|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online May 4, 2004
doi: 10.1242/10.1242/jcs.01079
Research Article |
Department of Cellular and Molecular Medicine, 451 Smyth Road, University of Ottawa, Ottawa, Ontario, K1H 8M5, Canada
* Author for correspondence (e-mail: btuana{at}uottawa.ca)
Accepted 5 January 2004
| Summary |
|---|
|
|
|---|
-tubulin at the centrosomes at all phases of the cell cycle. Agents that specifically disrupt microtubules did not affect SLMAP association with centrosomes. Furthermore, SLMAP sequences directed a reporter green fluorescent protein (GFP) to the centrosome, and deletions of the newly identified N-terminal sequence from SLMAP prevented the centrosomal targeting. Deletion-mutant analysis concluded that overall, structural determinants in SLMAP were responsible for centrosomal targeting. Elevated levels of centrosomal SLMAP were found to be lethal, whereas mutants that lacked centrosomal targeting inhibited cell growth accompanied by an accumulation of cells at the G2/M phase of the cell cycle.
Key words: Sarcolemmal membrane-associated protein (SLMAP), Centrosome, Forkhead associated domain, Genomic structure, Cell cycle
| Introduction |
|---|
|
|
|---|
In recent years, considerable progress has been made in elucidating the protein composition of centrosomes. In this regard, proteins localized to the MTOC have been classified as: (1) integral components of centrosomes; (2) proteins associated with centrosomes in a transient, cell cycle regulated manner; and/or (3) proteins that require microtubules for centrosomal associations (Urbani and Stearns, 1999
). Coiled-coil structure has emerged as a common structural motif predicted in several proteins localized at the MTOC, among which include pericentrin, Nek2 protein kinase, ninein, CG-NAP, kendrin and p160-Rho-associated coiled-coil-containing protein kinase (ROCK) (Doxsey et al., 1994
; Fry et al., 1998
; Fry et al., 1999
; Boukson-Castaing et al., 1996
; Takahashi et al., 1999
; Takahashi et al., 2002
; Li et al., 2000
; Chevrier et al., 2002
). Further characterization of novel structural and regulatory components localized at the MTOC will foster an improved understanding of the complex mechanisms defining centrosomal functions.
Sarcolemmal membrane-associated proteins (SLMAPs) comprise a unique family of alpha-helical coiled-coil proteins encoded by a single gene mapped to human chromosome 3p14.3-21.2 (Wigle et al., 1997
; Wielowieyski et al., 2000
). Elucidation of the genomic organization of the 3' region of the SLMAP gene indicated the presence of several splice variants, which exhibit developmental and tissue specific expression (Wielowieyski et al., 2000
). A central coiled-coil region encompassing two leucine zipper motifs constitutes the core structural feature of all SLMAP isoforms, together with a single transmembrane domain at the C-terminus that can be alternatively spliced to target these polypeptides to cellular membranes (Wielowieyski et al., 2000
). In the present study we elucidated the genomic organization of the entire SLMAP gene, which was found to comprise 24 exons spread over
122 kb of DNA. The genomic structure of the SLMAP gene predicted the presence of several splice variants, one of which was found to be a component of the MTOC.
| Materials and Methods |
|---|
|
|
|---|
FIXII and
DASH II; Stratagene). SLMAP cDNA probes used for library screening were PCR generated (Table 1) and digoxigenin labeled, according to the manufacturer's directions (Roche Applied Science) for subsequent use in Southern blotting experiments. Positive phage DNA clones were digested and resolved by electrophoresis. Restriction enzyme digest fragments of the phage genomic DNA clones were analyzed by Southern blotting to identify SLMAP exons. Genomic DNA for each of the eight clones was isolated (Table 2), subcloned into pBlueScript KS (Stratagene) and subsequently sequenced using AmpliTaw sequencing methodology (ABI). Sequencing of the identified exons enabled the identification of exon-intron junctions by PCR using forward and reverse primers designed to span successive exons (Table 1). PCR conditions consisted of the following steps: (1) 3 minutes at 94°C; (2) 30 cycles of denaturation at 94°C for 30 seconds, annealing at 50-55°C for 30 seconds, extension at 72°C for 1-3 minutes; and (3) 10 minutes at 72°C. Amplicons were resolved by electrophoresis, and the isolated DNA was cloned into the pCR4-TOPO cloning vector (Invitrogen) for subsequent sequence analysis. Computer-assisted alignment of SLMAP cDNA sequence (Accession #AF304451) with genomic sequences facilitated the identification of putative exons. The exon-intron organization of SLMAP3 was verified by aligning the mouse cDNA sequence of SLMAP3 (Accession AF304451) with mouse genomic sequences (NW 000090.1) deposited in GenBank. Consensus phosphorylation, N-glycosylation and N-myristoylation sites were identified using PROSITE database available on the EMBL server (Falquet et al., 2002
|
|
|
Antibodies
Two polyclonal antibodies against SLMAP were generated by injecting rabbits with two synthetic SLMAP-specific peptides. Anti-SLMAP(C) rabbit antisera was raised against the carboxyl 370 amino acids of SLAP, as previously described (Wigle et al., 1997
). A second antibody, designated anti-SLMAP(N), was raised against the peptide RLSRGEESPPCEI, which corresponds to the extreme N-terminus of SLMAP3, within the region separating two different initiating methionines M1 and M2 (Fig. 2A). Monoclonal anti-
-tubulin (clone GTU-88, Sigma Chemical Co.) was used to identify centrosomes, and monoclonal anti-
-tubulin (clone DM 1A, Sigma Chemical Co.) was used to visualize cytoplasmic microtubules in immunocytochemical studies. The DNA stain 4',6-diamidino-2-phenylindole dihydrochloride (DAP1) was purchased from Molecular Probes. Secondary antibodies used in immuno-cytochemistry studies included FITC-conjugated anti-rabbit immunoglobulins (Amersham Pharmacia Biotech) and CY3-conjugated anti-mouse immunoglobulins (Jackson ImmunoResearch Laboratories). Secondary antibodies used in immunoblotting experiments included anti-rabbit IgG peroxidase linked whole antibody (Amersham Pharmacia Biotech) and peroxidase conjugated AffiniPure goat anti-mouse IgG (Jackson ImmunoResearch Laboratories).
|
Immunoblot analysis
NIH 3T3 cells were solubilized by RIPA lysis buffer (1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS in PBS pH 7.4) and centrifuged at 10,000 g (15 minutes, 4°C). The protein content of clarified supernatants was determined using the BCA Protein Assay Kit (Pierce). Proteins (15 µg) were resolved by electrophoresis on 10% SDS-polyacrylamide gels, according to Laemmli (Laemmli, 1970
). Separated proteins were electrophoretically transferred onto PVDF membranes (Amersham Pharmacia Biotech) and blocked in 5% skim milk powder (SMP) in TRIS-buffered saline containing 0.05% Tween-20 (TBS-T), then incubated at room temperature for 1 hour with anti-SLMAP rabbit antibodies (1:4500) in 5% SMP/TBS-T. After four washes in TBS-T, blots were incubated with anti-rabbit IgG peroxidase linked whole antibody (Amersham Pharmacia Biotech) in 5% SMP in TBS-T for 1 hour. Antibody detection was carried out using the enhanced chemiluminescent detection system (Amersham Pharmacia Biotech).
Isolation of centrosomes
Centrosomes were isolated from NIH 3T3 cells using sucrose density gradients according to the method of Moudjou and Bornens (Moudjou and Bornens, 1998
).
Mammalian expression plasmids
SLMAP3M1 (nucleotides 1-2314) was PCR generated from the original full-length SLMAP rabbit cDNA clone (Wigle et al., 1997
) using the forward primer SLMAPN-F (GGAATTCGATGCCGTCAGCCTTGGC) and reverse primer SLMAPN-R (GATGCCAGCTTCTAGAGGGAGGACG). Forward primer SLMAPN-F and reverse primer (SLMAP+3') CCTCTAGAGCTCAGCTCTCACCTTCTTAAGC were utilized to produce carboxyl truncation mutant (nucleotides 1-1674), designated SLMAP3M1
C. The generation of N-terminal/C-terminal truncation mutant SLMAP3M2
C (nucleotides 389-1674) was accomplished using forward primer (ATG2M5') GGAATTCAGATGGTATGGAAGCC and the reverse primer (SLMAP+3'). The PCR products were each inserted into the EcoR1 and Xba1 sites of vector pcDNA3 (Invitrogen), in frame with the open reading frame of the green fluorescent protein (GFP). Sites of ligation were confirmed by DNA sequencing. To generate the leucine zipper (LZ) mutant (GFP-SLMAP3M1
LZ), the GFP-SLMAP3M1 construct was digested with BamH1 to release the segment of SLMAP that included the leucine zippers (nucleotides 1-1994). We retained the vector that included nucleotides 2001-2314 of SLMAP3M1 (designated SLMAP3') for subsequent subcloning of a PCR amplicon of SLMAP3M1 lacking the leucine zippers. This amplicon was generated using GFP SLMAP3M1 template and employing primers GFP-5' (GGGATCCATGGACAAAGGAGAAGAACTCTTCAC) and antisense primer LZ-less 3' (CGGATCCCTCTTTCTGCTGGTCCTCACACTGC), which both incorporated BamH1 sites. The PCR product (lacking the leucine zippers) was restriction digested (BamH1) and then subcloned into SLMAP3'. SLMAP N-terminal constructs were PCR generated using forward primer SLMAPN-F and the following reverse primers T3' (CCTGAGTCTAGATACTTGGAGTGTTAGC; nucleotides 1-490), U3' (CTTCTTCTAGAACATCTGTTCCCG; nucleotides 1-549) and V3' (TGCTCTAGATCAAGCCTGCCAACTGGT; nucleotides 1-618). PCR products were each subcloned into GFP-pcDNA3 and sites of ligation were confirmed by DNA sequencing.
Immunocytochemistry
Cells grown on sterile glass coverslips were fixed by two methods. The first method involved a 10 minute exposure to 4% paraformaldehyde (PFA) in phosphate buffer at room temperature. The second method consisted of a 1 minute exposure to microtubule stabilization buffer (MTSB: 4 M glycerol, 100 mM PIPES pH 6.9, 1 mM EGTA, 5 mM MgCl2), followed by a 2 minute exposure to MTSB containing 0.5% Triton-X-100 to extract soluble cellular components, then an additional 2 minute exposure to MTSB. Detergent extracted cells were then fixed with 4% PFA as described. Following either fixation method, coverslips were mounted onto glass slides and cells were incubated with relevant antibody(s) diluted in PBS containing 0.3% Triton-X-100 (PBS-T) for 3 hours at room temperature. After several washes in PBS, cells were incubated in the appropriate fluorochrome-conjugated secondary antibody(s) for 45 minutes at 37°C. DNA was stained with 4 ',6-diamidino-2-phenylindole dihydrochloride (DAP1, 1 µg/ml) for 15 minutes at room temperature.
Microscopy and image analysis
Live cells were visualized with Axiovert S100 TV (Carl Zeiss) microscope equipped with SensiCam digital camera (PCO CCD Imaging). For immunocytochemistry studies, cells were visualized using Axiophot (Carl Zeiss) microscope equipped with a 3CCD colour video camera. Acquired images were digitally processed using Northern Eclipse (Version 5.0, Empix Imaging) acquisition software. Images were further processed using Adobe PhotoshopTM 5.0 (Adobe Systems).
BrdU incorporation
GFP-pcDNA3 or the SLMAP expression plasmids (GFP-SLMAP3M1; GFP-SLMAP3M1
C; GFP-SLMAP3M2
C) were transiently transfected into NIH 3T3 cells grown on glass coverslips. 5'-Bromo-2'-deoxyuridine (BrdU, 10 µmol/l, Boehringer Mannheim) was added to the culture media at 36 hours post-transfection for 2, 8, 12 or 24 hours. At the end of each labeling period, cells were washed in PBS and fixed in 70% ethanol (in 50 mM glycine, pH 2) for 30 minutes at 20°C. Cells were then covered with anti-BrdU monoclonal antibody (1:10, Boehringer Mannheim) and anti-GFP rabbit antibody (1:10, Clontech) in incubation buffer (66 mM TRIS buffer, 0.66 mM MgCl2, 1 mM ß-mercaptoethanol) for 30 minutes at 37°C. Following several washes in PBS, cells were incubated in secondary antibodies (in PBS) for 30 minutes at 37°C. Nuclei were stained with DAP1 as previously described. Cells were then covered with mounting media and processed for immunofluorescence microscopy.
Fluorescence activated cell sorting (FACS analysis)
Transfected cells were harvested and analyzed 48 hours after removal of DNA precipitates and prepared for FACS analysis as described by Pestov et al. (Pestov et al., 1999
). The DNA content of propidium iodide (Molecular Probes, 10 µg/ml) stained GFP positive cells was measured by a Becton Dickinson FACScan cytometer using an argon laser (488 nm) and analyzed with MulticycleAV (Phoenix Flow System) program.
| Results |
|---|
|
|
|---|
|
As a result of our analysis, three additional alternative exons were identified in SLMAP. These novel alternative exons are exons XI (51 bp), XII (51 bp) and XIII (63 bp) (Table 3, Fig. 1). Each alternative exon is flanked by either class 1 introns (introns 10, 11, 13), which interrupt the coding between the first and second base of the codon, or a class 0 intron (intron 12), which occurs between codons (Mount, 1982
). Notably, splicing of any of the alternative exons maintains the open reading frame of the predicted polypeptides. A PROSITE sequence scan did not predict the presence of conserved functional domains in alternative exons XI, XII or XIII; however, consensus sites for casein kinase 2 phosphorylation, protein kinase C phosphorylation, N-glycosylation and N-myristoylation were identified (Fig. 1B) (Falquet et al., 2002
).
Leucine zipper motifs, two regions of specialized coiled-coil structure in the common carboxyl portion of SLMAPs, are encoded by exons XX and XXI, which correspond to exons VII and VIII in SLMAP1 (Wielowieyski et al., 2000
). Two distinct transmembrane domains, TM1 and TM2, were previously identified within the extreme C-terminus of SLMAPs and are encoded by alternative exon XXIII and exon XXIV of SLMAP3, known as alternative exon X and exon XI in SLMAP1 (Wielowieyski et al., 2000
). The expression of TM1 and TM2 has previously been described as mutually exclusive. Splicing of alternative exon TM1 introduces an inframe stop codon which renders the second transmembrane domain (TM2) nonfunctional.
Two in-frame start codons (ATG1; M1 and ATG2; M2) were previously reported in the full-length cDNA sequence of the rabbit SLMAP3 isoform (Accession #U21157) (Wigle et al., 1997
) and have since been found to be conserved in mouse SLMAP cDNA. Analysis of the mouse SLMAP genomic sequences revealed that the first initiating methionine (ATG1; M1) is encoded by exon I, whereas the second initiating methionine (ATG2; M2) resides in exon II. Computer-assisted sequence analysis of exon I resulted in the identification of a consensus forkhead associated domain (FHA) corresponding to amino acid 24-58 within the region spanning M1 and M2 (Fig. 2A; bold print). FHA domains exist in proteins of diverse function and have been recognized as phosphoserine/threonine-specific protein-protein interaction motifs involved in phosphopeptide recognition (Durocher et al., 2000
; Sun et al., 1998
).
Endogenous expression and subcellular distribution of SLMAP
In vitro transcription-translation experiments revealed the presence of two SLMAP products whose molecular masses were similar to those predicted by the utilization of M1 (91 kDa) or M2 (80 kDa) (Wigle et al., 1997
). To test whether a 91 kDa protein is produced in vivo, implying the utilization of M1 as the initiating methionine, antibodies were generated against a peptide sequence in the M1-M2 region at the N-terminus of SLMAP (anti-SLMAP-N) or against a fusion protein encompassing the C-terminal region of SLMAP (anti-SLMAP-C). Both antibodies recognized a 91 kDa protein in NIH 3T3 cell extracts (Fig. 2B, lanes 1 and 2). Immunoadsorption of the anti-SLMAP(N) antibodies with purified SLMAP fusion protein confirmed the specificity of the antiserum (Fig. 2B, lane 3). These results suggest that a 91 kDa polypeptide is produced from M1 of SLMAP3 mRNA in NIH 3T3 cells.
The use of M1 as a translation initiation codon is predicted to add 132 residues to the N-terminal region of the previously identified SLMAP3 isoform. We then examined if these residues confer different biochemical and subcellular properties to SLMAP3M1 not previously described for other SLMAP isoforms. Immunocytochemical analysis of NIH 3T3 cells that exclusively express the 91 kDa isoform revealed that SLMAP3M1 resides in several subcellular compartments. While diffuse cytoplasmic SLMAP staining was evident, SLMAP proteins could also be detected in one or two foci generally situated adjacent to the nuclear membrane (Fig. 3Aa,b). The foci staining pattern, but not the diffuse cytoplasmic staining pattern, was resistant to detergent extraction, suggesting that SLMAP3M1 is tightly assembled with detergent-insoluble structures (Fig. 3Ab). The N-terminal directed peptide antibody (anti-SLMAP(N); Fig. 3Ac), but not the control pre-immune serum (Fig. 3Ad), detected SLMAP proteins at perinuclear foci in detergent extracted COS-7 cells as well. Peptide competition experiments abolished the staining pattern observed with anti-SLMAP(C) (Fig. 3Ae) and incubation with the pre-immune antisera also abolished staining (Fig. 3Af), thus confirming the antibody specificity for SLMAP proteins. The subcellular distribution of SLMAP was similar in other cells that express the 91 kDa SLMAP isoform, including murine myoblasts (C2C12) and embryonic stem cells (data not shown).
|
SLMAP is a novel component of the centrosome
The perinuclear foci staining of SLMAP is reminiscent of proteins that localize to the centrosome. To determine if SLMAP is associated with centrosomes, colocalization experiments were performed with
-tubulin, a well-characterized core centrosomal component (Stearns et al., 1991
). As illustrated in Fig. 3B, SLMAP labeling was co-incident with the
-tubulin signal at each stage of the cell cycle as determined by DAPI staining. Interphase (G1) cells (Fig. 3Ba,f,k) contained one centrosome stained by both anti-SLMAP and anti-
-tubulin. In mitotic cells SLMAP (Fig. 3Bb-e) colocalized with
-tubulin (Fig. 3Bg-j) from prophase to anaphase (Fig. 3Bl-o). The SLMAP protein appears to have a symmetrical distribution during centrosome division given that anti-SLMAP appeared to stain each centrosome with equal intensity.
Many proteins reside at the minus ends of microtubules and are thus dependent on microtubules for their associations with the MTOC. These proteins can be distinguished from integral centrosomal proteins by treatments with agents that specifically disrupt microtubules. The fungal toxin nocodazole causes depolymerization of the cytoplasmic microtubule network, whereas taxol (paclitaxel) acts to stabilize cytoplasmic microtubules by binding tubulin directly along the length of the microtubule (De Brabander et al., 1986
). On treatment with either drug, integral centrosomal proteins remain bound to centrosomal components, whereas microtubule-dependent centrosome-associated proteins are no longer retained at the MTOC (De Brabander et al., 1986
). Under control conditions (untreated) SLMAP3M1 was found to colocalize with
-tubulin (Fig. 4Aa,d). The effects of taxol (Fig. 4Ak) and nocodazole (Fig. 4Al) on microtubules were confirmed by staining with
-tubulin, which illustrated a distinct redistribution of cytoplasmic microtubules. Treatment with taxol (Fig. 4Ab,e,h,k) or nocodazole (Fig. 4Ac,f,i,l) did not alter the localization of SLMAPs at centrosomes. These findings confirm that SLMAP localization at the centrosome is independent of microtubule assembly.
|
To show biochemically that SLMAP is a component of centrosomes, these subcellular structures were purified from NIH 3T3 cell extracts by fractionation on a sucrose density gradient (Moudjou and Bornens, 1998
). The sucrose gradient fractions were resolved by SDS-PAGE and examined by immunoblotting with anti-
-tubulin and anti-SLMAP (Fig. 4B). The centrosomal marker
-tubulin was present in the cell lysate (lane 1), enriched in the crude centrosome preparation (lane 2) and even further concentrated in fraction 2 (lane 5) from the sucrose density gradient. The 91 kDa SLMAP3M1 protein was found to co-enrich with the
-tubulin peak in fraction 2 (lane 5) of the purified centrosome preparation.
Centrosomal targeting is mediated by the novel N-terminal region of SLMAP
The data presented indicates that SLMAP3M1 is an integral component of centrosomes. These observations led us to hypothesize that the newly identified sequences from the M1 initiating codon might play a role in targeting SLMAP to the MTOC. To test this hypothesis SLMAP3M1 cDNA (Fig. 5A) and a series of SLMAP deletion mutants (Fig. 6A-D) were fused in frame to GFP to produce GFP-SLMAP fusion proteins. The GFP-SLMAP fusion constructs were used for transient expression studies in NIH 3T3 cells. Fig. 5B (a) shows that SLMAP3M1 cDNA encodes information that is sufficient to target the heterologous reporter GFP to the centrosome in live cells. This localization pattern was not observed in live mitotic cells expressing GFP alone (Fig. 5Bc). GFP-SLMAP3M1 colocalized with
-tubulin at the centrosome (Fig. 5Bb,d), consistent with the localization of endogenous SLMAP3M1 (Figs 3, 4). Deletion of the two leucine zipper regions did not affect GFP targeting to the centrosome (Fig. 6Aa), and the C-terminal truncation mutant (SLMAP3M1
C) also retained the ability to target GFP to centrosomes (Fig. 6Ab). A cDNA encoding SLMAP initiated from the second methionine (GFP-SLMAP3M2
C) lacking the transmembrane domain was unable to target GFP to centrosomes (Fig. 6Ac). It is notable that C-terminal mutants lacking the putative transmembrane domain resulted in the exclusion of SLMAP from the perinuclear membranes and reticular formations (Fig. 6Cb,c), which is consistent with the observation that C-terminal sequences play a role in membrane targeting of SLMAP (Wielowieyski et al., 2000
). These results suggest that the newly described N-terminal sequences encompassing the FHA domain of SLMAP contain information required for its centrosomal localization.
|
|
To identify the minimal sequences present in SLMAP sufficient for targeting to the MTOC, a series of SLMAP N-terminal fragments fused to GFP were utilized in transient expression studies in NIH 3T3 fibroblast cells. Diffuse cytosolic and nuclear localization was observed in cells expressing the GFP-SLMAP mutant expressing amino acids 1-163 (Fig. 6Ba), while GFP-positive detergent-insoluble aggregates were detected in cells transfected with SLMAP mutants expressing amino acids 1-183 and 1-206 (Fig. 6Bb,c). On the basis of observations by live microscopy and co-staining with the centrosome marker protein
-tubulin (data not shown), GFP fluorescence was not detected at centrosomes in cells overexpressing these extreme N-terminal SLMAP3M1 mutants. These observations suggest that N-terminal sequences, in addition to preservation of the overall structure of SLMAP or SLMAP-mediated protein interactions, may be important determinants for targeting SLMAPs to centrosomes.
SLMAP overexpression affects cell proliferation
The finding that SLMAP3M1 was localized at the centrosome raised the possibility as to whether SLMAPs serve a role in mitosis and cell growth, and we examined this by ectopic expression studies. We observed that a large proportion of cells expressing the full-length GFP-SLMAP3M1 were nonviable and rounded in appearance (Fig. 6Db) and detached from the coverslips within 36 hours following transfection. By contrast, cell viability did not appear to be affected by the expression of either the C-terminal mutant (GFP-SLMAP3M1
C; Fig. 6Dc) or the GFP-tagged SLMAP mutant lacking both the N- and C-terminal sequences (GFP-SLMAP3M2
C; Fig. 6Dd). To address this issue further we examined the effect of ectopic expression of SLMAP3M1, SLMAP3M2 and SLMAP3M2
C on cell proliferation. A reduction in the level of BrdU incorporation by more than twofold was observed in cells expressing GFP-SLMAP3M1 fusion protein relative to GFP transfected control cells for labeling periods of 2 to 8 hours (Fig. 7A). Approximately 60% of cells expressing either SLMAP3M1, SLMAP3M2 or SLMAP3M2
C displayed BrdU incorporation after a 24 hour pulse, whereas essentially all of the control cells were positive for BrdU. These results indicate that regulated levels of SLMAPs are important for normal cell growth.
|
We sought to determine whether overexpression of SLMAPs altered cell proliferation by interfering in a cell cycle phase-specific manner. Fluorescence activated cell sorting (FACS) was used to identify GFP-expressing cells and thereby identify changes in cell cycle progression induced by SLMAP (Fig. 7B). Overproduction of GFP-SLMAP3M1 was toxic to NIH 3T3 cells as the majority of cells died within 36 hours post-transfection. However, cells expressing the deletion mutant GFP-SLMAP3M2 remained viable for the time required for FACS analysis, and overproduction of this deletion mutant caused about a fourfold increase in G2/M (4N DNA; Fig. 7Bii) content compared with control cells (Fig. 7Bi). These results suggest that deregulated levels of SLMAP3 in NIH 3T3 cells alter proliferation by interfering at the G2/M phase of the cell cycle.
| Discussion |
|---|
|
|
|---|
122 kb of continuous DNA sequence. Analysis of the new sequences defined the presence of three additional regions of alternative splicing (exons XI, XII, XIII) in SLMAP compared with our previous results. A new SLMAP variant (SLMAP3M1) containing an N-terminal extension of 132 amino acid residues that are encoded in exon I was identified to be a component of the MTOC. Using anti-peptide antibodies directed toward the N-terminal sequences, a SLMAP protein of
91 kDa was identified in various cell extracts. These findings confirm that SLMAP3M1 represents a ubiquitously expressed SLMAP isoform. Indirect immunofluorescence studies using fixation procedures known to aid visualization of the cytoskeleton localized SLMAP3M1 to the centrosome. SLMAP3M1 was detected at the centrosome at all stages of the cell cycle (therefore not a transient association) and colocalized with
-tubulin. Treatments with reagents that specifically disrupt cytoplasmic microtubules did not affect SLMAP association at centrosomes, indicating that SLMAP-centrosome association occurs independently of microtubules. This new SLMAP isoform may be a core component of the MTOC.
SLMAP3M1 sequences were found to contain the information required to target the heterologous protein GFP to centrosomes. Large C-terminal deletions eliminating much of the coiled-coil structure including the leucine zipper motifs did not affect targeting of GFP to centrosomes. However, removal of the newly identified N-terminal residues from SLMAP abolished the targeting of GFP to the centrosome, indicating that the 132 N-terminal amino acid residues are required for centrosomal targeting. Further analysis of SLMAP deletion mutants encoding N-terminal sequences revealed that this region of SLMAP is not alone sufficient for centrosome targeting. Although the N-terminus of SLMAP may serve a crucial role in mediating SLMAP-centrosome associations, the preservation of the overall structure of SLMAP may constitute an additional determinant for ensuring faithful targeting at the MTOC. Conserved motifs for protein targeting to and retention within organelles such as the ER and Golgi have been characterized (Pelham, 1988
; Jackson et al., 1990
; Kjer-Nielsen et al., 1999
; Munro and Nichols, 1999
; Brown et al., 2001
), yet little is known of conserved sequences directing proteins to centrosomes. Recent studies have highlighted a conserved region of approximately 90 amino acids encoded in pericentrin and AKAP450 that confers targeting to centrosomes (Gillingham and Munro, 2000
). This motif, known as the PACT domain, was not identified within the N-terminal sequences of SLMAP or within any other region of this molecule. Thus, our results indicate that structural motifs, in addition to motifs such as the PACT domain, are crucial in targeting components to centrosomes. In this regard, recent studies by Petit et al. (Petit et al., 2003
) indicate that coiled-coil motifs play important roles in targeting molecules to the centrosome.
Amino acid sequence analysis of the new SLMAP N-terminal revealed the presence of a conserved motif known as the forkhead associated (FHA) domain. FHA domains have been characterized in several proteins of diverse function, including kinases, phosphatases, kinesins, transcription factors, and DNA- and RNA-binding proteins, as well as metabolic enzymes (Hofmann and Bucher, 1995
; Durocher and Jackson, 2002
), and are known to serve as phosphoserine/threonine-specific protein-protein interaction motifs (Durocher et al., 2000
; Sun et al., 1998
). In this regard, FHA-interacting proteins such as Hklp2, a human homolog of Xklp2, a Xenopus kinesin-like motor protein, which serve roles in centrosome separation and spindle bipolarity, are known to reside at the MTOC (Boleti et al., 1996
; Sueishi et al., 2000
). The FHA domain in SLMAP may thus mediate associations with phosphoproteins present at MTOC. In this regard, the Aurora family of mitotic serine-threonine kinases is required for MTOC functions (Kimura et al., 1997
; Kimura et al., 1999
; Giet and Prigent, 1999
). The presence of the FHA domains in SLMAP raises the possibility that it may interact with phosphorylated substrates of this kinase to affect centrosome activity and cell viability.
SLMAP shares several features inherent to other centrosomal proteins, including a net negative charge (pI 4.9) and extensive regions of coiled-coil structure (Doxsey et al., 1994
; Boukson-Castaing et al., 1996
; Errabolu et al., 1994
). The alternative exons XI, XII and XIII were predicted to introduce post-translational modification sites including phosphorylation for casein kinase 2 and protein kinase C, as well as N-glycosylation and N-myristoylation. Such modifications may impose significant consequences with respect to the biological function and regulation of SLMAPs. In view of the extensive splicing predicted in SLMAP, we speculate that alternative splicing may represent a fundamental mechanism that confers functional diversity among SLMAP variants as has been reported for other coiled-coil proteins. Our recent unpublished data indicate that SLMAP isoforms can homodimerize via the specialized leucine-rich coiled-coil regions and reside in different cellular organelles, including the Golgi apparatus. In this regard the SLMAPs are similar to Golgin 97 and TGN 38, which can also reside in the Golgi and the centrosome (Takatsuki et al., 2002
). Studies indicate that the spatial arrangement of the Golgi with respect to the centrosome is important for Golgi organization following mitosis, and tethering these two organelles may be a critical event mediated by as-yet-unidentified molecules (Sutterlin et al., 2002
; Takatsuki et al., 2002
). The SLMAPs share an overall structural homology with docking molecules such as the syntaxins and may therefore contribute to tethering function for the centrosome and the Golgi, possibly via homodimer formation. Although we do not know the precise function of SLMAP at centrosomes, the deregulation of SLMAP expression had a marked effect on cell viability and cell cycle progression. It is notable that recent data has implicated a crucial role for the centrosome in cell cycle control, although the identity of the molecular components involved remain to be defined (Rieder et al., 2001
). Overall, our findings imply that the new SLMAP isoform is a component of the centrosome whose targeting is mediated by its unique structural determinants and as such may participate in the important functional roles being ascribed to this organelle.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Boleti, H., Karsenti, E. and Vernos, I. (1996). Xklp2, a novel Xenopus centrosomal kinesin-like protein required for centrosome separation during mitosis. Cell 84, 49-59.[CrossRef][Medline]
Boukson-Castaing, V., Moudjou, M., Ferguson, D. J. P., Mucklow, S., Belkaid, Y., Milon, G. and Crocker, P. R. (1996). Molecular characterization of ninein, a new coiled-coil protein of the centrosome. J. Cell Sci. 109, 179-190.[Abstract]
Brown, D. L., Heimann, K., Lock, J., Kjer-Nielsen, L., van Vliet, C., Strow, J. L. and Gleeson, P. A. (2001). The GRIP domain is a specific targeting sequence for a population of trans-Golgi network derived tubulo-vesicular carriers. Traffic 2, 336-344.[CrossRef][Medline]
Chevrier, V., Piel, M., Collomb, N., Saoudi, Y., Frank, R., Paintrand, M., Narumiya, S., Bornens, M. and Job, D. (2002). The Rho-associated protein kinase p160ROCK is required for centrosome positioning. J. Cell Biol. 157, 807-817.
De Brabander, M., Geuens, G., Nuydens, R., Willebrords, R., Aerts, F. and DeMey, J. (1986). Microtubule dynamics during the cell cycle: the effects of taxol and nocodazole on the microtubule system of Pt K2 cells at different stages of the mitotic cycle. Int. Rev. Cytol. 101, 215-274.[Medline]
Doxsey, S. J. (2001). Re-evaluating centrosome function. Nat. Rev. Mol. Cell. Biol. 2, 688-698.[CrossRef][Medline]
Doxsey, S. J. (2002). Duplicating dangerously: linking centrosome duplication and aneuploidy. Mol. Cell 10, 439-440.[CrossRef][Medline]
Doxsey, S. J., Stein, P., Evans, L., Calarco, P. D. and Kirschner, M. (1994). Pericentrin, a highly conserved centrosome protein involved in microtubule organization. Cell 76, 639-650.[CrossRef][Medline]
Durocher, D. and Jackson, S. P. (2002). The FHA domain. FEBS Lett. 513, 58-66.[CrossRef][Medline]
Durocher, D., Taylor, I. A., Sarbassova, D., Haire, L. F., Westcott, S. L., Jackson, S. P., Smerdon, S. J. and Yaffe, M. B. (2000). The molecular basis of FHA domain: phosphopeptide binding specificity and implications for phospho-dependent signaling mechanisms. Mol. Cell 6, 1169-1182.[CrossRef][Medline]
Errabolu, R., Sanders, M. A. and Salisbury, J. L. (1994). Cloning of a cDNA encoding human centrin, an EF-hand protein of centrosomes and mitotic spindle poles. J. Cell Sci. 107, 9-16.[Abstract]
Falquet, L., Pagni, M., Bucher, P., Hulo, N., Sigrist, C. J., Hofmann, K. and Bairoch, A. (2002). The PROSITE database, its status in 2002. Nucleic Acids Res. 30, 235-238.
Fry, A. M., Meraldi, P. and Nigg, E. A. (1998). A centrosomal function for the human Nek2 protein kinase, a member of the NIMA family of cell cycle regulators. EMBO J. 17. 470-481.[CrossRef][Medline]
Fry, A. M., Arnaud, L. and Nigg, E. A. (1999). Activity of the human centrosomal kinase, Nek2, depends on an unusual leucine zipper dimerization motif. J. Biol. Chem. 274, 16304-16310.
Giet, R. and Prigent, C. (1999). Aurora/Ipl1p-related kinases, a new oncogenic family of mitotic serine-threonine kinases. J. Cell Sci. 112, 3591-3601.[Abstract]
Gillingham, A. K. and Munro, S. (2000). The PACT domain, a conserved centrosomal targeting motif in the coiled-coil proteins AKAP450 and pericentrin. EMBO Rep. 1, 524-529.[CrossRef][Medline]
Hinchcliffe, E. H., Li, C., Thompson, E. A., Maller, J. L., Sluder, G. (1999). Requirement of Cdk2-cyclin E activity for repeated centrosome reproduction in Xenopus egg extracts. Science 283, 851-854.
Hofmann, K. and Bucher, P. (1995). The FHA domain: a putative nuclear signaling domain found in protein kinases and transcription factors. Trends Biochem. Sci. 20, 347-349.[CrossRef][Medline]
Jackson, M. R., Nilsson, T. and Peterson, P. A. (1990). Identification of a consensus motif for retention of transmembrane proteins in the endoplasmic reticulum. EMBO J. 9, 3153-3162.[Medline]
Kaiser, B. K., Zimmerman, Z. A., Charbonneau, H. and Jackson, P. K. (2002). Disruption of centrosome structure, chromosome segregation and cytokinesis by misexpression of human Cdc14A phosphatase. Mol. Biol. Cell 13, 2289-2300.
Kimura, M., Kotani, S., Hattori, T., Sumi, N., Yoshioka, T., Todokoro, K. and Okano, Y. (1997). Cell cycle-dependent expression and spindle pole localization of a novel human protein kinase, Aik, related to Aurora of Drosophila and yeast Ipl1. J. Biol. Chem. 272, 13766-13771.
Kimura, M., Matsuda, Y., Yoshioka, T. and Okano, Y. (1999). Cell cycle-dependent expression and centrosome localization of a third human aurora/Ipl1-related protein kinase, AIK3. J. Biol. Chem. 274, 7334-7340.
Kjer-Nielsen, L., Teasdale, R. D., van Vliet, C. and Gleeson, P. A. (1999). A novel Golgi-localization domain shared by a class of coiled-coil peripheral membrane proteins. Curr. Biol. 9, 385-388.[CrossRef][Medline]
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.[CrossRef][Medline]
Li, Q., Hansen, D., Killilea, A., Joshi, H. C., Palazzo, R. E. and Balczon, R. (2000). Kendrin/pericentrin-B, a centrosomal protein with homology to pericentrin that complexes with PCM-1. J. Cell Sci. 114, 797-809.
Mailand, N., Lukas, C., Kaiser, B. K., Jackson, P. K., Bartek, J. and Lucas, J. (2002). Deregulated human Cdc14A phosphatase disrupts centrosome separation and chromosome segregation. Nat. Cell Biol. 4, 317-322.[Medline]
Mayor, T., Meraldi, P., Stierhof, Y. D., Nigg, E. A. and Fry, A. M. (1999). Protein kinases in control of the centrosome cycle. FEBS Lett. 452, 92-95.[CrossRef][Medline]
Meraldi, P. and Nigg, E. A. (2002). The centrosome cycle. FEBS Lett. 521, 9-13.[CrossRef][Medline]
Meraldi, P., Lukas, J., Fry, A. M., Bartek, J. and Nigg, E. A. (1999). Centrosome duplication in mammalian somatic cells requires E2F and Cdk2-cyclin A. Nat. Cell Biol. 1, 88-93.[CrossRef][Medline]
Moudjou, M. and Bornens, M. (1998). Method of centrosome isolation from cultured animal cells. In Cell Biology: A Laboratory Handbook (ed. J. E. Celis), 2 pp. 111-119. Toronto: Academic Press.
Mount, S. M. (1982). A catalogue of splice junction sequences. Nucleic Acids Res. 10, 459-472.
Munro, S. and Nichols, B. J. (1999). The GRIP domain a novel Golgi-targeting domain found in several coiled-coil proteins. Curr. Biol. 9, 377-380.[CrossRef][Medline]
Nigg, E. A. (2002). Centrosome aberrations: cause or consequence of cancer progression? Nat. Rev. Cancer 2, 815-825.[CrossRef][Medline]
Pelham, H. R. (1988). Evidence that luminal ER proteins are sorted from secreted proteins in a post-ER compartment. EMBO J. 7, 913-918.[Medline]
Pestov, D. G., Polonskaia, M. and Lau, L. F. (1999). Flow cytometric analysis of the cell cycle in transfected cells without cell fixation. Biotechniques 26, 102-106.[Medline]
Petit, C., Giron, M-L., Tobaly-Tapiero, J., Bittoun, P., Real, E., Jacob, Y., Tordo, N., de Thé., H. and Saïb, A. (2003). Targeting of incoming retroviral Gag to the centrosome involves a direct interaction with the dynein light chain 8. J. Cell Sci. 116, 3433-3442.
Rieder, C. L., Faruki, S. and Khodjakov, A. (2001). The centrosome in vertebrates: more than a MTOC. Trends Cell Biol. 10, 413-419.
Sluder, G. and Hinchcliffe, E. H. (2000). The coordination of centrosome reproduction with nuclear events during the cell cycle. Curr. Top. Dev. Biol. 49, 267-289.[Medline]
Stearns, T., Evans, L. and Kirschner, M. (1991). Gamma-tubulin is a highly conserved component of the centrosome. Cell 65, 825-836.[CrossRef][Medline]
Sueishi, M., Takagi, M. and Yoneda, Y. (2000). The Forkhead-associated domain of Ki-67 antigen interacts with the novel kinesin-like protein Hklp2. J. Biol. Chem. 275, 28888-28892.
Sun, Z., Hsiao, J., Fay, D. S. and Stern, D. F. (1998). Rad53 FHA domain associated with phosphorylated Rad9 in the DNA damage checkpoint. Science 281, 272-274.
Sutterlin, C., Hsu, P., Mallabiabarrena, A., Malhotra, V. (2002). Fragmentation and dispersal of the pericentriolar Golgi complex is required for entry into mitosis in mammalian cells. Cell 109, 359-369.[CrossRef][Medline]
Takahashi, M., Shibata, H., Shimakawa, M., Miyamoto, M., Mukai, H., and Ono, Y. (1999). Characterization of a novel giant scaffolding protein, CG-NAP, that anchors multiple signaling enzymes to centrosome and the Golgi apparatus. J. Biol. Chem. 274, 17267-17274.
Takahashi, M., Yamagiwa, A., Nishimura, T., Mukai, H. and Ono, Y. (2002). Centrosomal proteins CG-NAP and kendrin provide microtubule nucleation sites by anchoring
-tubulin ring complex. Mol. Biol. Cell 13, 3235-3245.
Takatsuki, A., Nakamura, M. and Kono, Y. (2002). Possible implication of Golgi-nucleating function for the centrosome. Biochem. Biophys. Res. Commun. 291, 494-500.[CrossRef][Medline]
Urbani, L. and Stearns, T. (1999). The centrosome. Curr. Biol. 9, R315-R317.[CrossRef][Medline]
Whitehead, C. M. and Salisbury, J. L. (1999). Regulation and regulatory activities of centrosomes. J. Cell. Biochem. 32, 192-199.
Wielowieyski, P. A., Sevinc, S., Guzzo, R., Salih, M., Wigle, J. T. and B. S. Tuana (2000). Alternative splicing, expression, and genomic structure of the 3' region of the gene encoding the sarcolemmal-associated proteins (SLAPs) defines a novel class of coiled-coil tail-anchored membrane proteins. J. Biol. Chem. 275, 38474-38481.
Wigle, J. T., Demchyshyn, L., Pratt, M. A., Staines, W. A., Salih, M. and Tuana, B. S. (1997). Molecular cloning, expression, and chromosomal assignment of sarcolemmal-associated proteins. A family of acidic amphipathic alpha-helical proteins associated with the membrane. J. Biol. Chem. 272, 32384-32394.
This article has been cited by other articles:
![]() |
H. Ding, A. G. Howarth, M. Pannirselvam, T. J. Anderson, D. L. Severson, W. B. Wiehler, C. R. Triggle, and B. S. Tuana Endothelial dysfunction in Type 2 diabetes correlates with deregulated expression of the tail-anchored membrane protein SLMAP Am J Physiol Heart Circ Physiol, July 1, 2005; 289(1): H206 - H211. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Guzzo, M. Salih, E. D. Moore, and B. S. Tuana Molecular properties of cardiac tail-anchored membrane protein SLMAP are consistent with structural role in arrangement of excitation-contraction coupling apparatus Am J Physiol Heart Circ Physiol, April 1, 2005; 288(4): H1810 - H1819. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||