS, the nitrocellulose was probed for 1 hour with the antibodies at the following dilutions: anti-Nox2 1/500, anti-p22phox 1/500, anti-p67phox 1/750, anti-p47phox 1/2,500, anti-p40phox 1/1,000. The primary antibodies were then detected with the protein A-horseradish conjugate, using ECL.
RNA isolation and RT-PCR
Total cellular RNA was extracted from DCs (5x106 cells) using the RNeasy Protect Mini kit (Qiagen, Courtaboeuf, France) according to the manufacturer's instruction, and reversely transcribed using the Superscript cDNA synthesis kit from Gibco BRL (Pontoise, France). The cDNA was amplified by PCR on a LightCycler System (Roche) (Gallagher et al., 2001
), using two oligonucleotide primers derived from the murine Nox2 cDNA sequence, namely 5'-1ATGGGGAACTGGGCTGTGAATGAA24-3' and 5'-271TGAGGTTCCTGTCCAGTTGTCTTCG295-3'. PCR products were separated by electrophoresis on a 1.6% agarose gel, stained with ethidium bromide and visualized by UV illumination. Product specificity was determined by sequencing the amplified fragments excised from the gel.
Assay of O2 production by DCs
In some experiments, generation of O2 by PMA-stimulated DCs was assayed by measurement of the rate of reduction of cytochrome c inhibitable by SOD. DCs (5x106 cells) were suspended in 1 ml of PBS/20 mM glucose/1 mM MgCl2/200 µM cytochrome c, in a photometric cuvette at 37°C, and cytochrome c reduction was measured at 550 nm. PMA was added at the final concentration of 1 µg/ml. To assess the specific oxidase activity, 40 µg/ml SOD was added to quench O2 and the residual reduction of cytochrome c was recorded. The rate of SOD-sensitive production of O2 was calculated from the difference between the two slopes. In most of the cases, more than 95% of the reduction of cytochrome c was inhibited by SOD, indicating that reduction of cytochrome c was essentially due to O2.
In other experiments, DCs were preincubated with the pro-inflammatory ligands LPS (1 µg/ml) or PSB (20 µg/ml) at 37°C overnight in Petri dishes; anti-CD40 (1 µg/ml) and poly I:C (50 µg/ml) were also used. Each Petri dish contained 106 cells suspended in 10 ml of Iscove DMEM medium supplemented with 10% FCS, GM-CSF and Flt-3L (Berthier et al., 2000
; Martinon-Ego et al., 2001
). After preincubation, the cells from each dish were pelleted by low speed centrifugation and washed twice with PBS supplemented with 40 mM glucose (PBS-glucose). They were finally resuspended in 200 µl of PBS-glucose and transferred to the wells of a microtiter plate for assay of O2 production upon activation with PMA (final concentration of 1 µg/ml). Production of O2 was assayed by reduction of NBT (100 µM). Incubation was carried out at 37°C and lasted for 3 hours. Reduction of NBT to the red purple formazan was monitored at 550 nm using ELISA plate reader. For microscopic examination, cytospins were prepared from 40 µl aliquots of the cell suspensions supplemented with 60 µl PBS.
Assay of O2 production by DC membranes in the cell-free system
The assay consisted of an activation step followed by measurement of the elicited oxidase activity. It was performed in a 96-well microtiter plate. Each well was filled with 50 µl of PBS containing the indicated amounts of cytosolic and membrane proteins, 0.5 mM ATP, 10 µM GTP
S and 2.5 mM MgSO4. Arachidonic acid in ethanol was distributed in the wells in amounts ranging from 5 to 40 nmol/well. When indicated, KCN was added at the final concentration of 1 mM. The plate was shaken using a Labsystems integrated EIA Management System (iEMS) for 10 minutes at 25°C. Then, cytochrome c and NADPH in 175 µl PBS were added (final concentrations 150 µM and 300 µM, respectively). Cytochrome c reduction was recorded at 550 nm for 3 minutes. Parallel cell-free assays were carried out with membrane and cytosol from bovine neutrophils.
In some experiments, NADPH oxidase activation was carried out in the presence of ß-OG. After a 5 minute incubation of ß-OG with the membrane fraction from either neutrophils or DCs at room temperature, as described in the text, neutrophil cytosol, ATP, GTP
S, KCN and MgSO4 in PBS were added (see above), resulting in a final ß-OG concentration lower than the critical micellar concentration (CMC). Aliquots of this suspension were withdrawn and distributed in the wells of the plate, followed by addition of arachidonic acid at increasing concentrations. Incubation lasted for 10 minutes, followed by addition of cytochrome c and NADPH in PBS.
Assay of H2O2 production
Production of hydrogen peroxide by DCs was measured using HVA and HRP in a 2 ml assay adapted from a previously described method (Baggiolini et al., 1986
).
Confocal microscopy
Murine DCs were diluted to 2x106/ml and incubated for 10 minutes at room temperature and 20 minutes at 37°C on poly-L-lysine-coated lamellas. After three washes with PBS, cells were fixed with 3% paraformaldehyde for 10 minutes and permeabilised with 0.05% saponin in PBS supplemented with 0.2% BSA. They were first incubated with appropriate polyclonal antibodies, as indicated in the text, and stained with Cy3 donkey anti-rabbit IgGs. The coverslips were then mounted in FluorSaveTM reagent. Analysis was performed using a confocal laser microscope (TCS-SP2, Leica, Heidelberg, Germany), equipped with an helium/neon laser. Excitation was at 543 nm and emission at 570 nm.
Spectrophotometric experiments
Difference optical spectra (dithionite reduced minus oxidized) of whole DCs and DC membranes were recorded with a double-beam Perkin-Elmer 557 spectrophotometer. For measurement of heme b oxidation-reduction potentials, spectra were recorded with a Hewlett-Packard 8452A diode array spectrophotometer. DC membranes recovered from the sucrose gradient were suspended in 50 mM Hepes pH 7.0 at the concentration of 2.1 mg protein/ml. The suspension was clarified by addition of 0.2% Triton X-100, and placed in a 1-cm-wide cuvette that was sealed with a gas-tight rubber stopper in which three needles were inserted. One of the needles was used for flushing argon, the other for gas evacuation and the third to inject microliter volumes of appropriate solutions. The argon pressure in the cuvette was maintained at a slightly higher value than the atmospheric pressure to ensure anaerobiosis. The stopper was equipped with an axle-bearing for the passage of a plastic stick. The helicoidal-shaped extremity of the stick plunged in the cuvette medium. The rotation of the stick driven by a motor was used to make the membrane suspension homogeneous. Since the purpose of the potentiometric titration was to detect and quantitate the presence of a low potential heme b similar to that present in neutrophil flavocytochrome b, phenosafranin, a dye with a mid-point potential of 252 mV at pH 7.0, was chosen as potential indicator (Light et al., 1981
). Moreover, oxidized phenosafranin has a maximal absorbance at 525 nm, far from the Soret peak of heme b. After a 4 minute equilibration with argon, phenosafranin was added to the membrane suspension (final concentration 2 µM), and the potentiometric titration started with the sequential additions of 1 µl aliquots of a freshly prepared solution of 5 mM sodium dithionite in 50 mM HEPES pH 7.0. After each addition, the optical spectrum was recorded. Reduction of heme b was assessed by the increase of the Soret peak at 426 nm. The increase of the peak at 444 nm was used to monitor the reduction of hemes aa3 (due presumably to contaminating mitochondrial membranes). Reduction of phenosafranin corresponded to a decrease of the peak at 525 nm. When reduction of heme b reached a maximal value, the back reaction was started by a controlled delivery of air into the cuvette medium. The heme b potential was calculated by plotting the log of the ratio of oxidized heme b to reduced heme b at various potential values derived from the phenosafranin spectrum.
| Results |
|---|
|
|
|---|
|
The time course of NBT reduction in DCs subjected to the above-mentioned conditions was determined spectrophotometrically at 550 nm (Fig. 1I). The slow and steady increase of absorbance observed with control DCs (absence of LPS and PMA) and also with DCs pretreated with LPS, not followed by addition of PMA, did not correlate with accumulation of reduced NBT in the cells as detected under the microscope. This absorbance increase was therefore not related to an oxidase activity. A different situation occurred with DCs challenged with PMA or with DCs first treated with LPS and then challenged with PMA. In contrast with control DCs, the kinetics were biphasic, characterized by a rapid increase in absorbance during the first half an hour followed by a slow decrease to reach a plateau after 2-3 hours. The rise in absorbance by DCs treated with PMA or LPS plus PMA was clearly related to the accumulation of reduced NBT in DCs found under the microscope (Fig. 1A,B). After deduction of the value of absorbance in control DCs, the overnight contact of DCs with LPS was found to enhance at least four times the oxidase activity of DCs challenged with PMA alone. Thus, LPS acts as a primer in the oxidative response of DCs to PMA. Similar kinetics were obtained when LPS was replaced by PSB in the preincubation medium (not shown). To achieve an effective priming effect, the contact of DCs with the pro-inflammatory ligands should last for at least 10-12 hours. The length of the preincubation period required to obtain noticeable priming suggested that protein synthesis is necessary in the oxidative response to PMA. An alternative explanation is the slow relief of an inhibited state of the NADPH oxidase under the control of a signaling system triggered by LPS.
To test the specificity of the priming effect, the pro-inflammatory ligands LPS and PSB were replaced by the anti-CD40 antibody and the oligonucleotide poly I:C. CD40 triggering of DCs by anti-CD40 mimics the interaction of DCs with T cells (Caux et al., 1994
). Poly I:C, a dsRNA analogue, mimics the recognition of viral pathogens by DCs and induces the synthesis of pro-inflammatory cytokines (Cella et al., 1999
; Verdijk et al., 1999
). Although significant, the PMA-dependent reduction of NBT was less acute than with LPS or PSB (Fig. 2).
|
It is noteworthy that reduced NBT is essentially detected within DCs, not outside the cells. The near absence of secretion of O2 outside DCs was confirmed by using the O2-dependent reduction of cytochrome c. Upon addition of PMA (1 µg/ml), the rate of O2 production by DCs at 37°C was very low (
0.1 to 0.6 nmol/minute/106 cells, 9 assays). Interestingly, whereas the production of O2 in PMA-activated DCs was equal to or less than 0.1 nmol O2/minute/106 cells, that of LPS-pretreated DCs was at least five times higher, which is consistent with the large accumulation of reduced NBT within LPS-pretreated DCs (Fig. 1A). The production of H2O2, a direct derivative of O2, on a period of 20 minutes in the presence of 1 mM aminotriazole, an inhibitor of catalase, was in the same range as that of O2. Comparison of these values with those reported in the literature for neutrophils and B cells showed that the apparent capacity of activated DCs to secrete O2 and H2O2 is <3% of that of human neutrophils (Yagisawa et al., 1996
) and of the same order as those found in activated B cells (Cohen-Tanugi et al., 1991
).
Characterization and subcellular localization of the components of the O2-generating NADPH oxidase in DCs
The presence of phox proteins in DCs was analyzed by immunoblotting of cytosolic and membrane fractions. As illustrated in Fig. 3A,B, murine DCs contain the typical components of the NADPH oxidase complex detected by antibodies directed to human Nox2, p22phox, p67phox, p47phox and p40phox. The apparent molecular masses of the DC phox proteins probed with the antibodies were similar to those of reference bovine neutrophils, with the exception of the protein detected with anti-Nox2 antibodies. This protein migrated in SDS-PAGE with an apparent molecular mass of 60 kDa instead of 90-100 kDa, typical of human and bovine neutrophils; it is referred to here as p60. p60 was also found in membranes of DCs directly purified from mouse spleen (sDCs in Fig. 3A). A membrane protein of the same size (58 kDa) was recently identified as the large subunit of the membrane-bound flavocytochrome b558 in murine neutrophils, the low molecular mass of murine Nox2 being explained by a defect of glycosylation (Björgvinsdóttir et al., 1996
). Confirmation of the identity of the Nox2 component expressed by murine DCs was carried out by reverse transcription of RNA from DCs followed by PCR amplification. Primers derived from the murine Nox2 cDNA sequence were used. Following electrophoresis, a predominant cDNA band was detected in the gel; the band was excised and sequenced. Sequencing demonstrated its identity with the 1-295 base fragment of Nox2 found in murine macrophages (Björgvinsdóttir et al., 1996
). The cDNA cloning data were consistent with the immunological data showing that DC p60 is immunoreactive to human Nox2 antibodies. Comparative western blots carried out with LPS-primed DCs and unprimed DCs did not reveal any significant difference in the amounts of p60 and the cytosolic factors of oxidase activation (data not shown); an increased synthesis of these proteins in LPS-primed DCs is therefore unlikely.
|
In neutrophils p67phox, p47phox and p40phox are associated to form a complex in the cytosol (Someya et al., 1993
). A similar complex was recovered from DC cytosol by immunoprecipitation, using p67phox antibodies (data not shown). Curiously, a significant amount of the cytosolic phox proteins, more particularly p67phox and p40phox, was associated with crude DC membranes. This association disappeared when DC membranes were purified by centrifugation on sucrose gradient (Fig. 3C), suggesting a loose binding of cytosolic phox proteins to the membrane. Another strategic component of the NADPH oxidase, namely Rac, has been detected in DCs, the two effective isoforms Rac1 and Rac2 being present at comparable levels (Garrett et al., 2000
).
The subcellular localization of the NADPH oxidase components in DCs was assessed by confocal microscopy. A predominantly peripheral fluorescence was seen with antibodies directed to Nox2 and p22phox (Fig. 4). Immunodetection of p67phox close to the cell membrane was in agreement with the results of the western blotting experiment reported above. Clusters of p47phox were observed predominantly in the cytosol.
|
Evidence for a low potential heme b in DC membranes
The difference optical spectrum of DC membranes illustrated in Fig. 5A, trace 8 (sodium dithionite reduced minus oxidized) exhibited peaks at 605 nm, 558 nm, 530 nm, 444 nm and 426 nm. By comparison with the difference spectrum of heart mitochondria (not shown), the peaks at 605 nm and 444 nm were ascribed to heme aa3, a specific mitochondrial redox carrier, which indicated the presence of submitochondrial particles in the DC membrane fraction. Other peaks at 558 nm, 530 nm and 426 nm (Soret band) denoted the presence of heme b. The sizes of the reduced peaks at 426 nm (heme b) and at 444 nm (heme a3) led us to conclude that the molar ratio of heme b to heme a3 was significantly higher in DC membranes than in heart mitochondria, and to infer that DC membranes were likely to harbour, in addition to mitochondrial heme b, another heme b species. This heme b could be the prosthetic group of the 60 kDa protein, p60, detected in DC membranes with anti-Nox2 antibodies. It remained to be found whether it was a low potential heme b similar to that present in the neutrophil Nox2 (Cross et al., 1981
; Cross et al., 1984
).
|
To measure the redox potential of heme b in DC membranes, we used as redox indicator phenosafranin, which has a redox potential (Em,7) of 252 mV, close to that of the neutrophil heme b (Em,7 = 245 mV) (Cross et al., 1981
). After each addition of sodium dithionite to the anaerobic suspension of DC membranes, the spectrum was recorded between 370 nm and 650 nm (Fig. 5A). Reduction of heme b and heme aa3 was determined by measuring the increase in absorbance at 426 nm and 444 nm, respectively. Reduction of phenosafranin was followed by the decrease in absorbance at 525 nm. At low concentrations of sodium dithionite, a first wave of simultaneous reduction of heme b (426 nm) and heme aa3 (444 nm) was recorded, unaccompanied by any modification of the phenosafranin spectrum (Fig. 5B). Above a threshold concentration of sodium dithionite, the heme b reduction increased abruptly in parallel with the reduction of phenosafranin. The second wave of heme b reduction reflected the titration of a heme b species with a redox potential in the same range as that of phenosafranin, whereas the first wave of heme b reduction probably corresponded to the titration of mitochondrial heme b, whose redox potential (0 to 50 mV) is significantly more positive than that of phenosafranin. The slight absorbance increase at 444 nm observed at low redox potential was probably due to the contribution of the tail of the large peak at 426 nm. Introduction of trace amounts of O2 into the suspension of reduced DC membranes led to the spontaneous reoxidation of heme b, as assessed by the decrease of the reduced peak at 426 nm, which allowed us to proceed to the back redox titration of heme b. The back titration curve coincided with the direct titration curve, indicating that the system was at equilibrium (Fig. 5C). The mid-point redox potential Em,7 of heme b corresponding to the second wave of titration was calculated from the ratio of the reduced to oxidized phenosafranin in the Nernst curve. It was approximated to a value of 200 mV, close to that found for the heme b component of the Nox2 subunit of flavocytochrome b558 in neutrophil cells. From the titration data, using a redox absorption coefficient of 106 mM1 cm1 at 426 nm, it could be calculated that DC membranes contain 90-100 pmol of low potential heme b per mg of protein, a value only half of that found in neutrophil membranes (Morel et al., 1985
).
Assessment of the respective efficiencies of the cytosolic and membrane-bound components of the DC oxidase complex
The previous experiments led us to conclude that whereas DCs are fully equipped in components of the O2-generating NADPH oxidase, they are barely able to mount a substantial respiratory burst when activated with PMA alone. This paradoxical situation, different from that usually observed in neutrophils, could be explained by an unusual activation mechanism or by the association of an inhibitory factor with one of the components, either membranous or cytosolic, of the oxidase complex. To clarify this point, oxidase activity was assayed in an heterologous cell-free system (Cohen-Tanugi et al., 1991
). This system consisted of membrane and cytosolic fractions derived from murine DCs and bovine neutrophils (Table 1). In the cell-free system, only the terminal step of the activation mechanism, namely the binding of the cytosolic factors to the membrane-bound flavocytochrome b, is implicated in the elicitation of the oxidase response. As a control, DC membranes preincubated with arachidonic acid were mixed with DC cytosol, GTP
S and ATP, and the elicited oxidase activity was assayed after addition of NADPH and cytochrome c. At the optimal concentration of arachidonic acid, the mean rate of O2 production was 24 nmol O2/minute/mg membrane protein, which is 3% of that determined in parallel in a cell-free system consisting of membranes and cytosol from bovine neutrophils, namely 803 nmol O2/minute/mg membrane protein. Addition of KCN to avoid any reoxidation of the reduced cytochrome c by contaminant mitochondrial membranes had no effect on the rate of O2 production. The difference in the apparent oxidase activities of DC and neutrophil membranes assayed in a cell-free system confirmed that obtained with PMA activated cells, and it indicates that the defect in the elicitation of oxidase activity in PMA-stimulated DCs is directly related to the final step of the oxidase activation. Through the use of the heterologous cell-free system consisting of murine DC cytosol and bovine neutrophil membranes, the mean rate of O2 production, 217 nmol O2/minute/mg membrane protein, was nine times higher than that measured with the homologous DC cell-free system. In contrast, the reverse heterologous system obtained by mixing murine DC membranes and bovine neutrophil cytosol was barely more efficient than the homologous DC cell-free system. From these results, we concluded that the limiting factor in O2 production by DCs resides in components of the NADPH oxidase located in the membrane fraction.
|
As shown in the preceding section, DCs are equipped with a Nox2 protein that is identical to that located in murine macrophages and differs from the human Nox2 by the near absence of glycosylation (Björgvinsdóttir et al., 1996
). Nevertheless, murine macrophages, in contrast with murine DCs, are fully competent to generate a respiratory burst upon addition of PMA (Pollock et al., 1995
). A substantial amount of Nox2 associated with a low potential heme b was present in DC membranes corresponding, on the basis of the heme content, to about half of that reported for neutrophils. We should therefore expect a noticeable production of O2 by activated DC membranes. This was not the case, which led us to hypothesize that a membrane-bound inhibitory factor might interfere with the activation of the membrane-bound Nox2 by cytosolic factors in DCs.
Evidence for the presence of an oxidase activation inhibitor of protein nature in DC membranes
If an inhibitory factor of NADPH oxidase activation were present in DC membranes, then mixing DC membranes with neutrophil membranes in a cell-free system should not result in an additive effect of elicited oxidase activities of the two types of membranes but, on the contrary, in an antagonistic effect. In the experiment illustrated in Fig. 6A, oxidase activation of both murine DC membranes and bovine neutrophil membranes was performed with bovine neutrophil cytosol in the presence of arachidonic acid. Control assays showed that at the optimal concentration of arachidonic acid, DC membranes exhibited a modest oxidase activity. The amount of O2 generated per minute and per well of the microplate amounted to 0.38 nmol (equivalent to 37 nmol O2/minute/mg membrane protein). This value was much lower than that found with neutrophil membranes under similar conditions, namely 4.0 nmol O2/minute (equivalent to 660 nmol O2/minute/mg membrane protein). Upon mixing DC membranes and neutrophil membranes, an intermediate value of O2 production, 2.3 nmol O2/minute, was obtained. This finding corroborated the hypothesis that an inhibitory factor resides in DC membranes. In the presence of high concentrations of arachidonic acid in the activation step, the inhibitory factor might diffuse from DC membranes to neutrophil membranes. The assay was repeated by varying the ratio of DC membranes to neutrophil membranes. The dose-effect curve illustrated in Fig. 6B shows that increasing the relative amount of DC membranes resulted in a decrease of the elicited oxidase activity of neutrophil membranes. If the DC inhibitory factor were a protein, its negative effect on the elicitable neutrophil oxidase activity assayed in the cell free system should be relieved either by heating the DC membranes or by subjecting them to a protease treatment. As shown in Fig. 6B, heating DC membranes or incubation of these membranes with proteinase K almost completely abolished their inhibitory effect on the neutrophil oxidase activity.
|
Based on the hypothesis that a membrane-bound inhibitor interfered with the production of O2 in DCs, it was reasoned that treatment of DC membranes by a detergent should dislodge the inhibitor, the resulting effect being an increased oxidase activity in a cell-free system. DC membranes were lysed by 1% ß-octylglucoside (ß-OG); addition of cytosol, ATP, GTP
S and arachidonic acid lowered the final concentration of ß-OG to 0.075%, well below its CMC (0.73%) (Hjelmeland and Chrambach, 1984
). This condition is expected to reconstitute the oxidase in the phospholipid micelles, without noticeable inhibitory effect of the detergent (Shpungin et al., 1989
). A control experiment carried out with neutrophil membranes indicated that the lysed neutrophil membranes supplemented with neutrophil cytosol and the other components of the cell-free system were still able to mount a substantial respiratory burst; their elicited oxidase activity at the optimal concentration of arachidonic acid was decreased by only 30% compared with the control (51.2 versus 74.2 mol O2/mol heme b/second) (Fig. 7A). There was no further decrease in the elicited oxidase activity upon doubling the concentration of ß-OG. Addition of FAD, a cofactor of Nox2, did not restore the lost oxidase activity (not shown). With DC membranes treated with ß-OG, the opposite effect was observed, consisting in a near tripling of the elicited oxidase activity (8.5 versus 3.0 mol O2/mol heme b/second) (Fig. 7B). Taking into account the decrease in neutrophil oxidase activity due to the presence of residual ß-OG, the tripling of oxidase activity in DC membranes incubated with ß-OG was clearly an underestimate of the actual NADPH oxidase capacity. Taken together, the above results confirm the location of an inhibitory factor of protein nature that prevents the elicitation of oxidase activity in DC membranes, and its release upon addition of ß-OG.
|
To distinguish between the extrinsic or intrinsic nature of the inhibitory protein, the DC membranes were subjected to two different treatments. One membrane fraction was incubated with 0.5 M KCl and sonicated to remove extrinsic proteins. The other membrane fraction was incubated with 1% ß-OG and then diluted 13 fold with PBS supplemented with 0.5 M KCl, to decrease the ß-OG concentration below the CMC. The supernatant fractions obtained after high speed centrifugation were dialyzed overnight and added to neutrophil membranes. Oxidase activation was triggered by addition of bovine neutrophil cytosol, GTP
S, ATP and arachidonic acid. As illustrated in Fig. 8 (inset), the KCl extract displayed a limited inhibitory effect on the elicited oxidase activity, compared with the substantial inhibition observed with the ß-OG extract. The inhibition was dose-dependent (Fig. 8, inset), which corroborates the conclusion that the inhibitor is a membrane-bound protein, removable by ß-OG. A ß-OG extract of neutrophil membranes added to the neutrophil cell-free system resulted in only a slight inhibition of the oxidase activation, indicating that the inhibitory protein present in DC membranes is not present in neutrophil membranes in detectable amounts (Fig. 8, inset).
|
In the preceding experiment, the ß-OG extract of DC membranes was added to neutrophil membranes prior to the addition of the activating cytosolic factors. When the sequence of addition was reversed, so that the ß-OG extract of DC membranes was added to the cell-free system of oxidase activation after arachidonic acid and the cytosolic factors, i.e. after the activation step, the inhibitory effect on the rate of O2 production was much less marked (less than 10%) (not shown). In this case, the effect of the ß-OG extract was directed towards the activated NADPH oxidase. This finding led us to eliminate a scavenging effect of the ß-OG extract of DC membranes on the superoxide O2 and to conclude that the DC membrane extract inhibits the activation of NADPH oxidase rather than the elicited oxidase activity.
| Discussion |
|---|
|
|
|---|
Confocal analysis of immunocytochemically stained DCs led to the puzzling observation that, in resting cells, a large fraction of p67phox, one of the cytosolic factors of oxidase activation, is predominantly localized to the plasma membrane. It is well recognized that, during the course of oxidase activation in neutrophils, a critical event is the migration of p67phox to the plasma membrane to interact with the membrane-bound flavocytochrome b (reviewed by Vignais, 2002
). Resting DCs can engulf surrounding antigens by a spontaneous, albeit active, pinocytosis (Steinman and Swanson, 1995
). This process might occur concomitantly with the migration of p67phox to the membrane. Under these conditions, to prevent any elicitation of the oxidase activity that would result in an inadvertent and detrimental production of O2, DCs might have developed a mechanism of negative regulation of oxidase activation. Confocal analysis of DCs (Fig. 4) showed the different subcellular localizations of p67phox and p47phox. In contrast to p67phox, p47phox is predominantly present in the cytoplasm. An early report concluded that in activated neutrophils, participation of p47phox precedes that of p67phox in the formation of the active NADPH oxidase by association with Nox2 (Kleinberg et al., 1990
). Consistent with this report was the finding that p67phox translocation to the membrane-bound Nox2 does not occur in p47phox-deficient neutrophils (Heyworth et al., 1991
). Prevention of migration of p47phox to the cell membrane in DCs, possibly due to the presence of a membrane-bound inhibitor associated with Nox2 or p22phox, might explain the apparent incapability of these cells to mount a respiratory burst.
Myeloid DCs are known to express several members of the Toll-like receptor (TLR) family (reviewed by Akira et al., 2001
; Medzhitov, 2001
; Janeway and Medzhitov, 2002
; Akira and Hemmi, 2003
; Imler and Hoffmann, 2003
; Kopp and Medzhitov, 2003
). TLRs play a critical role in innate immunity as they can recognize and interact with pathogen-associated molecular patterns (PAMPs), and elicit intracellular signals leading to the induction of host defence genes. Importantly, recognition of PAMPs allows the immune system to distinguish infectious non-self from non-infectious self (Janeway and Medzhitov, 2002
). In this context, LPS and poly I:C have been found to be ligands for TLR4 and TLR3, respectively (Hoshino et al., 1999
; Matsumoto et al., 2002
). Recent studies have suggested a role of TLR in the activation of the NADPH oxidase. For instance, the non-phagocytic NADPH oxidase of gastric pit cells appears to be activated by LPS through a TLR4 mediated signalling pathway (Kawahara et al., 2001
). The TLR4 signalling pathway was also reported to mediate upregulation of NADPH oxidase components in gastric mucosal cells (Teshima et al., 1999
). Our data indicate that two signalling pathways cooperate to activate the NADPH oxidase in DCs. The first one, a PKC-dependent pathway, has been extensively reported to be involved in the activation of neutrophil and macrophage NADPH oxidase, routinely monitored in the presence of PMA (reviewed by Dinauer, 1993
; De Leo and Quinn, 1996
; Vignais, 2002
). The other pathway that appears to contribute to the oxidase activation in DCs is the TLR-mediated signalling pathway. This pathway might be responsible for the delayed priming of DCs in response to pro-inflammatory stimuli.
The functional significance of the cryptic DC oxidase, activated upon interaction with pro-inflammatory agonists and T cells, remains to be defined. As activated DCs exhibit a high propensity to interact with T cells, and as T cells lack the conventional NADPH oxidase (Hildeman et al., 1999
; Hildeman et al., 2003
), it is possible that O2 generated by activated DCs and the derived ROS alter the regulation of T-cell redox-sensitive signalling pathways. Along this line, the role of ROS in T-cell apoptosis has been emphasized (Hildeman et al., 2003
). It has also been reported that T-cell signalling pathways are differentially affected by oxidative stress, leading for example to the downregulation of PLC-
1 and to the activation of ERK-2 (extracellular signal-regulated kinase 2) (Cemerski et al., 2002
). As an alternative, generation of O2 by activated DCs might lead to an apoptotic process of DCs. In fact, phenotypic maturation induced in vitro by LPS or cytokines such as TNF
was found to end by apoptotic cell death (Winzler et al., 1997
). As recently shown (Ingulli et al., 1997
), following interaction between antigen-bearing DCs and T cells within the T-cell rich region of lymph nodes, DCs are eliminated by apoptosis, allowing the activated T cells to escape, proliferate and migrate to sites of inflammation. Similarly, it has been reported that, following maturation in response to the bacterial LPS, DCs rapidly die by apoptosis, once they have entered the T-cell areas, unless they receive a survival signal from T cells (De Smedt et al., 1998
). It would be interesting to explore whether there is a link between the apoptosis of DCs subjected to pro-inflammatory stimuli and the ability of these stimuli to unmask the cryptic NADPH oxidase of DCs.
| Acknowledgments |
|---|
| Footnotes |
|---|
Present address: Molecular Oncology Group, Lady Davis Institute for Medical Research, Jewish General Hospital, 3755 chemin de la côte sainte Catherine, H3T1E2 Montreal, Pr. Quebec, Canada ![]()
| References |
|---|
|
|
|---|
Akira, S. and Hemmi, H. (2003). Recognition of pathogen-associated molecular patterns by TLR family. Immunol. Lett. 85, 85-95.[CrossRef][Medline]
Akira, S., Takeda, K. and Kaisho, T. (2001). Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immunol. 2, 675-680.[CrossRef][Medline]
Baggiolini, M., Ruch, W. and Cooper, P. H. (1986). Measurement of hydrogen peroxide production by phagocytes using homovanillic acid and horseradish peroxidase. Methods Enzymol. 132, 395-400.[Medline]
Banchereau, J. and Steinman, R. M. (1998). Dendritic cells and the control of immunity. Nature 392, 245-252.[CrossRef][Medline]
Batot, G., Paclet, M. H., Doussière, J., Vergnaud, S., Martel, C., Vignais, P. V. and Morel, F. (1998). Biochemical and immunochemical properties of B lymphocyte cytochrome b558. Biochim. Biophys. Acta 1406, 188-202.[Medline]
Berthier, R., Martinon-Ego, C., Laharie, A. M. and Marche, P. N. (2000). A two-step culture method starting with early growth factors permits enhanced production of functional dendritic cells fom murine splenocytes. J. Immunol. Methods 239, 95-107.[CrossRef][Medline]
Björgvinsdóttir, H., Zhen, L. and Dinauer, M. C. (1996). Cloning of murine gp91phox cDNA and functional expression in a human X-linked chronic granulomatous disease cell line. Blood 87, 2005-2010.
Caux, C., Massacrier, C., Vanbervliet, B., Dubois, B., van Kooten, C., Durand, I. and Banchereau, J. (1994). Activation of human dendritic cells through CD40 cross-linking. J. Exp. Med. 180, 1263-1272.
Cella, M., Salio, M., Sakakibara, Y., Langen, H., Julkunen, I. and Lanzavecchia, A. (1999). Maturation, activation, and protection of dendritic cells induced by double-stranded RNA. J. Exp. Med. 189, 821-829.
Cemerski, S., Cantagrel, A., van Meerwijk, J. P. and Romagnoli, P. (2002). Reactive oxygen species differentially affect T cell receptor-signaling pathways. J. Biol. Chem. 277, 19585-19593.
Chen, B., Shi, Y., Smith, J. D., Choi, D., Geiger, J. D. and Mule, J. J. (1998). The role of tumor necrosis factor alpha in modulating the quantity of peripheral blood-derived, cytokine-driven human dendritic cells and its role in enhancing the quality of dendritic cell function in presenting soluble antigens to CD4+ T cells in vitro. Blood 91, 4652-4661.
Cohen-Tanugi, L., Morel, F., Pilloud-Dagher, M. C., Seigneurin, J. M., Francois, P., Bost, M. and Vignais, P. V. (1991). Activation of O2-generating oxidase in an heterologous cell-free system derived from Epstein-Barr-virus-transformed human B lymphocytes and bovine neutrophils. Application to the study of defects in cytosolic factors in chronic granulomatous disease. Eur. J. Biochem. 202, 649-655.[Medline]
Cross, A. R., Jones, O. T., Harper, A. M. and Segal, A. W. (1981). Oxidation-reduction properties of the cytochrome b found in the plasma-membrane fraction of human neutrophils. A possible oxidase in the respiratory burst. Biochem. J. 194, 599-606.[Medline]
Cross, A. R., Parkinson, J. F. and Jones, O. T. (1984). The superoxide-generating oxidase of leucocytes. NADPH-dependent reduction of flavin and cytochrome b in solubilized preparations. Biochem. J. 223, 337-344.[Medline]
De Leo, F. R. and Quinn, M. T. (1996). Assembly of the phagocyte NADPH oxydase. Molecular interaction of oxidase proteins. J. Leukoc. Biol. 60, 677-691.[Abstract]
De Smedt, T., Pajak, B., Klaus, G. G., Noelle, R. J., Urbain, J., Leo, O. and Moser, M. (1998). Antigen-specific T lymphocytes regulate lipopolysaccharide-induced apoptosis of dendritic cells in vivo. J. Immunol. 161, 4476-4479.
Dinauer, M. C. (1993). The respiratory burst oxidase and the molecular genetics of chronic granulomatous disease. Crit. Rev. Clin. Lab. Sci. 30, 329-369.[Medline]
Doussière, J., Brandolin, G., Derrien, V. and Vignais, P. V. (1993). Critical assessment of the presence of an NADPH binding site on neutrophil cytocrome b558 by photoaffinity and immunochemical labeling. Biochemistry 32, 8880-8887.[CrossRef][Medline]
Doussière, J., Gaillard, J. and Vignais, P. V. (1996). Electron transfer across the O2-generating flavocytochrome b of neutrophils. Evidence for a transition from a low-spin state to a high-spin state of the heme iron component. Biochemistry 35, 13400-13410.[CrossRef][Medline]
Dubois, B., Bridon, J. M., Fayette, J., Barthelemy, C., Banchereau, J., Caux, C. and Briere, F. (1999). Dendritic cells directly modulate B cell growth and differentiation. J. Leukoc. Biol. 66, 224-230.[Medline]
Fuchs, A., Bouin, A. P., Rabilloud, T. and Vignais, P. V. (1997). The 40-kDa component of the phagocyte NADPH oxidase (p40phox) is phosphorylated during activation in differentiated HL60 cells. Eur. J. Biochem. 249, 531-539.[Medline]
Gallagher, M., Obeid, P., Marche, P. N. and Jouvin-Marche, E. (2001). Both TCR alpha and TCR delta chain diversity are regulated during thymic ontogeny. J. Immunol. 67, 1447-1453.
Garrett, W. S., Chen, L. M., Kroschewski, R., Ebersold, M., Turley, S., Trombetta, S., Galan, J. E. and Mellman, I. (2000). Developmental control of endocytosis in dendritic cells by Cdc42. Cell 102, 325-334.[CrossRef][Medline]
Gerosa, F., Baldani-Guerra, B., Nisii, C., Marchesini, V., Carra, G. and Trinchieri, G. (2002). Reciprocal activating interaction between natural killer cells and dendritic cells. J. Exp. Med. 195, 327-333.
Gildea, L. A., Morris, R. E. and Newman, S. L. (2001). Histoplasma capsulatum yeasts are phagocytosed via very late antigen-5, killed, and processed for antigen presentation by human dendritic cells. J. Immunol. 166, 1049-1056.
Grandvaux, N., Elsen, S. and Vignais, P. V. (2001). Oxidant-dependent phosphorylation of p40phox in B lymphocytes. Biochem. Biophys. Res. Commun. 287, 1009-1016.[CrossRef][Medline]
Heyworth, P. G., Curnutte, J. T., Nauseef, W. M., Volpp, B. D., Pearson, D. W., Rosen, H. and Clark, R. A. (1991). Neutrophil nicotinamide adenine dinucleotide phosphate oxidase assembly. Translocation of p47-phox and p67-phox requires interaction between p47-phox and cytochrome b558. J. Clin. Invest. 87, 352-356.
Hildeman, D. A., Mitchell, T., Kappler, J. and Marrack, P. (2003). T cell apoptosis and reactive oxygen species. J. Clin. Invest. 111, 575-581.[CrossRef][Medline]
Hildeman, D. A., Mitchell, T., Teague, T. K., Henson, P., Day, B. J., Kappler, J. and Marrack, P. C. (1999). Reactive oxygen species regulate activation-induced T cell apoptosis. Immunity 10, 735-744.[CrossRef][Medline]
Hjelmeland, L. M. and Chrambach, A. (1984). Solubilization of functional membrane proteins. Methods Enzymol. 104, 305-318.[Medline]
Hoshino, K., Takeuchi, O., Kawai, T., Sanjo, H., Ogawa, T., Takeda, Y., Takeda, K. and Akira, S. (1999). Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J. Immunol. 162, 3749-3752.
Imler, J. L. and Hoffmann, J. A. (2003). Toll signaling: the TIReless quest for specificity. Nat. Immunol. 4, 105-106.[CrossRef][Medline]
Ingulli, E., Mondino, A., Khoruts, A. and Jenkins, M. K. (1997). In vivo detection of dendritic cell antigen presentation to CD4+ T cells. J. Exp. Med. 185, 2133-2141.
Janeway, C. A., Jr and Medzhitov, R. (2002). Innate immune recognition. Annu. Rev. Immunol. 20, 197-216.[CrossRef][Medline]
Kawahara, T., Kuwano, Y., Teshima-Kondo, S., Kawai, T., Nikawa, T., Kishi, K. and Rokutan, K. (2001). Toll-like receptor 4 regulates gastric pit cell responses to Helicobacter pylori infection. J. Med. Invest. 48, 190-197.[Medline]
Kleinberg, M. E., Malech, H. L. and Rotrosen, D. (1990). The phagocyte 47-kilodalton cytosolic oxidase protein is an early reactant in activation of the respiratory burst. J. Biol. Chem. 265, 15577-15583.
Kopp, E. and Medzhitov, R. (2003). Recognition of microbial infection by Toll-like receptors. Curr. Opin. Immunol. 15, 396-401.[CrossRef][Medline]
Light, D. R., Walsh, C., O'Callaghan, A. M., Goetzl, E. J. and Tauber, A. I. (1981). Characteristics of the cofactor requirements for the superoxide-generating NADPH oxidase of human polymorphonuclear leukocytes. Biochemistry 20, 1468-1476.[CrossRef][Medline]
Maldonado-Lopez, R., Maliszewski, C., Urbain, J. and Moser, M. (2001). Cytokines regulate the capacity of CD8
+ and CD8
dendritic cells to prime Th1/Th2 cells in vivo. J. Immunol. 167, 4345-4350.
Martinon-Ego, C., Berthier, R., Cretin, F., Collin, V., Laharie, A. M. and Marche, P. N. (2001). Murine dendritic cells derived from myeloid progenitors of the thymus are unable to produce bioactive IL-12p70. J. Immunol. 166, 5008-5017.
Matsumoto, M., Kikkawa, S., Kohase, M., Miyake, K. and Seya, T. (2002). Establishment of a monoclonal antibody against human Toll-like receptor 3 that blocks double-stranded RNA-mediated signaling. Biochem. Biophys. Res. Commun. 293, 1364-1369.[CrossRef][Medline]
Medzhitov, R. (2001). Toll-like receptors and innate immunity. Nat. Rev. Immunol. 1, 135-145.[CrossRef][Medline]
Mellman, I. and Steinman, R. M. (2001). Dendritic cells: specialized and regulated antigen processing machines. Cell 106, 255-258.[CrossRef][Medline]
Morel, F., Doussière, J., Stasia, M. J. and Vignais, P. V. (1985). The respiratory burst of bovine neutrophils. Role of a b type cytochrome and coenzyme specificity. Eur. J. Biochem. 152, 669-679.[Medline]
Omura, T. and Sato, R. (1964). The carbon monoxide-binding pigment of liver microsomes. Evidence for its hemoprotein nature. J. Biol. Chem. 239, 2370-2385.
Pollock, J. D., Williams, D. A., Gifford, M. A., Li, L. L., Du, X., Fisherman, J., Orkin, S. H., Doerschuk, C. M. and Dinauer, M. C. (1995). Murine model of X-linked chronic granulomatous disease, an inherited defect in phagocyte superoxide production. Nat. Genet. 9, 202-209.[CrossRef][Medline]
Rizzitelli, A., Berthier, R., Collin, V., Candeias, S. M. and Marche, P. N. (2002). T lymphocytes potentiate murine dendritic cells to produce IL-12. J. Immunol. 169, 4237-4245.
Rosenzwajg, M., Jourquin, F., Tailleux, L. and Gluckman, J. C. (2002). CD40 ligation and phagocytosis differently affect the differentiation of monocytes into dendritic cells. J. Leukoc. Biol. 72, 1180-1189.
Shpungin, S., Dotan, I., Abo, A. and Pick, E. (1989). Activation of the superoxide forming NADPH oxidase in a cell-free system by sodium dodecyl sulfate. Absolute lipid dependence of the solubilized enzyme. J. Biol. Chem. 264, 9195-9203.
Someya, A., Nagaoka, I. and Yamashita, T. (1993). Purification of the 260 kDa cytosolic complex involved in the superoxide production of guinea pig neutrophils. FEBS Lett. 330, 215-218.[CrossRef][Medline]
Steinman, R. M. and Nussenzweig, M. C. (2002). Avoiding horror autotoxicus: the importance of dendritic cells in peripheral T cell tolerance. Proc. Natl. Acad. Sci. USA 99, 351-358.
Steinman, R. M. and Swanson, J. (1995). The endocytic activity of dendritic cells. J. Exp. Med. 182, 283-288.
Svensson, M., Stockinger, B. and Wick, M. J. (1997). Bone marrow-derived dendritic cells can process bacteria for MHC-I and MHC-II presentation to T cells. J. Immunol. 158, 4229-4236.[Abstract]
Teshima, S., Tsunawaki, S. and Rokutan, K. (1999). Helicobacter pylori lipopolysaccharide enhances the expression of NADPH oxidase components in cultured guinea pig gastric mucosal cells. FEBS Lett. 452, 243-246.[CrossRef][Medline]
Turnbull, E. and MacPherson, G. (2001). Immunobiology of dendritic cells in the rat. Immunological Rev. 184, 58-68.[CrossRef][Medline]
Verdijk, R. M., Mutis, T., Esendam, B., Kamp, J., Melief, C. J., Brand, A. and Goulmy, E. (1999). Polyriboinosinic polyribocytidylic acid (poly(I:C)) induces stable maturation of functionally active human dendritic cells. J. Immunol. 163, 57-61.
Vignais, P. V. (2002). The superoxide-generating NADPH oxidase: structural aspect and activation mechanism. Cell. Mol. Life Sci. 59, 1428-1459.[CrossRef][Medline]
Winzler, C., Rovere, P., Rescigno, M., Granucci, F., Penna, G., Adorini, L., Zimmermann, V. S., Davoust, J. and Ricciardi-Castagnoli, P. (1997). Maturation stages of mouse dendritic cells in growth factor-dependent long-term cultures. J. Exp. Med. 185, 317-328.
Yagisawa, M., Yuo, A., Yonemaru, M., Imajoh-Ohmi, S., Kanegasaki, S., Yazaki, Y. and Takaku, F. (1996). Superoxide release and NADPH oxidase components in mature human phagocytes: correlation between functional capacity and amount of functional proteins. Biochem. Biophys. Res. Commun. 228, 510-516.[CrossRef][Medline]
Zitvogel, L. (2002). Dendritic and natural killer cells cooperate in the control/switch of innate immunity. J. Exp. Med. 195, F9-F14.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
C. Richter, M. H. S. Juan, J. Will, R. P. Brandes, U. Kalinke, S. Akira, J. M. Pfeilschifter, M. Hultqvist, R. Holmdahl, and H. H. Radeke Ncf1 Provides a Reactive Oxygen Species-Independent Negative Feedback Regulation of TLR9-Induced IL-12p70 in Murine Dendritic Cells J. Immunol., April 1, 2009; 182(7): 4183 - 4191. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. B. Thoren, A. Betten, A. I. Romero, and K. Hellstrand Cutting Edge: Antioxidative Properties of Myeloid Dendritic Cells: Protection of T Cells and NK Cells from Oxygen Radical-Induced Inactivation and Apoptosis J. Immunol., July 1, 2007; 179(1): 21 - 25. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Karlsson, E. Nygren, J. Karlsson, I. Nordstrom, C. Dahlgren, and K. Eriksson Ability of Monocyte-Derived Dendritic Cells To Secrete Oxygen Radicals in Response to Formyl Peptide Receptor Family Agonists Compared to That of Myeloid and Plasmacytoid Dendritic Cells Clin. Vaccine Immunol., March 1, 2007; 14(3): 328 - 330. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Bedard and K.-H. Krause The NOX Family of ROS-Generating NADPH Oxidases: Physiology and Pathophysiology Physiol Rev, January 1, 2007; 87(1): 245 - 313. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sinha, A. Singh, V. Satchidanandam, and K. Natarajan Impaired Generation of Reactive Oxygen Species during Differentiation of Dendritic Cells (DCs) by Mycobacterium tuberculosis Secretory Antigen (MTSA) and Subsequent Activation of MTSA-DCs by Mycobacteria Results in Increased Intracellular Survival J. Immunol., July 1, 2006; 177(1): 468 - 478. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Rivollier, L. Perrin-Cocon, S. Luche, H. Diemer, J.-M. Strub, D. Hanau, A. van Dorsselaer, V. Lotteau, C. Rabourdin-Combe, T. Rabilloud, et al. High Expression of Antioxidant Proteins in Dendritic Cells: Possible Implications in Atherosclerosis Mol. Cell. Proteomics, April 1, 2006; 5(4): 726 - 736. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Billard, C. Cazevieille, J. Dornand, and A. Gross High Susceptibility of Human Dendritic Cells to Invasion by the Intracellular Pathogens Brucella suis, B. abortus, and B. melitensis Infect. Immun., December 1, 2005; 73(12): 8418 - 8424. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||