spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 9 June 2004
doi: 10.1242/jcs.01179


Journal of Cell Science 117, 3119-3127 (2004)
Published by The Company of Biologists 2004
This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jcs.01179v1
117/15/3119    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iezzi, M.
Right arrow Articles by Wollheim, C. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iezzi, M.
Right arrow Articles by Wollheim, C. B.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Research Article

Synaptotagmin V and IX isoforms control Ca2+-dependent insulin exocytosis

Mariella Iezzi1, Georgia Kouri1, Mitsunori Fukuda2 and Claes B. Wollheim1,*

1 Division of Clinical Biochemistry, Department of Internal Medicine, University Medical Center, 1211 Geneva 4, Switzerland
2 Fukuda Initiative Research Unit, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198, Japan

* Author for correspondence (e-mail: claes.wollheim{at}medecine.unige.ch)

Accepted 24 February 2004


    Summary
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Synaptotagmin (Syt) is involved in Ca2+-regulated secretion and has been suggested to serve as a general Ca2+ sensor on the membrane of secretory vesicles in neuronal cells. Insulin exocytosis from the pancreatic ß-cell is an example of a Ca2+-dependent secretory process. Previous studies have yielded conflicting results as to which Syt isoform is present on the secretory granules in the native ß-cell. Here we show by western blotting and RT-PCR analysis, the presence of both Syt V and Syt IX in rat pancreatic islets and in the clonal ß-cell line INS-1E. The subcellular distribution of the two Syt isoforms was assessed by confocal microscopy and by sedimentation in a continuous sucrose density gradient in INS-1E cells. These experiments show that both proteins colocalize with insulin-containing secretory granules but are absent from synaptic-like microvesicles. Further immunofluorescence studies performed in primary pancreatic endocrine cells revealed that Syt V is present in glucagon-secreting {alpha}-cells, whereas Syt IX is associated with insulin granules in ß-cells. Transient overexpression of Syt V and Syt IX did not alter exocytosis in INS-1E cells. Finally, reduction of the expression of both Syt isoforms by RNA interference did not change basal secretion. Remarkably, hormone release in response to glucose was selectively and strongly reduced, indicating that Syt V and Syt IX are directly involved in the Ca2+-dependent stimulation of exocytosis.

Key words: RNA interference, ß-cell, Insulin secretion, INS-1E cells, Pancreatic islet, hGH secretion


    Introduction
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Insulin exocytosis from the ß-cells of the islets of Langerhans is stimulated by various physiological secretagogues that include glucose, amino acids and receptor agonists such as acetylcholine, cholecystokinin and glucagon like-peptide 1. A common mechanism of action for these secretagogues is an increase in cytosolic Ca2+. However, the mechanism by which Ca2+ induces insulin-granule fusion with the plasma membrane in the ß-cell is poorly understood (Wollheim and Maechler, 2002Go; Rorsman and Renstrom, 2003Go). Nonetheless, the process shares many features with neuroexocytosis (Burgoyne and Morgan, 2003Go).

Synaptotagmins (Syts) constitute a large family of proteins implicated in Ca2+-triggered exocytosis (Chapman, 2002Go; Südhof, 2002Go). Vertebrates express at least 15 isoforms, which share a common structure composed of an intravesicular N-terminal domain and a single membrane-spanning region, followed by the two C-terminal C2A and C2B domains (Südhof and Rizo, 1996Go; Rickman et al., 2004Go). These domains mediate the Ca2+-dependent phospholipid binding that is essential for membrane interactions.

The archetypical closely related Syts I and II are localized to synaptic vesicles as well as secretory granules and they function as essential vesicular Ca2+ sensors in exocytosis (Geppert et al., 1994Go). However, these isoforms are not the only Ca2+ sensors because some Ca2+-dependent exocytosis remains in their absence (Geppert et al., 1994Go). Our group has shown that Syt I and II are expressed in various pancreatic ß-cell lines but not in native ß-cells. Furthermore, both the C2A and C2B domains were required for Ca2+-triggered insulin exocytosis (Lang et al., 1997Go).

Syt III is the most abundant synaptotagmin after Syts I and II. Syt III mRNA was detected in different insulin-secreting cell lines and in rat pancreatic islets (Gao et al., 2000Go; Gut et al., 2001Go; Mizuta et al., 1994Go). Using a monospecific antibody, endogenous Syt III was not observed in rat ß-cells but localized to the plasma membrane when overexpressed (Gut et al., 2001Go). This contrasts with previous studies showing the association of Syt III with insulin-secretory granules in ß-cells and derived cell lines (Brown et al., 2000Go; Gao et al., 2000Go; Mizuta et al., 1997Go).

Another isoform, Syt IV, is present in glucagon-secreting islet {alpha}-cells and within the TGN in various ß-cell lines (Gut et al., 2001Go). In addition, Syt VII and VIII mRNAs are present in different insulinoma cell lines and in rat pancreatic islets (Gao et al., 2000Go; Gut et al., 2001Go). The Syt VII protein was also detected in these cell preparations (Gao et al., 2000Go). Indirect evidence suggested that Syt VII and VIII might be implicated in Ca2+-regulated exocytosis (Gut et al., 2001Go).

The Syt V isoform has been reported to localize on dense-core vesicles in mouse brain and to control calcium-dependent exocytosis in PC12 cells (Saegusa et al., 2002Go). Moreover, the Syt V transcript was detected in rat pancreatic islets and in various insulin-secreting cell lines (Gao et al., 2000Go; Gut et al., 2001Go). However, the Syt V protein was only present in mouse pancreatic {alpha}-cells, constituting ~20% of the islet endocrine cells (Saegusa et al., 2002Go). Previous experiments in permeabilized primary ß-cells showed that the introduction of a recombinant peptide corresponding to the C2 domains of Syt V inhibited Ca2+-evoked insulin release. These findings suggested that Syt V might be one of the Ca2+ sensors for insulin exocytosis in the ß-cell (Gut et al., 2001Go). Nonetheless, the subcellular localization of Syt V in insulin-secreting cells and its precise function in regulated exocytosis have not been clarified.

Syt IX, unfortunately also called Syt V, shares the highest sequence similarity with Syt I and Syt II (Rickman et al., 2004Go). It is synthesized at low abundance in non-neuronal tissues (such as rat kidney, adipose tissue, lung and heart) and at higher levels in brain and PC12 cells, where it is localized to synaptic vesicles (Craxton and Goedert, 1995Go; Hudson and Birnbaum, 1995Go). Syt IX was reported to have a role as a Ca2+ sensor in the release of norepinephrine from PC12 cells (Fukuda et al., 2002aGo). In addition to exocytosis, Syt IX may also have a role in endocytosis. In fact, a recent study revealed that this isoform is involved in the transport of transferrin from the endocytic recycling compartment (ERC) to the cell surface (Haberman et al., 2003Go). But to date there is no information regarding a putative involvement of Syt IX in insulin secretion.

Therefore, we have investigated the presence and the intracellular localization of Syt V and Syt IX in pancreatic endocrine cells and in a derived cell line (INS-1E). We also examine the functional impact of Syt V and Syt IX on insulin exocytosis in INS-1E cells, comparing their overexpression as well as suppression using RNA interference (RNAi).


    Materials and Methods
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Rat Syt IX cDNA was a kind gift from M. Birnbaum (Harvard Medical School, Boston, MA). Myc-tagged rat Syt V in pcDNA3 was kindly provided by R. Regazzi (Institute of Cellular Biology and Morphology, University of Lausanne, Switzerland). The GFP cDNA was obtained from Clontech (Basel, Switzerland). The monoclonal antibody against Syt IX was purchased from BD Biosciences (Basel, Switzerland). The rabbit polyclonal antibody directed against Syt V (anti-Syt V{Delta}C2AB) was prepared as described previously (Saegusa et al., 2002Go). The mouse monoclonal antibody specific for human c-myc (9E10) was produced from myeloma SP2/O and the hybridoma medium was used for experiments. The polyclonal antibody against c-myc, as well as the monoclonal antibodies against insulin, synaptophysin (clone SVP-38) and glucagon, were obtained from Sigma. The guinea pig antibody against insulin was kindly provided by P. Meda (Department of Morphology, University of Geneva, Switzerland). A polyclonal rabbit antibody raised against the {alpha}-subunit of Na+/K+-ATPase was supplied by E. Ferraille (University of Geneva, Switzerland). The polyclonal antibody against carboxypeptidase H was a kind gift from J. Parkinson (Sheffield Hallam University, UK). FITC and Rhodamine-conjugated secondary antibodies were from Jackson ImmunoResearch Laboratories (West Grove, PA). Phorbol 12-myristate 13-acetate (PMA) was from Sigma.

Cell culture
The INS-1E clone of the insulin-secreting cell line INS-1 (Merglen et al., 2004Go) was cultured in RPMI 1640 medium supplemented with 10% FCS and other additions as described (Asfari et al., 1992Go). Cells were incubated in a humidified atmosphere of 5% CO2 at 37°C.

Pancreatic islets
Rat pancreatic islets were obtained by collagenase digestion and purified on a Ficoll gradient as described (Pralong et al., 1990Go). Islets were then homogenized and used for western blotting experiments as described below. Alternatively, just after Ficoll gradient, islet cells were prepared for immunofluorescence as described previously (Rouiller et al., 1991Go). Briefly, the islets were dissociated by trypsin treatment, seeded on poly-ornithine-coated glass coverslips and maintained in culture 48 hours before the experiment.

Cell homogenates
The cells of the INS-1E clone or the pancreatic islets were washed twice in ice-cold phosphate-buffered saline (PBS) containing 5 mM EDTA, 5 µg/ml leupeptine, 5 µg/ml aprotinine and then disrupted by brief sonication (3x 1 second). The homogenates were stored at –20°C until use.

Brain crude membranes
A whole rat brain was homogenized in 2 ml ice cold sonication buffer containing 5 mM Tris-HCl pH 7.4, 1 mM EDTA, 1 mM dithiothreitol and a cocktail of protease inhibitors (Roche Diagnostica, Mannheim, Germany). The homogenate was briefly sonicated and centrifuged at 14,000 g for 30 minutes at 4°C. The obtained pellet was resuspended in 500 µl of 10 mM Tris-HCl pH 7.4, 1 mM EDTA, a cocktail of protease inhibitors (Roche Diagnostica, Mannheim, Germany) and then subjected to SDS-PAGE and immunoblotting.

Western blotting
The homogenates were suspended in Laemmli sample buffer, resolved by 10% SDS-PAGE under reducing conditions and transferred onto PVDF membrane. The transferred proteins were blocked in 20 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.1% Tween 20, 5% milk and then incubated with the appropriate primary antibodies. Immunoreactive bands were revealed by enhanced chemiluminescence (Pierce, Lausanne, Switzerland) using horseradish peroxidase coupled secondary antibodies.

Immunofluorescence microscopy
INS-1E and primary pancreatic endocrine cells were cultured on glass coverslips coated with poly-ornithine (Sigma). Subconfluent monolayers were rinsed twice with PBS, fixed for 10 minutes in a 4% para-formaldehyde-PBS solution and permeabilized for 1 hour in PBS containing 0.1% saponin and 0.5% BSA. The cells were then incubated with primary antibodies overnight at 4°C. After rinsing with PBS, the cells were exposed to secondary antibodies for 1 hour at room temperature. Coverslips were mounted on glass slides with Vectastain (Reactolab, Lausanne, Switzerland). Samples were analysed using a Zeiss laser confocal microscope (LSM 510, Zurich, Switzerland). Images were taken with a 60x objective.

Subcellular fractionation of INS-1E cells
Subcellular fractionation of approximately 108 INS-1E cells was performed as described previously (Regazzi et al., 1996Go). Briefly, INS-1E cells were homogenized by nitrogen cavitation (9 bars for 30 minutes) in a solution containing 5 mM HEPES pH 7.4, 1 mM EGTA, 10 µg/ml leupeptin and 2 µg/ml aprotinin. The cell debris and the nuclei were eliminated by centrifuging the homogenate for 10 minutes at 3000 g. The obtained postnuclear supernatant was loaded on a continuous sucrose density gradient (0.45-2 M sucrose; 8 ml). After centrifugation for 18 hours at 110,000 g, 16 fractions of 0.5 ml were collected from the top of the tube. The concentration of sucrose in the fractions was determined by measuring the refractive index of the solution. The amount of insulin present in the fractions was measured by RIA. The distribution, throughout the gradient, of plasma membrane (Na+/K+-ATPase), synaptic-like microvesicles (synaptophysin) and insulin-containing secretory granules (carboxypeptidase H) was assessed by western blotting.

Reverse transcription and PCR amplification of Syt IX cDNA
Total RNA was extracted from rat brain, rat islets and INS-1E cells by the use of TRIzolTM Reagent (Gibco Life Sciences, Basel, Switzerland). cDNA was synthesized for 45 minutes at 48°C followed by 2 minutes at 94°C using AMV reverse transcriptase (Promega, Catalys AG, Walisellen, Switzerland). The primers used for reverse transcription and PCR amplification of cDNAs were: 5' CAGGATCCTTCCCGGAACCCCCGACC 3' (sense strand, positions 128-145 of Syt IX cDNA sequence) and 5' TCATAATCCAGTGAATACTG 3' (reverse strand, positions 460-480 of Syt IX cDNA sequence). The PCR program involved 40 cycles of denaturation at 94°C for 30 seconds, annealing at 60°C for 1 minute and elongation at 68°C for 2 minutes. A final elongation step of 7 minutes at 68°C allowed the truncated product to extend to full length. PCR reactions were performed using Tfl DNA polymerase (Promega, Catalys AG, Walisellen, Switzerland). Control experiments showed that amplification products were absent after reactions omitting reverse transcriptase.

Construction of myc-tagged Syt IX cDNA
The Syt IX cDNA was amplified by PCR using the following primers: 5' CAG GATCCTTCCCGGAACCCCCGACC 3' and 5' GCGAATTCAATCAGGGTG CAGGTATTGG 3' and then cloned in the pGEM® -T Easy Vector (Promega, Catalys AG, Walisellen, Switzerland). The DNA fragment was next purified by agarose gel electrophoresis and ligated into BamHI/NotI sites of the pcDNA3 vector (Invitrogen, San Diego, CA) in frame with the N-terminal myc epitope. The construct was verified by DNA sequencing.

Generation of Syt V and Syt IX silencing vectors
Mammalian expression vectors directing the synthesis of small interfering RNAs targeted against Syt V and Syt IX were prepared according to Ambion's guidelines (Huntingdon, Cambridgeshire, UK). Briefly, using the `siRNA Target Finder and Design Tool' web page, the mRNA sequence of each protein was scanned for AA dinucleotides and recorded for the 19 nucleotides downstream of the AA. The potential siRNA target sequence was then compared with the genome database to eliminate any sequences with significant homology to other genes. On the basis of the chosen target transcript, two complementary DNA fragments encoding a 19-nucleotide sequence and separated from its reverse 19-nucleotide complement by a short spacer were synthesized by Microsynth (Balgach, Switzerland). The two complementary DNA fragments were annealed and cloned into EcoRI/ApaI sites of the pSilencerTM 1.0-U6 siRNA Expression Vector (Ambion) The Syt V silencer was generated using the sequence corresponding to nucleotides 94-112 of rat Syt V cDNA; the Syt IX silencer was constructed using the nucleotide sequence 158-176 of rat Syt IX cDNA.

Cell transfection
Transient transfection of INS-1E cells was performed using the Lipofectamine 2000 reagent (Invitrogen, Groningen, Switzerland), according to the manufacturer's instructions. In all the experiments the DNA/Lipofectamine ratio was 1/2.

Secretion from transfected INS-1E cells
INS-1E cells were transiently cotransfected with a plasmid encoding human growth hormone (hGH) as a reporter for secretion, and with plasmids containing either the RNAi silencers or the cDNAs expression constructs. Three days after transfection the cells were incubated at 37°C for 2 hours in complete medium without glucose. They were preincubated for 30 minutes in modified Krebs-Ringer-Bicarbonate buffer (KRB) (Regazzi et al., 1996Go) containing 2.5 mM glucose and then incubated during 30 minutes either in the same buffer (basal conditions), or in KRB supplemented with either 15 mM glucose or 100 nM PMA (stimulated conditions). After incubation, secretion from transfected cells was assessed by measuring the amount of hGH released into the medium during the incubation period by enzyme-linked immunoabsorbent assay (ELISA) (Roche, Diagnostica, Mannheim, Germany).

Statistical analysis
Results are presented as mean±s.e.m. from experiments performed independently on at least three different cell preparations.


    Results
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of Syt V and Syt IX in insulin-secreting cells
Our group has previously shown that Syt V is expressed at the RNA level in various insulin-secreting cell lines and primary islet cells (Gut et al., 2001Go). We next investigated the presence of Syt IX mRNA in the insulin-secreting cell line INS-1E, rat pancreatic islets and rat brain. The latter was used as a positive control. Fig. 1A shows that RT-PCR reactions with primers corresponding to the N-terminal region of Syt IX yielded a product of the predicted size of 353 bp. Sequencing of the amplicons confirmed that INS-1E cells and primary pancreatic endocrine cells express Syt IX mRNA. Subsequently, we analysed the expression of Syt V and Syt IX in insulin-secreting cells at the protein level. Homogenates of INS-1E cells, rat pancreatic islets and rat brain (used as a positive control) were resolved by SDS-PAGE and the proteins were detected with antibodies directed against Syt V or Syt IX. Western blotting (Fig. 1B) revealed that Syt V migrates at ~70 kDa and is present at a similar level in all three homogenates. The Syt IX protein with a Mr of ~50 kDa is expressed in comparable quantities in rat brain and INS-1E cells, being less abundant in rat pancreatic islets.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 1. Expression of Syt V and Syt IX in insulin-secreting cells. (A) PCR amplification of Syt IX cDNA from rat brain, INS-1E cells and rat islets. PCR reactions in which reverse transcriptase was omitted are shown by (–). The DNA size markers (bp) are also indicated. (B) Homogenates (100 µg) of rat brain, INS-1E cells and rat islets were separated by SDS-PAGE and subjected to immunoblotting with anti-Syt V or anti-Syt IX antibodies.

 

Subcellular distribution of Syt V and Syt IX in insulin-secreting cells
To determine the subcellular localization of Syt V, INS-1E cells were immunostained and analysed by confocal microscopy. Double labelling experiments showed that Syt V perfectly colocalizes with insulin-containing secretory granules (Fig. 2A). Additional immunofluorescence studies performed in cultured primary pancreatic endocrine cells revealed that Syt V was not expressed in the ß-cells but was present in the glucagon-containing islet {alpha}-cells. (Fig. 2B).



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2. Immunolabelling of Syt V in the INS-1E clone and pancreatic islet cells. INS-1E cells (A) and pancreatic endocrine cells (B) were analysed by confocal microscopy after double immunofluorescence with an antibody against insulin or glucagon (revealed using fluorescein-conjugated antibody) and with the anti-Syt V (detected using rhodamine-conjugated antibody). The overlapping images were obtained after superposition of the green and red channels.

 

The intracellular distribution of Syt IX in INS-1E cells and native ß-cells was also analysed by confocal microscopy. The overlapping images in Fig. 3 show that Syt IX colocalizes with the insulin-containing granules in both INS-1E and primary ß-cells.



View larger version (67K):
[in this window]
[in a new window]
 
Fig. 3. Intracellular localization of Syt IX in insulin-secreting cells. INS-1E cells and pancreatic ß-cells were double labelled with an antibody against insulin (revealed by FITC-conjugated antibody) together with the anti-Syt IX (detected by rhodamine-conjugated antibody). Images were obtained by confocal microscopy. The upper panels show the localization of insulin, the middle panels the position of Syt IX and the lower panels the superposition of the green and red channels.

 

To further characterize the association of Syt V and Syt IX with insulin-containing granules, we performed subcellular fractionation by continuous sucrose density gradient (0.45-2 M) (Reetz et al., 1991Go; Regazzi et al., 1996Go). INS-1E cells contain a large number of secretory granules and are therefore appropriate for this type of biochemical characterization. As illustrated in the top panel of Fig. 4, when homogenates of INS-1E cells are centrifuged at equilibrium, insulin-containing granules are recovered in the fractions 11-17 corresponding to 1.4-1.8 M sucrose. The lower panels in Fig. 4 show that the plasma membrane marker Na+/K+-ATPase was detected in fractions 9-13; synaptophysin, a marker of GABA-containing synaptic-like microvesicles, was found in fractions 7-10, while carboxypeptidase H, a resident protein in the insulin-granule, was concentrated in fractions 11-17. Finally, Syt V and Syt IX were also enriched in fractions 11-17, consistent with an association with insulin-containing secretory granules. These results confirm the data obtained by immunofluorescence experiments.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 4. Subcellular fractionation of Syt V and Syt IX in INS-1E cells. Subcellular fractions of INS-1E cells were obtained using the sucrose density gradient described in Materials and Methods. Aliquots of each fraction of the gradient were analysed by western blotting using antibodies directed against Na+/K+-ATPase, synaptophysin (SVP38), carboxypeptidase H (CPH), Syt V and Syt IX. Sucrose concentration was calculated from the refractive index of the fractions. The top panel shows the amount of insulin present in the fractions corresponding to the distribution of insulin-containing secretory granules.

 

The intracellular localization of Syt V and Syt IX was also investigated after transient transfection of INS-1E cells. To monitor the expression of the transfected proteins, a myc epitope was inserted at the amino terminus of each Syt isoform. Immunolabelling followed by confocal microscopy analysis revealed that the myc-tagged Syt V and Syt IX proteins colocalize with insulin-containing granules (Fig. 5A,B, upper images), confirming the data obtained with the sucrose gradient. When the expression of the Syt proteins was further increased (2 µg, not shown; 5 µg, Fig. 5A,B, lower images), the Syts distributed with insulin to plasma membrane-near regions in a dose-dependent manner. Similar localization has also been reported for secretory granules in nontransfected INS-1E cells (Waselle et al., 2003Go). Taken together, these results are consistent with the findings that both endogenous and extrinsic Syt V and Syt IX are associated with insulin-containing granules.



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 5. Concentration-dependent localization of Syt V and Syt IX after their overexpression in INS-1E cells. INS-1E cells were transiently transfected with 1 µg and 5 µg of cDNAs encoding myc-tagged Syt V (A) or myc-tagged Syt IX (B). Two days later, the cells were double stained with antibodies directed against insulin (revealed by FITC-conjugated antibody) and against the myc-epitope (detected by rhodamine-conjugated antibody). Images were obtained by confocal microscopy. Yellow images correspond to the overlay of the anti-insulin and anti-myc signals.

 

Functional role of Syt V and Syt IX in insulin exocytosis
To study the potential involvement of Syt V and Syt IX in insulin exocytosis, these proteins were overexpressed in INS-1E cells. Syt V or Syt IX was transiently cotransfected with a plasmid encoding human growth hormone (hGH). hGH is targeted to insulin-containing granules and can be used to monitor exocytosis as an insulin substitute in the subpopulation of transfected cells (Iezzi et al., 2000Go). Using this approach, we observed that an increase in the glucose concentration from 2.5 mM to 15 mM caused a 4.3-fold rise in hGH release (Fig. 6, lower panel). The overexpression of Syt V did not significantly affect basal secretion, whereas Syt IX slightly reduced it. Remarkably, exocytosis stimulated by glucose was not affected by the overexpression of the two Syts. Moreover, neither of the Syt constructs affected the hGH cellular content that ranged from 400-500 ng/ml. As estimated by immunoblotting compared with the endogenous protein, Syt V and Syt IX were overexpressed approximately fivefold (Fig. 6, upper panels). The two Syt isoforms were expressed at similar levels, as revealed by blotting the membranes with the anti-myc antibody. It should be noted that in Syt IX-overexpressing cells, the anti-Syt IX antibody recognizes both the larger and smaller forms of the protein (see Discussion).



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 6. Effect of Syt V and Syt IX overexpression on insulin exocytosis. INS-1E cells were transiently cotransfected with a plasmid encoding human growth hormone (hGH) and 1 µg of the control pcDNA3 (control), the Syt V or the Syt IX vectors. Two days later, the cells were incubated in the presence of 2.5 mM glucose (open bars) or with 15 mM glucose (filled bars) for 30 minutes. The cells were then collected and the expression of the exogenous proteins was analysed by western blotting using anti-Syt V or anti-Syt IX antibodies (top panels). The same membranes were also blotted with an anti-myc antibody. The positions of endogenous Syt V and Syt IX and their transfected myc-tagged counterparts (loaded on duplicates) are indicated by the arrows. After incubation the amount of hGH secreted by the cells was measured by ELISA. The lower panel shows the mean+s.e.m. of three independent experiments performed in triplicate.

 

Next, we directly investigated the functional implication of Syt V and Syt IX in insulin exocytosis. For this purpose, we generated a plasmid that directs the synthesis of small interfering RNAs (siRNAs) targeting the sequences of the two Syt isoforms. As illustrated in Fig. 7A, transient expression of the Syt V and Syt IX silencers in INS-1E cells selectively abolished the production of these proteins, but did not affect other endogenous unrelated proteins (Fig. 7A, arrow in b). To verify the silencing effect on the endogenous protein, INS-1E cells were transfected with GFP together with the Syt V or Syt IX silencers. Homogenates of FACS-enriched GFP-expressing cells were analysed by western blotting. Fig. 7B shows that Syt V silencer strongly reduced the amount of Syt V protein (panel a) but did not affect Syt IX (panel b); similarly Syt IX silencer almost completely eliminated the Syt IX protein (panel c) without changing the amount of Syt V (panel d). These results emphasize the selectivity of the designed Syt siRNAs.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 7. Selective decrease of Syt V and Syt IX expression by RNA interference. (A) INS-1E cells were transiently transfected with myc-tagged Syt V (a) or myc-tagged Syt IX (b). Silencing of the genes was determined by cotransfecting the cells either with an empty pSilencer vector (control) or with a pSilencer vector containing a sequence that directs the synthesis of Syt V-specific siRNA or Syt IX-specific siRNA (RNAi). Nontransfected cells are shown by (–). After three days the cells were homogenized and equal amounts of protein were analysed by western blotting using antibodies directed against Syt V or Syt IX. The same membrane was also blotted with an anti-myc antibody. The arrow indicates Syt IX unrelated proteins. (B) INS-1E cells were transiently cotransfected with GFP and with an empty vector (control) or with a vector containing either the Syt V or the Syt IX silencer sequences (RNAi). Three days later, GFP-expressing cells were enriched by FACS separation. The cells were then homogenized and the same amount of protein was separated by SDS-PAGE and immunoblotted with anti-Syt V (a) or anti-Syt IX (c) antibodies. The membranes (a) and (c) were then blotted respectively with anti-Syt IX (b) and anti-Syt V (d) antibodies.

 

The efficacy of the two silencers was further verified by immunofluorescence studies. Transfected cells identified by the expression of GFP were found to contain low levels of Syt V (Fig. 8A) and Syt IX (Fig. 8B), confirming the silencing of the given endogenous protein.



View larger version (79K):
[in this window]
[in a new window]
 
Fig. 8. Immunolabelling of Syt V and Syt IX suppression by RNAi in INS-1E cells. INS-1E cells were transiently transfected with GFP together with the Syt V silencer (A) or with the Syt IX silencer (B). After three days the cells were fixed and analysed by immunofluorescence with the antibodies against Syt V or Syt IX. Transfected cells were identified using GFP fluorescence. The arrows indicate the position of transiently transfected cells expressing the silencer.

 

Finally, INS-1E cells were transfected with the hGH together with Syt V or Syt IX silencers. Selective knockdown of Syt proteins by RNA interference did not alter basal secretion. When hormone secretion was stimulated by 15 mM glucose, there was strong inhibition reaching 79% and 74% for Syt V and Syt IX, respectively (Fig. 9, upper panel). To distinguish whether the inhibitory effects of the silencers are exerted on Ca2+-dependent or -independent exocytosis, the experiments were repeated in the presence of the phorbol ester PMA. This compound acts by potentiating insulin exocytosis distal to the increase in cytosolic Ca2+ (Regazzi et al., 1989Go). A decrease in Syt V or Syt IX expression neither affected basal nor the marked potentation of exocytosis (fourfold relative to 15 mM glucose alone) in the presence of PMA (Fig. 9, lower panel). Again, the silencers did not change the cellular content of hGH (not shown).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 9. Effect of Syt V and Syt IX silencing on hormone secretion in INS-1E cells. INS-1E cells were transiently cotransfected with a plasmid encoding hGH and with the empty vector (control) or with either the Syt V-specific siRNA (RNAi Syt V) or the Syt IX-specific siRNA (RNAi Syt IX). Three days later, the cells were incubated for 30 minutes with 2.5 mM glucose (open bars) or stimulated with 15 mM glucose (filled bars). The experiments depicted in the lower panel were performed in the presence of 100 nM PMA. The amount of hGH released during the incubation period was determined by ELISA. The results correspond to the mean+s.e.m. of three independent experiments performed in triplicate.

 


    Discussion
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, we show that both INS-1E and native ß-cells express Syt IX. These findings extend our previous work indicating that these cells also contain the Syt III-VIII isoforms (Gut et al., 2001Go). Syt IX was originally cloned from both human and rat cDNAs and named Syt V (Craxton and Goedert, 1995Go; Hudson and Birnbaum, 1995Go), although it was completely different in sequence from a rat cDNA, which was also termed Syt V (Li et al., 1995Go). Subsequently, two cDNAs were cloned from mouse, one of which was highly homologous to the human Syt V cDNA, and it was thus named Syt IX (Fukuda et al., 1999Go). Therefore, the given human, rat and mouse sequences are referred to as Syt IX (Craxton and Goedert, 1995Go; Hudson and Birnbaum, 1995Go), whereas the rat and mouse sequences remain Syt V (Li et al., 1995Go; Fukuda et al., 1999Go).

Our data prove that Syt V (~70 kDa) is expressed at the protein level in rat pancreatic islets and in the clonal ß-cell line INS-1E. These results are in accordance with the presence of Syt V mRNA in various insulinoma cell lines and in rat islets (Gut et al., 2001Go) and the protein level in mouse pancreatic islets (Saegusa et al., 2002Go). We assessed the subcellular distribution of Syt V by confocal microscopy and continuous sucrose density gradient in INS-1E cells. The latter method permits the separation of insulin-containing granules from synaptic-like microvesicles (Iezzi et al., 1999Go). Both approaches show that Syt V colocalizes with insulin-granules but is absent from synaptic-like microvesicles. This is consistent with the targeting of Syt V to dense-core vesicles but not to synaptic-like microvesicles in PC12 cells, and agrees with the location in mouse brain (Saegusa et al., 2002Go). Further immunofluorescence studies performed in rat pancreatic endocrine cells revealed that Syt V is expressed in the glucagon-secreting {alpha}-cells but not in ß-cells, confirming the data obtained in mouse pancreatic islets (Saegusa et al., 2002Go). Taken together, the fascinating observation that Syt V is associated with insulin-granules in INS-1E cells suggests a mixed {alpha}-ß cell phenotype that is more closely related to neurons than native ß-cells. The tumor origin of INS-1E cells may explain their islets progenitor cell phenotype (Asfari et al., 1992Go; Merglen et al., 2004Go). (N.B: mature rodent islet contains 70% ß-cells, 20% {alpha}-cells and 5% each of somatostatin and pancreatic-polypeptide cells.)

We next showed the presence of Syt IX mRNA in INS-1E cells and, albeit at moderate levels, in pancreatic endocrine cells. The lower abundance of Syt IX protein in the endocrine tissue was confirmed by immunoblotting experiments. Syt IX was also detected in the hamster ß-cell line HIT-T15 cells (M.F., unpublished). Syt IX (~50 kDa) was also identified in INS-1E cells by the use of a rabbit polyclonal antibody directed against the C-terminal region of the protein. Moreover, the immunoreactive band of ~50 kDa was abolished when the immunizing peptide was included in the blotting solution (results not shown). These data strongly support the specificity of the Syt IX N-terminal monoclonal antibody used in this study. We also performed immunofluorescence and sucrose subcellular fractionation experiments showing that Syt IX is associated with insulin-granules but not with synaptic-like microvesicles in both INS-1E and native ß-cells. Similarly, immunocytochemical studies showed the presence of Syt IX on dense-core vesicles in nerve growth factor-differentiated PC12 cells (Fukuda et al., 2002aGo). The participation of Syt IX in insulin-containing granule secretion may be more important than that of Syt I and II, which are also associated with synaptic like microvesicles (Lang et al., 1997Go).

Further immunofluorescence experiments on overexpressed myc-tagged Syt V and Syt IX in INS-1E cells confirm the association of the Syt proteins with insulin-granules. As shown by immunoblotting, the specificity of Syt V and Syt IX antibodies was further confirmed by overexpressing the recombinant Syts in INS-IE (Fig. 6, upper panels) and COS-7 cells (data not shown). In particular, in Syt IX-overexpressing cells, the anti-Syt IX antibody recognizes two forms of the protein that could represent post-translational modifications (e.g. palmitoylation and O-glycosylation), which may affect Syt size and immunoreactivity. Similar results were recently obtained in Syt IX-overexpressing rat basophilic leukaemia (RBL) cells (Haberman et al., 20003). Our previous study reported that transient expression of Syt II did not alter exocytosis in HIT-T15 cells (Lang et al., 1997Go). Likewise, the overexpressed Syt V and Syt IX had no effect on stimulated insulin secretion in INS-1E cells. This indicates that the Syt proteins are not interfering with the stoichiometry of the SNARE proteins whose overexpression inhibits insulin exocytosis (Nagamatsu et al., 1999Go). By contrast, stable clones expressing Syt III and VII showed enhanced Ca2+-induced insulin secretion in RINm5F ß-cells (Gao et al., 2000Go). However, the long-term expression of the proteins may affect other components of the secretory pathway. For this reason it is more attractive to suppress a given protein to elucidate its function.

In a recent study RNAi was initiated in insulin-secreting cells and efficiently employed to investigate ß-cell function (Waselle et al., 2003Go). Here, we also used the RNAi approach to directly analyse the role of Syt V and Syt IX in insulin exocytosis. Silencing of each of the Syts in INS-1E cells did not affect basal secretion but decreased the glucose-induced insulin release. Therefore, it seems that the inhibition is caused by impairment of the exocytotic process rather than by interference with granule transport or endocytic events (Haberman et al., 2003Go). The strong attenuation of hormone release suggests that Syt V and Syt IX act as positive modulators of exocytosis. This effect is remarkably selective for the Ca2+-dependent release, as PMA-induced secretion was unchanged (Lang, 1999Go). As deficiency of both Syt V and Syt IX inhibits Ca2+-dependent exocytosis, it is possible that this process requires the formation of oligomeric complexes, implicating several Syt isforms in agreement with previous studies (Sudhof, 2002Go; Fukuda et al., 1999Go; Fukuda et al., 2002bGo). By contrast, PMA may not require such oligomerization, as it can stimulate insulin exocytosis in the complete absence of Ca2+ (Vallar et al., 1987Go). The exact mode of action of PMA on exocytosis is unclear. The compound not only activates protein kinase C but also interacts with Munc 13-1 (Brose and Rosenmund, 2002Go), which participates in the regulation of insulin exocytosis (Sheu et al., 2003Go).

In conclusion, our data show that Syt V and Syt IX are localized on insulin-containing granules and directly control Ca2+-mediated insulin exocytosis. In the endocrine pancreas Syt V and Syt IX segregate respectively to {alpha}- and ß-cell granules. This suggests that Syt IX may be the Ca2+ sensor for insulin secretion in the ß-cell. Verification of this hypothesis requires specific suppression of Syt IX in islets.


    Acknowledgments
 
We are grateful to S. Mouche for technical assistance. We should like to thank M. Birnbaum (University of Pennsylvania, Philadelphia, PA) for providing a rabbit polyclonal antibody against Syt IX. We are indebted to B. Gauthier and to R. Regazzi for stimulating discussions. This work was supported by the Swiss National Science Foundation Grant (32-66907.01) (C.B.W.), the Human Frontiers of Science Program (RG-197/98) and a generous donation from Mr Hubertus Spierings (Geneva, Switzerland) through the Fondation de Recherche Médicale.


    References
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

Asfari, M., Janjic, D., Meda, P., Li, G., Halban, P. A. and Wollheim, C. B. (1992). Establishment of 2-mercaptoethanol-dependent differentiated insulin-secreting cell lines. Endocrinology 130, 167-178.[Abstract/Free Full Text]

Brose, N. and Rosenmund, C. (2002). Move over protein kinase C, you've got company: alternative cellular effectors of diacylglycerol and phorbol esters. J. Cell Sci. 115, 4399-4411.[Abstract/Free Full Text]

Brown, H., Meister, B., Deeney, J., Corkey, B. E., Yang, S. N., Larsson, O., Rhodes, C. J., Seino, S., Berggren, P. O. and Fried, G. (2000). Synaptotagmin III isoform is compartmentalized in pancreatic beta-cells and has a functional role in exocytosis. Diabetes 49, 383-391.[Abstract]

Burgoyne, R. D. and Morgan, A. (2003). Secretory granule exocytosis. Physiol. Rev. 83, 581-632.[Abstract/Free Full Text]

Chapman, E. R. (2002). Synaptotagmin a Ca2+ sensor that triggers exocytosis? Nat. Rev. Mol. Cell Biol. 3, 498-508.[CrossRef][Medline]

Craxton, M. and Goedert, M. (1995). Synaptotagmin V: a novel synaptotagmin isoform expressed in rat brain. FEBS Lett. 361, 196-200.[CrossRef][Medline]

Fukuda, M., Kanno, E. and Mikoshiba, K. (1999). Conserved N-terminal cysteine motif is essential for homo- and heterodimer formation of synaptotagmins III, V, VI, and X. J. Biol. Chem. 274, 31421-31427.[Abstract/Free Full Text]

Fukuda, M., Kowalchyk, J. A., Zhang, X., Martin, T. F. and Mikoshiba, K. (2002a). Synaptotagmin IX regulates Ca2+-dependent secretion in PC12 cells. J. Biol. Chem. 277, 4601-4604.[Abstract/Free Full Text]

Fukuda. M., Katayama, E. and Mikoshiba, K. (2002b). The calcium-binding loops of the tandem C2 domains of synaptotagmin VII cooperatively mediate calcium-dependent oligomerization. J. Biol. Chem. 277, 29315-29320.[Abstract/Free Full Text]

Gao, Z., Reavey-Cantwell, J., Young, R. A., Jegier, P. and Wolf, B. A. (2000). Synaptotagmin III/VII isoforms mediate Ca2+-induced insulin secretion in pancreatic islet ß-cells. J. Biol. Chem. 275, 36079-36085.[Abstract/Free Full Text]

Geppert, M., Goda, Y., Hammer, R. E., Li, C., Rosahl, T. W., Stevens, C. F. and Südhof, T. C. (1994). Synaptotagmin I: a major Ca2+ sensor for transmitter release at a central synapse. Cell 79, 717-727.[CrossRef][Medline]

Gut, A., Kiraly, C. E., Fukuda, M., Mikoshiba, K., Wollheim, C. B. and Lang, J. (2001). Expression and localisation of synaptotagmin isoforms in endocrine beta-cells: their function in insulin exocytosis. J. Cell Sci. 114, 1709-1716.[Abstract]

Haberman, Y., Grimberg, E., Fukuda, M. and Sagi-Eisenberg, R. (2003). Synaptotagmin IX, a possible linker between the perinuclear endocytic recycling compartment and the microtubules. J. Cell Sci. 116, 4307-4318.[Abstract/Free Full Text]

Hudson, A. W. and Birnbaum, M. J. (1995). Identification of a nonneuronal isoform of synaptotagmin. Proc. Natl. Acad. Sci. USA 92, 5895-5899.[Abstract/Free Full Text]

Iezzi, M., Escher, G., Meda, P., Charollais, A., Baldini, G., Darchen, F., Wollheim C. B. and Regazzi, R. (1999). Subcellular distribution and function of Rab3A, B, C, and D isoforms in insulin-secreting cells. Mol. Endocrinol. 13, 202-212.[Abstract/Free Full Text]

Iezzi, M., Regazzi, R. and Wollheim, C. B. (2000). The Rab3-interacting molecule RIM is expressed in pancreatic beta-cells and is implicated in insulin exocytosis. FEBS Lett. 26, 66-70.

Lang, J. (1999). Molecular mechanisms and regulation of insulin exocytosis as a paradigm of endocrine secretion. Eur. J. Biochem. 259, 3-17.[Medline]

Lang, J., Fukuda, M., Zhang, H., Mikoshiba, K. and Wollheim, C. B. (1997). The first C2 domain of synaptotagmin is required for exocytosis of insulin from pancreatic ß-cells: action of synaptotagmin at low micromolar calcium. EMBO J. 16, 5837-5846.[CrossRef][Medline]

Li, C., Ullrich, B., Zhang, J. Z., Anderson, R. G., Brose, N. and Sudhof, T. C. (1995). Ca(2+)-dependent and -independent activities of neural and non-neural synaptotagmins. Nature 375, 594-599.[CrossRef][Medline]

Merglen, A., Theander, S., Rubi, B., Chaffard, G., Wollheim, C. B. and Maechler, P. (2004). Glucose sensitivity and metabolism-secretion coupling studied during two-year continuous culture in INS-1E insulinoma cells. Endocrinology 145(2), 667-678.

Mizuta, M., Inagaki, N., Nemoto, Y., Matsukura, S., Takahashi, M. and Seino, S. (1994). Synaptotagmin III is a novel isoform of rat synaptotagmin expressed in endocrine and neuronal cells. J. Biol. Chem. 269, 11675-11678.[Abstract/Free Full Text]

Mizuta, M., Kurose, T., Miki, T., Shoji-Kasai, Y., Takahashi, M., Seino, S. and Matsukura, S. (1997). Localization and functional role of synaptotagmin III in insulin secretory vesicles in pancreatic ß-cells. Diabetes 46, 2002-2006.[Abstract]

Nagamatsu, S., Nakamichi, Y., Yamamura, C., Matsushima, S., Watanabe, T., Ozawa, S., Furukawa, H. and Ishida, H. (1999). Decreased expression of t-SNARE, syntaxin 1, and SNAP-25 in pancreatic ß-cells is involved in impaired insulin secretion from diabetic GK rat islets: restoration of decreased t-SNARE proteins improves impaired insulin secretion. Diabetes 48, 2367-2373.[Abstract]

Pralong, W. F., Bartley, C. and Wollheim, C. B. (1990). Single islet beta-cell stimulation by nutrients: relationship between pyridine nucleotides, cytosolic Ca2+ and secretion. EMBO J. 9, 53-60.[Medline]

Reetz, A., Solimena, M., Matteoli, M., Folli, F., Takei, K. and de Camilli, P. (1991). GABA and pancreatic beta-cells: colocalization of glutamic acid decarboxylase (GAD) and GABA with synaptic-like microvesicles suggests their role in GABA storage and secretion. EMBO J. 10, 1275-1284.[Medline]

Regazzi, R., Li, G., Ullrich, S., Jaggi, C. and Wollheim, C. B. (1989). Different requirements for protein kinase C activation and Ca2+-independent insulin secretion in response to guanine nucleotides. Endogenously generated diacylglycerol requires elevated Ca2+ for kinase C insertion into membranes. J. Biol. Chem. 15, 9939-9944.

Regazzi, R., Ravazzola, M., Iezzi, M., Lang, J., Zahraoui, A., Andereggen, E., Morel, P., Takai, Y. and Wollheim, C. B. (1996). Expression, localization and functional role of small GTPases of the Rab3 family in insulin-secreting cells. J. Cell Sci. 109, 2265-2273.[Abstract]

Rickman, C., Craxton, M., Osborne, S. and Davletov B. (2004). Comparative analysis of tandem C2 domains from the mammalian synaptotagmin family. Biochem. J. 378, 681-686.[CrossRef][Medline]

Rorsman, P. and Renstrom, E. (2003). Insulin granule dynamics in pancreatic beta cells. Diabetologia 46, 29-45.

Rouiller, D. G., Cirulli, V. and Halban, P. A. (1991). Uvomorulin mediates calcium-dependent aggregation of islet cells, whereas calcium-independent cell adhesion molecules distinguish between islet cell types. Dev. Biol. 148, 233-242.[CrossRef][Medline]

Saegusa, C., Fukuda, M. and Mikoshiba, K. (2002). Synaptotagmin V is targeted to dense-core vesicles that undergo calcium-dependent exocytosis in PC12 cells. J. Biol. Chem. 277, 24499-24505.[Abstract/Free Full Text]

Sheu, L., Pasyk, E. A., Ji, J., Huang, X., Gao, X., Varoqueaux, F., Brose, N. and Gaisano, H. Y. (2003). Regulation of insulin exocytosis by Munc13-1. J. Biol. Chem. 278, 27556-27563.[Abstract/Free Full Text]

Südhof, T. C. (2002). Synaptotagmins: why so many? J. Biol. Chem. 277, 7629-7632.[Free Full Text]

Südhof, T. C. and Rizo, J. (1996). Synaptotagmins: C2-domain proteins that regulate membrane traffic. Neuron 17, 379-388.[CrossRef][Medline]

Vallar, L., Biden, T. J. and Wollheim, C. B. (1987). Guanine nucleotides induce Ca2+-independent insulin secretion from permeabilized RINm5F cells. J. Biol. Chem. 262, 5049-5056.[Abstract/Free Full Text]

Waselle, L., Coppola, T., Fukuda, M., Iezzi, M., El-Amraoui, A., Petit, C. and Regazzi, R. (2003). Involvement of the Rab27 binding protein Slac2c/MyRIP in insulin exocytosis. Mol. Biol. Cell 14, 4103-4113.[Abstract/Free Full Text]

Wollheim, C. B. and Maechler, P. (2002). Beta-cell mitochondria and insulin secretion: messenger role of nucleotides and metabolites. Diabetes 51, 37-42.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
M. J. Tuvim, A. R. Mospan, K. A. Burns, M. Chua, P. J. Mohler, E. Melicoff, R. Adachi, Z. Ammar-Aouchiche, C. W. Davis, and B. F. Dickey
Synaptotagmin 2 Couples Mucin Granule Exocytosis to Ca2+ Signaling from Endoplasmic Reticulum
J. Biol. Chem., April 10, 2009; 284(15): 9781 - 9787.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
B. R. Gauthier and C. B. Wollheim
Synaptotagmins bind calcium to release insulin
Am J Physiol Endocrinol Metab, December 1, 2008; 295(6): E1279 - E1286.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K.-S. Park, A. Wiederkehr, C. Kirkpatrick, Y. Mattenberger, J.-C. Martinou, P. Marchetti, N. Demaurex, and C. B. Wollheim
Selective Actions of Mitochondrial Fission/Fusion Genes on Metabolism-Secretion Coupling in Insulin-releasing Cells
J. Biol. Chem., November 28, 2008; 283(48): 33347 - 33356.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. F. Vinet, M. Fukuda, and A. Descoteaux
The Exocytosis Regulator Synaptotagmin V Controls Phagocytosis in Macrophages
J. Immunol., October 15, 2008; 181(8): 5289 - 5295.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
L. Eliasson, F. Abdulkader, M. Braun, J. Galvanovskis, M. B. Hoppa, and P. Rorsman
Novel aspects of the molecular mechanisms controlling insulin secretion
J. Physiol., July 15, 2008; 586(14): 3313 - 3324.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. Gustavsson, Y. Lao, A. Maximov, J.-C. Chuang, E. Kostromina, J. J. Repa, C. Li, G. K. Radda, T. C. Sudhof, and W. Han
Impaired insulin secretion and glucose intolerance in synaptotagmin-7 null mutant mice
PNAS, March 11, 2008; 105(10): 3992 - 3997.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
B. R. Gauthier, D. L. Duhamel, M. Iezzi, S. Theander, F. Saltel, M. Fukuda, B. Wehrle-Haller, and C. B. Wollheim
Synaptotagmin VII splice variants {alpha}, , and {delta} are expressed in pancreatic -cells and regulate insulin exocytosis
FASEB J, January 1, 2008; 22(1): 194 - 206.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
T. Rose, S. Efendic, and M. Rupnik
Ca2+-Secretion Coupling Is Impaired in Diabetic Goto Kakizaki rats
J. Gen. Physiol., June 1, 2007; 129(6): 493 - 508.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
Y. Brunner, Y. Coute, M. Iezzi, M. Foti, M. Fukuda, D. F. Hochstrasser, C. B. Wollheim, and J.-C. Sanchez
Proteomics Analysis of Insulin Secretory Granules
Mol. Cell. Proteomics, June 1, 2007; 6(6): 1007 - 1017.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Dubois, P. Vacher, B. Roger, D. Huyghe, B. Vandewalle, J. Kerr-Conte, F. Pattou, N. Moustaid-Moussa, and J. Lang
Glucotoxicity Inhibits Late Steps of Insulin Exocytosis
Endocrinology, April 1, 2007; 148(4): 1605 - 1614.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
K. L. Lynch and T. F. J. Martin
Synaptotagmins I and IX function redundantly in regulated exocytosis but not endocytosis in PC12 cells
J. Cell Sci., February 15, 2007; 120(4): 617 - 627.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
J. Gromada, I. Franklin, and C. B. Wollheim
{alpha}-Cells of the Endocrine Pancreas: 35 Years of Research but the Enigma Remains
Endocr. Rev., February 1, 2007; 28(1): 84 - 116.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
L. E. Parton, P. J. McMillen, Y. Shen, E. Docherty, E. Sharpe, F. Diraison, C. P. Briscoe, and G. A. Rutter
Limited role for SREBP-1c in defective glucose-induced insulin secretion from Zucker diabetic fatty rat islets: a functional and gene profiling analysis
Am J Physiol Endocrinol Metab, November 1, 2006; 291(5): E982 - E994.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
E. Aganna, J. M Burrin, G. A Hitman, and M. D Turner
Involvement of calpain and synaptotagmin Ca2+ sensors in hormone secretion from excitable endocrine cells.
J. Endocrinol., September 1, 2006; 190(3): R1 - R7.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
G. A. Rutter and E. V. Hill
Insulin Vesicle Release: Walk, Kiss, Pause ... Then Run
Physiology, June 1, 2006; 21(3): 189 - 196.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
A. S. Narang and R. I. Mahato
Biological and biomaterial approaches for improved islet transplantation.
Pharmacol. Rev., June 1, 2006; 58(2): 194 - 243.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. A. Antinozzi, A. Garcia-Diaz, C. Hu, and J. E. Rothman
Functional mapping of disease susceptibility loci using cell biology.
PNAS, March 7, 2006; 103(10): 3698 - 3703.
[Abstract] [Full Text] [PDF]


Home page
Phil Trans R Soc BHome page
P. E MacDonald, J. W Joseph, and P. Rorsman
Glucose-sensing mechanisms in pancreatic {beta}-cells
Phil Trans R Soc B, December 29, 2005; 360(1464): 2211 - 2225.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. Iezzi, S. Theander, R. Janz, C. Loze, and C. B. Wollheim
SV2A and SV2C are not vesicular Ca2+ transporters but control glucose-evoked granule recruitment
J. Cell Sci., December 1, 2005; 118(23): 5647 - 5660.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
S. Seino and T. Shibasaki
PKA-Dependent and PKA-Independent Pathways for cAMP-Regulated Exocytosis
Physiol Rev, October 1, 2005; 85(4): 1303 - 1342.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
Y. Haberman, I. Ziv, Y. Gorzalczany, M. Fukuda, and R. Sagi-Eisenberg
Classical protein kinase C(s) regulates targeting of synaptotagmin IX to the endocytic recycling compartment
J. Cell Sci., April 15, 2005; 118(8): 1641 - 1649.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Fukuda, E. Kanno, M. Satoh, C. Saegusa, and A. Yamamoto
Synaptotagmin VII Is Targeted to Dense-core Vesicles and Regulates Their Ca2+-dependent Exocytosis in PC12 Cells
J. Biol. Chem., December 10, 2004; 279(50): 52677 - 52684.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
S. Barg and P. Rorsman
Insulin Secretion: A High-affinity Ca2+ Sensor After All?
J. Gen. Physiol., November 29, 2004; 124(6): 623 - 625.
[Full Text] [PDF]


Home page
J BiochemHome page
M. Fukuda and A. Yamamoto
Effect of Forskolin on Synaptotagmin IV Protein Trafficking in PC12 Cells
J. Biochem., August 1, 2004; 136(2): 245 - 253.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jcs.01179v1
117/15/3119    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iezzi, M.
Right arrow Articles by Wollheim, C. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iezzi, M.
Right arrow Articles by Wollheim, C. B.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?