spacer gif spacer gif spacer gif spacer gif Propose a workshop for 2011 spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 17 August 2004
doi: 10.1242/jcs.01310


Journal of Cell Science 117, 4481-4494 (2004)
Published by The Company of Biologists 2004
This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jcs.01310v1
117/19/4481    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sigle, R. O.
Right arrow Articles by Carter, W. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sigle, R. O.
Right arrow Articles by Carter, W. G.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Research Article

Globular domains 4/5 of the laminin {alpha}3 chain mediate deposition of precursor laminin 5

Randy O. Sigle1, Susana G. Gil1, Mallar Bhattacharya2, Maureen C. Ryan1,*, Tai-Mei Yang1, Tod A. Brown1, Ariel Boutaud4, Yuko Miyashita2, John Olerud2 and William G. Carter1,3,{ddagger}

1 Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue, Seattle, WA 98109, USA
2 Department of Medicince (Dermatology), University of Washington, 1959 N.E. Pacific St, Seattle, WA 98195, USA
3 Department of Pathobiology, University of Washington, 1959 N.E. Pacific St, Seattle, WA 98195, USA
4 BioStratum Incorporated, 4620 Creekstone Drive, Suite 200, Durham, NC 27703, USA

{ddagger} Author for correspondence (e-mail: wcarter{at}fhcrc.org)

Accepted 12 May 2004


    Summary
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In epidermal wounds, precursor laminin 5 ({alpha}3ß3{gamma}2) is deposited in the provisional basement membrane (PBM) before other BM components. Precursor laminin 5 contains G4/5 globular domains at the carboxyl terminus of the {alpha}3 chain. Here, the function of G4/5 was evaluated in deposition of laminin 5. Soluble laminin 5, secreted by keratinocytes in culture, is cleaved by an endogenous protease releasing G4/5. Thrombin, a serum protease, cleaves G4/5 indistinguishably from endogenous protease. Soluble human precursor laminin 5, but not cleaved laminin 5, was bound and deposited by mouse keratinocytes null for mouse {alpha}3 chain ({alpha}3–/– MKs). The deposition rescued adhesion and spreading and survival. In a model for PBM assembly, precursor laminin 5 was deposited along fibronectin fibrils at the junction between co-cultures of keratinocytes and fibroblasts. In both models, the deposition of precursor laminin 5 was inhibited by removal of G4/5 with thrombin. To confirm that G4/5 participates in deposition, the human LAMA3A gene was modified to produce {alpha}3 chains either without or with G4/5 that cannot be cleaved. Both precleaved and noncleavable {alpha}3 isoforms were expressed in {alpha}3–/– MKs, where they deposited sufficiently to rescue adhesion via integrins {alpha}3ß1 and {alpha}6ß4. Despite this similarity, noncleavable laminin 5 was at least threefold more efficiently deposited than precleaved isoform. We conclude that the G4/5 domain in the {alpha}3 chain facilitates deposition of precursor laminin 5 into the PBM in epidermal wounds.

Key words: Laminin 5, Adhesion, Basement membrane assembly, Extracellular matrix


    Introduction
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Wounding of quiescent epidermis generates leading migratory keratinocytes that deposit precursor laminin 5 (pre-lam5; {alpha}3ß3{gamma}2) in the provisional basement membrane (PBM) of the wound (Aumailley, 2003Go; Borradori and Sonnenberg, 1999Go; Lampe et al., 1998Go; Nguyen et al., 2000bGo). Pre-lam5 contains a 200 kDa form of the laminin {alpha}3 chain ({alpha}3200), encoded by the LAMA3 gene (Ryan et al., 1994Go) with globular domains G4 and G5 (G4/5) (Aumailley, 2003Go; Nguyen et al., 2000bGo). Subsequent to deposition on exposed dermis, keratinocytes adhere and migrate on pre-lam5 via integrins {alpha}3ß1 and/or {alpha}6ß4 and on dermal collagen and fibronectin via integrins {alpha}2ß1 and {alpha}5ß1, respectively (Carter et al., 1990Go; Carter et al., 1991Go; Goldfinger et al., 1999Go; Mercurio et al., 2001Go; Nguyen et al., 2000bGo). Recently, we evaluated the coupling between deposition of pre-lam5 and subsequent adhesion and migration (Frank and Carter, 2003Go). We showed that deposition of pre-lam5 at the rear of migrating cells established linear polarized `processive migration' in the absence of chemotactic gradients. Here, we extended these studies to evaluate the function of G4/5 in deposition of pre-lam5 that precedes and is necessary for adhesion and processive migration.

Little is known about the role of G4/5 in the deposition of pre-lam5 onto dermis in wounds. Further, the order and interdependence of intracellular trafficking, deposition verses secretion, integrin ligation, and proteolytic processing of G4/5 domain have not been resolved. For deposition to occur, endogenous or exogenous pre-lam5 may interact with a cell surface receptor(s) followed by interaction with and retention in the dermis. For example, pre-lam5 is deposited into the PBM before other components of the mature BM including laminins 10/11 ({alpha}5ß1{gamma}1/{alpha}5ß2{gamma}1), collagen types IV and VII, nidogen and perlecan (Kainulainen et al., 1998Go; Lampe et al., 1998Go; Nguyen et al., 2000bGo). In the absence of other components, the deposited pre-lam5 may interact with uncharacterized components of the dermis. It is unclear how pre-lam5 makes the transition from the cytoplasm to the cell surface to deposits at the rear of leading keratinocytes (Frank, 2003). Binding of laminin 1 ({alpha}1ß1{gamma}1) onto the surface of a `competent' cell is dependent on the G4/5 domain of the laminin {alpha}1 chain (Li et al., 2003Go; Li et al., 2002Go; Smirnov et al., 2002Go). G4/5 in precursor {alpha}3200 and soluble G4/5 bind heparin (Nguyen et al., 2000aGo) and as a result candidate receptors for cell surface binding of the precursor {alpha}3200 chain of lam5 include sulfate-containing syndecans (Okamoto et al., 2003Go; Utani et al., 2001Go), dystroglycans (Hohenester et al., 1999Go; Winder, 2001Go) and glycolipids (Hall et al., 1997Go; Taraboletti et al., 1990Go). Integrin {alpha}3ß1 was suggested to incorporate lam5 into its proper higher-order structure within the ECM of keratinocytes (deHart et al., 2003Go). Consistently, null defects in {alpha}3 (DiPersio et al., 1997Go) or ß1 integrins (Grose et al., 2002Go; Grose and Werner, 2003Go; Raghavan et al., 2003Go) alter localization of deposited lam5 and adhesion. Significantly, lam5 is still deposited despite these adhesion defects. Null mutations in syndecans 1 (Stepp et al., 2002Go) and 4 (Echtermeyer et al., 2001Go), or integrin {alpha}6 (Georges-Labouesse et al., 1996Go) or ß4 (Dowling et al., 1996Go; van der Neut et al., 1996Go) have no reported defects in lam5 deposition. Thus, receptors involved in adhesion to lam5 may be distinct from receptors involved in deposition of lam5. Significantly, inherited defects in the amino terminus of the {gamma}2 chain of lam5 inhibit assembly in the BM (Gagnoux-Palacios et al., 2001Go). This may explain why laminin 6 (lam6; {alpha}3ß1{gamma}1) that contains the integrin-binding {alpha}3200 chain, but not {gamma}2, fails to deposit and compensate for the adhesion defects in lam5 (Nakano et al., 2002Go).

Here, we evaluate the function of the G4/5 domain of the laminin {alpha}3200 chain in deposition of pre-lam5. As a definition for use here, endogenous cytoplasmic pre-lam5 can be either exported and deposited onto the substratum, termed deposition, or exported as a soluble protein, termed secretion. On the basis of three novel approaches, we conclude that the G4/5 domain contributes to efficient cell-mediated deposition of pre-lam5 onto a dermal equivalent.


    Materials and Methods
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cells, skin and wounds
Primary keratinocytes from normal human foreskins (HFKs) were grown as described previously (Boyce and Ham, 1985Go) in serum-free keratinocyte growth media (KGM; Clonetics, Corp., San Diego, CA). Keratinocytes from an individual with junctional epidermolysis bullosa gravis form (JEBG) (Nakano et al., 2002Go) were a gift from M. R. Pittelkow (Mayo Clinic College of Medicine, Rochester, MN) (Lim et al., 1996Go) and have homozygous null defect in the LAMB3 gene encoding the laminin ß3 chain. Mouse keratinocytes (MKs) from wild-type mice ({alpha}3+/+ MKs) or mice with homozygous null mutations in the LAMA3 gene ({alpha}3–/– MKs) were immortalized with E6 and E7 oncogenes from human papilloma virus. {alpha}3–/– MKs on collagen-coated culture dishes (rat tail collagen I, Becton-Dickinson) and {alpha}3+/+ MKs, were maintained in KGM containing 60 µM calcium. Fibroblasts from human foreskin (HFs) or mouse skin (MFs) were grown in RPMI +10% fetal bovine serum.

Procedures for skin wounds in mice were approved by the Fred Hutchinson Cancer Research Center Animal Care Committee and were executed as follows: mice (C57BL/Ks) were anesthetized and shaved. Full thickness punch biopsies were created on the dorsal surface of the mice. Mice were euthanized with IP injections of sodium pentobarbital at 7 and 14 days after wounding and wounds were harvested, embedded in OCT and cyrostat sectioned (6 µm).

Antibodies
Mouse monoclonal antibodies (Mabs) against human laminin ß3 chain (Mab A2'-2) and {alpha}3 chain (Mab P5H10), or rat Mabs against mouse lam5 (Mab P3C8) and against mouse and human ß4 integrin (Mab P4G11) were isolated in this lab. The anti-laminin {alpha}3 chain Mab (P5H10) immunoblots denatured or nondenatured precleaved or noncleavable {alpha}3 chain, and immunoprecipitates denatured or nondenatured precleaved or noncleavable {alpha}3 chain in laminin 5 and laminin 6. An antibody against laminin ß1 and {gamma}1 chains (rabbit polyclonal antibody R5922) was prepared against denatured ß1 and {gamma}1 chains and is able to immunoblot denatured ß1 or {gamma}1 chains and immunoprecipitate denatured or nondenatured ß1 or {gamma}1 chains in laminins 1 and 6. Mouse Mabs P1H5 (inhibitory anti-{alpha}2 integrin), P1B5 (inhibitory anti-{alpha}3 integrin), P4C10 (inhibitory anti-ß1 integrin), D3-4 (anti-human and mouse laminin {alpha}3), C2-5 (anti-human laminin {alpha}3), B4-6 (anti-human laminin {gamma}2), C2-9 (inhibitory anti-human laminin {alpha}3) and D2-1 (anti-human laminin {alpha}3 G4/5 domain) have been described (Gil et al., 1994Go; Gil et al., 2002Go; Wayner and Carter, 1987Go). R5808-f1, a rabbit Mab directed against a peptide sequence (n-EQVYLGLSPSRKSKSLP-c) from the G5 domains of mouse laminin {alpha}3 chain was developed in this lab in conjunction with Elizabeth Wayner in the FHCRC hybridoma facility. The Mab is specific for the 200 kDa mouse precursor laminin {alpha}3 chain and the 37 and 39 dDa G4/5 products released by proteolytic processing of the {alpha}3 chain. Goat anti-laminin ß3 chain antibodies are from Santa Cruz Inc. (Santa Cruz, CA). Rabbit polyclonal Ab against phosphorylated tyrosine residue 397 in focal adhesion kinase (FAKp-Y397) is from Bio-source (Hopkinton, MA).

Deposition of soluble human laminin 5 by {alpha}3–/– MKs and thrombin digestion
{alpha}3–/– MKs were attached to glass coverslips for 3 hours in KGM then blocked for 15 minutes with 0.5% heat-denatured BSA in PBS generating attached round cells. The cells were then cultured in a mixture of 50% fresh KGM, 50% KGM conditioned by HFKs or JEBG keratinocytes, and 0.025% BSA, for 24 hours. Alternatively, precursor laminin 5 in HFK-conditioned media was separated from cleaved laminin 5 by heparin chromatography (Nguyen et al., 2000aGo). Thrombin digestion was performed at 37°C for 1 hour with 1 NIH unit of thrombin/ml, after which 2 units/ml of hirudin were added to block further thrombin activity. Fixed and permeabilized cultures were examined for spreading by phase contrast, and for deposition of human laminin 5 by immunostaining with antibodies. The area covered by deposits was measured, using Metamorph software, by counting pixels with a signal intensity above a threshold value and dividing by the number of cells (nuclei) in the same field. Data in Fig. 4B is expressed as the deposit area/cell in the presence or absence of lam5.



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 4. Thrombin cleavage of G4/5 inhibits deposition of pre-lam5 by {alpha}3–/– MKs. {alpha}3–/– MKs attached to glass coverslips were incubated (overnight) with either culture media alone (A; a-c), media with heparin-purified lam5 (A; d-f) or heparin-purified lam5 that has been digested with thrombin (A; g-i). The coverslips were processed for immunofluorescence to visualize ECM deposits containing the human {gamma}2 chain (a,d,g; B4-6), {alpha}3 chain (b,e,h; C2-5) or the G4/5 domains of {alpha}3200 (c,f,i; D2-1). Deposition occurred only where lam5 containing {alpha}3200 (C; lane 1) was added, and was prevented by thrombin digestion of the {alpha}3200 to {alpha}3165 (C, lane 2). Bar in (f), 20 µm. (B) Quantitation of deposit area/cell for six random fields for each of the conditions in A. (C) Western blot of lam5 preparations used in A and B. Lane 1, heparin-purified lam5; lane 2, heparin-purified lam5 from lane 1, digested with thrombin.

 

Co-cultures of HFKs and dermal fibroblasts
HFs or MFs were grown on glass coverslips (11 mm) at confluence (about 5 days) to establish ECM used as a dermal equivalent. The coverslips were transferred to KGM and 104 HFKs were added to each coverslip, and incubations were continued at 37°C for the indicated times. Thrombin (1 unit/ml) with or without hirudin (2 units/ml) was added during or after co-culturing. Treatments after the appointed culture period were for 1 hour. Lam5 deposits were visualized with human specific Mabs described above, and fibronectin was stained with a rabbit polyclonal Ab against fibronectin (R790). Digital images, 6 µM thick, were captured in 0.2 µM optical sections and deconvoluted using Deltavision software. ELISA data (Fig. 5B) is the average and standard deviation of six wells for each time point.



View larger version (75K):
[in this window]
[in a new window]
 
Fig. 5. Deposition of lam5 into the PBM is inhibited by thrombin removal of G4/5. (A) HFKs were seeded onto confluent cultures of MF on coverslips, cultured for 18-20 hours, then fixed and processed for immunofluorescence with Mabs against the {alpha}3 chain (a-c; P5H10) or precursor {alpha}3200 (d-f; D2-1). Arrowheads indicate nuclei of HFKs. Thrombin digestion after the culture period removed G4/5 staining in {alpha}3200 (e), but {alpha}3 was still present in the PBM (b). Thrombin digestion throughout the culture period removed G4/5 from {alpha}3200 detected with anti-G4/5 (f) and suppressed deposition lam5 detected with anti-{alpha}3 (c). Bar in (f), 20 µm. (B) HFKs grown on MFs were double stained with (a) anti-laminin {alpha}3 chain (P5H10, green) and (b) anti-integrin ß4 subunit (P4G11, red) and the images overlaid (c, yellow) Bar in (c), 20 µm. (C) ELISA quantitation of lam5 deposits. After the designated time periods (5, 10, 20 hours), the HFK/MF co-cultures were processed for ELISA using anti-{gamma}2 Mab (B4-6). The amount of lam5 detected was significantly lower for all time points when thrombin was included during the co-culture (thrombin). Hirudin, a thrombin inhibitor, prevented the effects of thrombin.

 

Cloning of a full-length cDNA for the human LAMA3 gene encoding the laminin {alpha}3 chain
Oligonucleotide primers for the isolation of a full-length cDNA clone of the human LAMA3 gene (GenBank accession #L34155) were designed based on the sequence of partial cDNA clones described previously (Ryan et al., 1994Go); 5' primer (5' CTGGTTCCGGCGAGATGCCTCCAGCAGTGAGG 3'), 3' primer (5' CTCGCTCCGGCGACTTGGGTTACTGGTCAGG 3'). Total RNA was isolated from log-phase HFKs. cDNA was reverse-transcribed using superscipt II (Gibco-BRL) and the 3' primer. A PCR product consistent with a full-length cDNA of the {alpha}3 chain was obtained using taq DNA polymerase (Gibco-BRL) and cloned into an engineered bluescript vector (Stratagene) using ligation independent cloning (Haun and Moss, 1992Go). Point mutations in this 5 Kb clone were repaired by resection with restriction fragments from partial cDNAs. The corrected clone was inserted into the pcDNAIIzeo expression vector (Invitrogen) to yield pZeo{alpha}3, expressing human LAMA3 under control of the CMV promoter, and conferring zeocin resistance to transfected cells.

The noncleavable form of the {alpha}3 chain (Fig. 6) was obtained by deleting the sequence for 46 amino acids (S1308 to C1354) in the spacer region separating the G3 and G4 domains. The precleaved form was constructed by inserting five His codons and a stop codon after His 1364. The modifications were generated via oligonucleotide directed mutagenesis of appropriate restriction fragments using a proofreading polymerase (Deep Vent, New England Biolabs) for PCR. The modified restriction fragments were gel purified and spliced back into the pZeo{alpha}3 expression vector using standard techniques. All constructs were verified by DNA sequencing.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 6. Mutations in recombinant human laminin {alpha}3 chain. Wild-type and mutated human laminin {alpha}3 chains. Numbering of amino acid residues is from Ryan et al. (Ryan et al., 1994Go). Noncleavable {alpha}3 contains a 47 amino acid internal deletion from residue S1308 to residue C1354, in the spacer region between the G3 and G4 domains, producing a sequence in which C1307 is followed directly by S1355. This modification prevents cleavage of the G4/5 domains in culture. Precleaved {alpha}3 is a truncated {alpha}3 chain in which the G4 and G5 domains are not included, mimicking the cleavage that removes the G4/5 domains. The sequence stops at residue H1364, and five additional histidine residues have been added as an affinity tag at the C-terminus.

 

Selection of {alpha}3–/– MKs expressing human laminin {alpha}3 chain
The mutated human laminin {alpha}3 expression vectors described above were transfected into the {alpha}3–/– MK cell line by electroporation. Zeocin resistant colonies (5 µg/ml) were only present in cultures receiving plasmid DNA during the electroporation. Zeocin-selected cells were further selected for their ability to adhere and survive on Petri dishes and finally on BSA-coated Petri dishes. Only those cells synthesizing and depositing a minimal level of lam5 were able to adhere and survive on these surfaces.

ECM preparation, immobilization of soluble laminin and cell adhesion assays
For preparation of ECM, keratinocytes were grown to confluence in multiwell Petri dishes (Falcon) and extracted with three changes of 20 mM ammonium hydroxide (Gospodarowicz, 1984Go). Collagen-coated control surfaces were prepared by incubating 10 µg/ml rat tail collagen (Becton-Dickinson) in 0.05 N HCl on Petri dish for 2 hours. All surfaces were blocked with heat-denatured BSA (5 mg/ml in PBS). Lam5 and lam6 were immobilized onto plastic surfaces using antibody trapping as described (Gil et al., 2002Go; Xia et al., 1996Go). Adhesion assays were performed as previously described (Carter et al., 1991Go) in 24-well Petri plates on ECM prepared by NH4OH extraction or on collagen-coated surfaces.

Analysis of cell proliferation
Cells were plated at 104 cells per well in 24-well Petri dishes (Fig. 8A) and counted every 24 hours thereafter, for 7 days using a Metamorph software package.



View larger version (81K):
[in this window]
[in a new window]
 
Fig. 8. Expression of recombinant lam5 rescues adhesion and survival. {alpha}3+/+, {alpha}3–/–, {alpha}3–/– expressing noncleavable or precleaved human {alpha}3 chain were plated at 104 cells/well in 24-well Petri plates. Growth and deposition of the human {alpha}3 chain were monitored over a 7 day period. (A) Cell numbers were compared by counting 12 separate fields for a 10x objective. (B) ELISA for human {alpha}3 chain deposition onto the Petri dishes. (C) Phase-contrast images of cells after 7 days on Petri dishes. Bar, 25 µm. (D) Quantitation of cells in S-phase of the cell cycle after 48 hours on a Petri dish as determined by FACs analysis.

 

Duplicate plates were analyzed by ELISA for deposition of the human laminin {alpha}3 chain into the ECM (Fig. 8B). Cell-cycle analysis (Fig. 8D) was by flow cytometry, and this data was deconvoluted using Multicycle software.

Assays for integrin ß4 assembly in SACs
Assembly of ß4 integrin into Triton X-100 insoluble SACs was quantitated by ELISA and by immunofluorescent staining (Fig. 10). SACs were examined by immuno-fluorescence as described previously (Carter et al., 1990b) using anti-integrin ß4 (P4G11), anti-human laminin {alpha}3 (P5H10) or rat Mab against mouse lam5 (P3C8). For ELISA, the Triton insoluble SACS were incubated with the same Mabs used for microscopy then incubated with peroxidase conjugated anti-mouse or anti-rat secondary antibodies. Optical densities were measured at 405 nm in a microplate reader. Results are presented as the average and standard deviation from triplicate wells.



View larger version (65K):
[in this window]
[in a new window]
 
Fig. 10. Deposits of recombinant lam5 direct assembly of integrin ß4 in detergent-resistant SACs. (A) {alpha}3+/+ MKs (a-b), or {alpha}3–/– MKs expressing noncleavable human laminin {alpha}3 chain (e-f and i-j), or precleaved {alpha}3 chain (g-h and k-l). Cells were cultured on BSA-coated glass coverslips for 24 hours. {alpha}3–/– MKs (c-d), which cannot attach to BSA-coated surfaces, were cultured on collagen-coated coverslips. Cultures were extracted with 0.25% Triton X-100 in PBS, fixed and examined by immunofluorescence microscopy. Double staining with anti-integrin ß4 (Mab P4G11; panels b, d, f, h, j and l) and Mabs against: mouse/human laminin {alpha}3 (D3-4; a and c), human laminin {alpha}3 chain (P5H10; e and g), or against G4/5 in human laminin {alpha}3-200 (D2-1;i and k). a-b, c-d, e-f, g-h, i-j, and k-l are each the same field. Bar, 10 µm. (B) Quantitation by ELISA of human laminin {alpha}3 chain deposition (Mab P5H10) and mouse laminin {alpha}3 chain (Mab p3C8), and Triton X-100 resistant mouse integrin ß4 in Triton extracted cultures of {alpha}3–/– MKs, {alpha}3+/+ MKs or {alpha}3–/– MKs expressing noncleavable (non-cl.) or precleaved (pre-cl.) human laminin {alpha}3 chain.

 

Western blotting of deposited ECM
Keratinocytes were grown to confluence (4 days) on Petri dishes. The cell layers were removed with 20 mM NH4OH, and the remaining ECM was collected by scraping into 0.1% SDS and equal volumes were analyzed as shown in Fig. 4.

Immunoprecipitation of 35S-labeled laminins
Adherent cells were labeled with 35S-met and 35S-cys (2 hours in 3.5 ml met-free KGM containing 100 µCi/ml). For pulse-chase studies, the labeling media was collected at the 0 hour time point, and the incubation was continued for 3, 8 or 24 hours in KGM containing 100 µg/ml BSA as a carrier protein. For studies with labeled ECM and/or conditioned medium labeled cells were incubated with 3.5 ml KGM containing 100 µg/ml BSA, and grown for 3 days. The conditioned media containing labeled secreted proteins was collected and protease inhibitors added (NEM, PMSF, 5 mM EDTA). The cell layer was extracted with 1% Triton X-100 in PBS containing protease inhibitors, then with 2 M urea, 1 M NaCl. The remaining ECM was collected into 8 M urea, 0.1% Triton X-100, and protease inhibitors in 0.05 N HCl, by scraping. Samples were neutralized with NaOH before immunoprecipitation. Labeled proteins were precipitated as previously described (Carter et al., 1991Go). Antibodies used (P5H10 and R5922, see Antibodies, above) were able to immunoprecipitate denatured antigens.


    Results
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Transient expression of G4/5 in deposits of pre-lam5 in PBM of wounds
Pre-lam5 containing G4/5 in the {alpha}3200 chain was deposited into the PBM of epidermal wounds by leading keratinocytes in mice (Fig. 1). Precursor mouse lam5 was detected using rabbit monoclonal antibody R5808-f1 that recognizes a peptide epitope in G5 of mouse {alpha}3200 (Fig. 1a). Pre-lam5 was deposited into the PBM within 6-8 hours of injury and at 7 days (Fig. 1a). Detectable {alpha}3200 was lost by 14 days post injury (Fig. 1b), while lam5 remained detectable (Fig. 1d). This suggests that {alpha}3200 is proteolytically converted to {alpha}3165 with removal of G4/5.



View larger version (135K):
[in this window]
[in a new window]
 
Fig. 1. Transient expression of G4/5 in pre-lam5 in the PBM of epidermal wounds. Excisional wounds in mouse skin were healing for 7 days (a and c), or about 14 days (b and d). Cryostat sections of the wounds were probed with rabbit Mab R5808-f1 against mouse G5 in laminin {alpha}3 (a and b), or rat Mab against mouse lam5 (P3C8, c and d). Migrating leading cells in the partially healed wound expressed G4/5 (a) and lam5 (c), whereas closed wounds downregulated G4/5 (b) but maintained lam5 (d) (leading cells in outgrowth indicated with arrow; provisional BM indicated by arrowheads).

 

The role of G4/5 in deposition: precursor {alpha}3200 assembles into lam5 and 6
We wished to determine whether G4/5 in {alpha}3200 contributes to deposition and retention of pre-lam5 on the substratum. Keratinocytes secrete several soluble proteins (Katz and Taichman, 1999Go) including lam5, lam6, fibronectin, thrombospondin and an uncharacterized laminin, probably laminin 1 (Carter et al., 1991Go). However, lam5 is more efficiently deposited than the other secreted proteins and is therefore dominant in adhesion (Carter et al., 1991Go; Frank and Carter, 2003Go; Nguyen et al., 2000aGo). Therefore, we speculated that the G4/5 domain of precursor {alpha}3200, in addition to the {gamma}2 chain, facilitates deposition and/or retention of pre-lam5 in the ECM.

First, we established a source of lam5 ({alpha}3200ß3{gamma}2) and lam6 ({alpha}3200ß1{gamma}1). HFKs and JEBG keratinocytes were metabolically labeled with 35S-met. Labeled lam5 and lam6 were immunoprecipitated from conditioned media (Fig. 2). From HFKs, lam5 containing primarily cleaved {alpha}3165 chain and small amounts of uncleaved {alpha}3200 were precipitated with Mab against {alpha}3 (C2-5) or {gamma}2 (B4-6) (Fig. 2, HFK, –thrombin, lanes 2 and 3). Lam6 was also precipitated from HFK media with anti-{alpha}3 (C2-5), but not anti-{gamma}2 (B4-6), and appeared to contain only uncleaved {alpha}3200 (Fig. 2, HFK, –thrombin, lane 2). The lam6 was confirmed to be uncleaved because it also precipitates with Mab D2-1 against G4/5 (Fig. 2, HFK, –thrombin, lane 1). From JEBG media, only lam6 containing {alpha}3200 was precipitated with anti-{alpha}3, or anti-G4/5 but not anti-{gamma}2 (Fig. 2, JEBG, –thrombin). Therefore, the conditioned media of HFKs contains soluble lam6 with uncleaved {alpha}3200 chain and soluble lam5 containing primarily cleaved {alpha}3165 chain with only small amounts of uncleaved {alpha}3200. By contrast, the conditioned media of JEBG cells contains lam6 with uncleaved {alpha}3200 and no lam5.



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 2. Assembly and secretion of lam5 and 6. 35S-labeled proteins were immunoprecipitated from the conditioned media of HFK or JEBG keratinocytes (JEBG) using the indicated Mabs (D2-1, C2-5, etc.). Before incubation with antibodies, one half of the collected media was digested with or without thrombin (+/– thrombin; 1 NIH unit/ml for 2 hours). The precipitates were separated by 6% SDS-PAGE. Lane 1, Mab D2-1 specific for the human {alpha}3 G4/5 domains; lane 2, Mab C2-5 specific for the human {alpha}3 chain; lane 3, Mab B4-6 specific for the human {gamma}2 chain; lane 4, Mab G2'-1 specific for the 170 kDa thrombospondin (TSP).

 

G4/5 is selectively cleaved from {alpha}3200 by thrombin
Next, a method was developed to selectively remove G4/5 from pre-lam5 and pre-lam6 containing {alpha}3200. In preliminary studies, we determined that thrombin, a serum protease (Backes et al., 2000Go), selectively cleaves {alpha}3200 at two candidate PRS cleavage sites. The potential cleavage sites at R1343 and R1389 localize to the linker sequence between G3 and G4 [see sequence in Ryan et al. (Ryan et al., 1999Go)]. After thrombin cleavage, lam5 and lam6 were immuno-precipitated with a Mab against the {alpha}3 chain (C2-5; Fig. 2, + thrombin, lane 2). The {alpha}3200 chain in both laminins 5 and 6 was cleaved to {alpha}3165. Thrombin digestion released G4/5 as two bands of 37 and 35 kDa (+thrombin, lane 1, marked g4/g5) that immunoprecipitated with D2-1 and were indistinguishable from cleavage products made by the endogenous protease (–thrombin, lane 1). Significantly, there was no detectable cleavage in ß3 or {gamma}2 chains (Fig. 2) testifying to the specificity of the thrombin cleavage even at 10x the concentration of thrombin used in Fig. 2 (i.e. 10 NIH units/ml for 1 hour, results not shown). Hirudin, a thrombin inhibitor, blocked digestion (results not shown) confirming that thrombin was required for cleavage. Consistently, Mabs against thrombospondin (TSP) did not co-precipitate with any of the laminin chains and the thrombospondin was unaffected by the thrombin digestion (Fig. 2, lane 4). To the best of our knowledge this is the first report that thrombin selectively cleaves {alpha}3200 releasing G4/5 and {alpha}3165.

Soluble pre-lam5, not pre-lam6, is deposited by {alpha}3–/– MKs and rescues adhesion
Two assays were developed to compare deposition of lam5 and lam6 and how this affects adhesion. Soluble lam5 and 6 from HFK-conditioned media, or lam6 from JEBG-conditioned media (characterized in Fig. 2) were trapped on surfaces using immobilized Mabs and assayed for adhesion of the {alpha}3–/– MKs (Fig. 3A). Immobilized Mab against the {alpha}3 chain (P5H10) trapped both lam5 and lam6. Mab against the {gamma}2 chain (B4-6) trapped only lam5 on the substratum. Control Mab did not trap adhesive activity. Both immobilized lam5 and 6 induced adhesion and spreading of the {alpha}3–/– MKs. This indicates that soluble lam6 from JEBG keratinocytes is inherently adhesive like lam5, if trapped on the substratum, and probably would be adhesive if deposited.



View larger version (58K):
[in this window]
[in a new window]
 
Fig. 3. Binding and deposition of soluble pre-lam5, but not lam6, promotes spreading of {alpha}3–/– MKs. (A) Soluble lam5 and lam6 in conditioned media of HFKs and JEBG keratinocytes were trapped onto plastic surfaces using immobilized Mabs, and analyzed for adhesion and spreading of {alpha}3–/– MKs. Control IgG does not trap any adhesive activity. Anti-lam {alpha}3 Mab P5H10 traps both lam5 and lam6; anti-lam {gamma}2, Mab B4-6 traps only lam5. Immobilized lam5 and 6 promoted adhesion, establishing that both are inherently adhesive if deposited on the substratum. (B) {alpha}3–/– MKs were attached to glass coverslips as round cells. The glass surface was blocked with BSA, and the cells were cultured with soluble lam5 in conditioned media from HFKs (a,c) or soluble lam6 in JEBG keratinocytes-conditioned media (b,d). After 24 hours the cells were fixed, permeabilized and immunostained for the human laminin {alpha}3 chain (P5H10, c and d). Representative phase images are shown in (a) and (b). Bars, 25 µm.

 

Next, we determined if {alpha}3–/– MKs could utilize either exogenous soluble lam5 or 6 to deposit an adhesive ECM (Fig. 3B). The {alpha}3–/– MKs were adhered to glass coverslips then the surface was blocked with BSA. The adherent but round {alpha}3–/– MKs were incubated with conditioned media from HFKs or JEBG keratinocytes. The soluble lam5 in HFK-conditioned culture media caused cell spreading of the {alpha}3–/– MKs within 1 hour (Fig. 3Ba). By contrast, {alpha}3–/– MKs given JEBG-conditioned media remained round (Fig. 3Bb). Therefore, exogenous soluble lam5, but not lam6, promoted spreading of {alpha}3–/– MKs. Significantly, fibronectin, laminin 1 and thrombospondin in the JEBG-conditioned media also failed to induce cell spreading. In the absence of soluble lam5, the {alpha}3–/– MKs remained round (Fig. 3Bb,d). The round cells were overexposed so they could be seen on the substratum (Fig. 3Bd). The fluorescence of the round cells in Fig. 3Bd was also useful in Fig. 4Aa-c to detect the round cells that did not spread or deposit soluble lam5 (see next section).

Significantly, the spread {alpha}3–/– MKs had deposited the human lam5 onto the substratum in the characteristic flower pattern for lam5 (Carter et al., 1991Go). This deposition is consistent with results reported by Baker et al. (Baker et al., 1996Go). The deposited lam5 reacted with anti-{alpha}3 Mab (P5H10; Fig. 3Bc) and anti-G4/5 specific Mab (D2-1; see Fig. 4d-f, next section). This suggested that exogenous soluble pre-lam5, not cleaved lam5, was selectively bound and deposited by the {alpha}3–/– MKs. In controls, the deposited pre-lam5 also reacted with anti-{alpha}3 Mabs (Fig. 3Bc) and anti-human {gamma}2 chain Mabs (see Fig. 4). As expected, no lam6 deposition could be detected in the presence of JEBG-conditioned media (Fig. 3Bd). This indicates that soluble lam6 is not deposited even though it is inherently adhesive when immobilized (Fig. 3A). In contrast to the {alpha}3–/– MKs, adherent NIH3T3, CHO or HT-1080 cells did not deposit the soluble human lam5 (results not shown). This suggested that cells that can adhere and spread on exogenous lam5 may lack cell binding required for deposition.

Thrombin cleavage of G4/5 in pre-lam5 inhibits deposition by the {alpha}3–/– MKs
We determined whether the removal of G4/5 from soluble pre-lam5 would inhibit cell binding and/or deposition by the {alpha}3–/– MKs (Fig. 4). Soluble pre-lam5 was affinity purified from HFK-conditioned media by chromatography on immobilized heparin (Nguyen et al., 2000aGo). Pre-lam5 was digested with or without thrombin to remove G4/5, as seen in Fig. 4C. The cleaved and noncleaved lam5 preparations were inclubated with the {alpha}3–/– MKs adhered to glass coverslips (Fig. 4A). {alpha}3–/– MKs bound exogenous soluble human pre-lam5, deposited it onto the substratum and spread on the deposits, (Fig. 4Ad-f). Deposition and spreading was eliminated by the removal of G4/5 with thrombin (Fig. 4Ag-i). The deposits of pre-lam5 were detected with anti-{gamma}2 (B4-6), anti-{alpha}3 (C2-5) and anti-G4/5 Mab (D2-1). Visual data was confirmed by quantitation of the deposits by morphometric analysis (Fig. 4B). In controls, inclusion of hirudin, a thrombin inhibitor, blocked removal of G4/5 and prevented the effects of thrombin (Fig. 5, next section). Treatment of the deposits with thrombin subsequent to deposition removes G4/5 staining but does not remove lam5 in deposits detected by staining with anti-{alpha}3 or -{gamma}2 Mabs (Fig. 5, next section). Thus, G4/5 is required for binding and deposition, but not retention, of soluble precursor human lam5 onto a culture dish by {alpha}3–/– MKs.

G4/5 facilitates deposition of pre-lam5 on fibronectin fibrils in a model PBM
We determined whether pre-lam5 could deposit onto a dermal equivalent and if the deposition required G4/5 (Fig. 5). For this purpose we established an in vitro model for dermis. Primary mouse fibroblasts (MFs) or human fibroblasts (HFs) were grown to confluence to assemble a dense ECM containing at least fibronectin, tenascin and collagen types I, III and VI assembled in fibrils (Carter, 1982Go) but lacking lam5 (Carter et al., 1991Go). HFKs were seeded at low density onto the apical surface of the dermal equivalent. HFKs attached in colonies on the apical surface of the MFs ECM and were distinguished from fibroblasts by staining with Mabs against either epithelial specific antigens (ß4 integrin or lam5) or human-specific antigens (CD44) or by the appearance of DAPI-stained nuclei. Keratinocyte nuclei (arrowheads, Fig. 5A) display uniform blue staining with DAPI while fibroblast nuclei also display blue staining of nucleoli in spots. The HFKs deposited a prominent PBM at the interphase with the MF ECM that stained with anti-pre-lam5 Mab (D2-1; Fig. 5Ad,e,f) or {alpha}3 chain (P5H10; Fig. 5Aa,b,c) or {gamma}2 chain (B4-6, not shown). At the light microscope level, the deposited pre-lam5 (Fig. 5Aa, green) was co-linear with fibronectin fibrils (Fig. 5Aa, red, see inset) or tenascin fibrils (not shown). This suggested that lam5 interacts directly or indirectly with one or more components of the fibrils. In controls (results not shown), deposits of pre-lam5 co-aligned with MF ECM that had been de-cellularized by extraction with Triton X-100 detergent. Significantly, pre-lam5 deposits co-aligned with integrin {alpha}6ß4 in hemidesmosme-like SACs of the HFKs (Fig. 5Ba-c). This indicates that pre-lam5 deposits were restricted to the points of contact of the HFKs with the MF ECM. The deposits of lam5 formed a `nest' surrounding the colony of HFKs and was not deposited over the MFs or ECM distant to the HFKs.

Significantly, thrombin digestion during co-culture (Fig. 5Ac,f), but not after deposition (Fig. 5Ab,e), reduced deposition. ELISA quantitation of deposited lam5 using anti-{gamma}2 chain Mab (B4-6) (Fig. 5C) confirmed that thrombin decreased deposition. Hirudin, a specific inhibitor of thrombin, partially blocked the effects of thrombin (Fig. 5C). Thrombin efficiently inhibited deposition of lam5 when detected by fluorescence microscopy (Fig. 5A) but only partially blocked the lam5 deposition when detected by ELISA (Fig. 5C). This is because the ELISA assay does not distinguish pre-lam5 in the cytoplasm of HFKs that is resistant to thrombin, from lam5 in the PBM. We conclude that HFKs deposit a PBM of pre-lam5 at the junction with a dermal equivalent. Removal of G4/5 prevents deposition, but not retention, of lam5.

G4/5 in deposition: expression of recombinant noncleavable or precleaved human {alpha}3 chain
We used recombinant forms of lam5 to further evaluate the role of G4/5 in deposition. A modified form of human {alpha}3 chain was expressed in mouse {alpha}3–/– MKs (Fig. 6). `Precleaved {alpha}3' ({alpha}3165*) was designed to mimic the {alpha}3 chain after proteolytic removal of G4/5. The sequence for residues H1364 to the stop codon was removed and replaced with the sequence for a six-histidine tag. `Noncleavable' {alpha}3 ({alpha}3200*) contains an internal deletion, with residues S1308 to C1354 removed. This deletion produces a G-domain resembling the laminin {alpha}1 chain, which is not cleaved (Timpl et al., 2000Go). The deletion removes one of the thrombin cleavage sites at R1343, and removes a cleavage site at Q1337 for endogenous protease (Tsubota et al., 2000Go).

Characterization of recombinant noncleavable and precleaved lam5
Before using the recombinant laminin 5 forms for evaluating the role of G4/5 in deposition, it was necessary to evaluate their function in assembly, cell proliferation, adhesion and signaling.

Rescue of lam5 assembly
Lam5 deposited by transfected {alpha}3–/– MKs was characterized by western blotting of ECM (Fig. 7). {alpha}3–/– MKs transfected with the noncleavable human {alpha}3200* chain expressed a 195 kDa human {alpha}3 chain detected with a Mab (P5H10) specific for human {alpha}3 chain (Fig. 7A, lane 5). For comparison, the wild-type {alpha}3200 was detected in CCM of HFKs (lane 2). Endogenous protease failed to remove G4/5 from the recombinant {alpha}3200*. A human {alpha}3 chain at 165 kDa was detected in the ECM from {alpha}3–/– MKs expressing the precleaved human {alpha}3165* chain (lane 6). In controls, no human {alpha}3 chain was detected in the ECM from either nontransfected {alpha}3–/– MKs (lane 3) or wild-type {alpha}3+/+ MKs (lane 4). A polyclonal antibody against both mouse and human laminin ß3 chain detected the ß3 chain in all samples except the {alpha}3–/– ECM (Fig. 7B, lane 3). In Fig. 7C, uncleaved mouse {alpha}3200 chain was detected only in ECM from {alpha}3+/+ MKs by an antibody that recognizes only G4/5 domains (R5808-f1) in the mouse laminin {alpha}3200 chain (lane 4). We conclude that expression of recombinant human {alpha}3165* or {alpha}3200* {alpha}3–/– MKs is sufficient to restore assembly and deposition of endogenous chimeric human/mouse lam5.



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 7. Immunoblotting of recombinant chimeric human/mouse lam5 deposited by {alpha}3–/– MKs. ECM from confluent cultures of {alpha}3–/– MKs (lane 3), {alpha}3+/+ MKs (lane 4) and {alpha}3–/– MKs expressing noncleavable (lane 5) or precleaved (lane 6) human {alpha}3 chains. Control samples of HFK lam5 containing {alpha}3200 chain (lane 2) or {alpha}3165 chain (lane 1). Samples were fractionated by SDS-PAGE (A and B 5%, C 10%) and immunoblotted. (A) Mab P5H10 specific for the human {alpha}3 chain; (B) goat polyclonal antibody anti-ß3 chain; (C) Rabbit Mab R5808-F1 specific for G4/5 domain of mouse laminin {alpha}3200.

 

Noncleavable and precleaved lam5 rescue proliferation
The {alpha}3–/– MKs do not deposit lam5 and as a result require an exogenous ligand, such as lam5 or collagen I, to adhere and proliferate on a polystyrene Petri dish (Ryan et al., 1999Go). When the {alpha}3–/– MKs express a human {alpha}3 chain, they are able to adhere and proliferate on a Petri dish in the absence of exogenous ligand (Fig. 8). The {alpha}3–/– MKs expressing human {alpha}3165* or {alpha}3200* or the {alpha}3+/+ MK adhered and proliferated. The nontransfected {alpha}3–/– MKs were unable to increase cell numbers. The two {alpha}3 transfected cell lines grew with nearly identical kinetics; however, significantly greater amounts of noncleavable lam5 were deposited compared with precleaved (Fig. 8B). We will return to this difference later.

Phase contrast microscopy of the MKs remaining attached to Petri dishes after 7 days of culturing (Fig. 8C) showed that the {alpha}3+/+ cells and the human {alpha}3 transfected {alpha}3–/– cells were confluent and spread. The {alpha}3–/– MKs were sparse, round and weakly attached. The {alpha}3–/– cells were still viable, however, as they could re-plate onto collagen coated dishes (results not shown). Cell cycle profiles indicated that {alpha}3–/– MKs have a low proportion of cells in S phase compared with {alpha}3+/+ MKs, and {alpha}3–/– MKs transfected with human {alpha}3 chains (Fig. 8D). Thus, expression of human {alpha}3 in {alpha}3–/– MKs followed by assembly and deposition of lam5 partially restores adhesion, cell cycle progression and cell replication.

Noncleavable and precleaved lam5 rescue adhesion via both integrins {alpha}3ß1 and {alpha}6ß4
Adhesion assays were performed to determine which integrins ligate the precleaved and noncleavable lam5 deposited by transfected {alpha}3–/– MKs (Fig. 9). Lam5 deposited by the transfected {alpha}3–/– MKs, but not {alpha}3–/– MKs, supported adhesion of HFKs in 30 minute adhesion assays. Adhesion to the deposited chimeric lam5 and to lam5 deposited by HFKs is inhibited by Mab against human laminin {alpha}3 chain (C2-9; Fig. 9) but not mouse lam5 deposited by {alpha}3+/+ MKs. Adhesion to the deposited recombinant ECM was inhibited by Mab against the integrin {alpha}3 subunit (P1B5), and integrin ß1 subunit (P4C10). Significantly, adhesion and inhibitor results were not affected by the presence of the G4/5 domains in the recombinant lam5. Adhesion to deposited lam5 was only partially inhibited by antibodies to {alpha}3 and ß1 integrins because integrin {alpha}6ß4 also contributes to adhesion (Xia et al., 1996Go) (see next section). Adhesion to collagen I, but not any of the lam5 substrates, was blocked by Mab against integrin {alpha}2 (P1H5). We conclude that adhesion via integrins {alpha}3ß1 is indistinguishable on noncleavable or precleaved lam5.



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 9. HFK adhesion to recombinant lam5 and effects of anti-integrin inhibitory antibodies. Trypsin suspended HFKs were plated into 24-well plates that are coated with type I collagen (COL.) or ECM from HFKs, {alpha}3+/+ MKs, {alpha}3–/– MKs, or {alpha}3–/– MKs expressing noncleavable and precleaved lam5. HFKs were allowed to adhere to the surfaces for 30 minutes at 37°C with or without the indicated Mabs: anti-LAM5 C2-9 against human laminin {alpha}3 chain; integrin ß1, P4C10; integrin {alpha}3, P1B5; integrin {alpha}2, P1H5; integrin {alpha}5, P1D6. Adhesion is reported as the proportion of fluorescently labeled cells remaining adhered after washing. Each condition was assayed in triplicate. This is a single adhesion assay, the results of which are representative of results obtained on at least three occasions.

 

The {alpha}3–/– MKs transfected with noncleavable (Fig. 10Ae-f and i-j) or precleaved (g-h and k-l) human {alpha}3 chain or {alpha}3+/+ MKs (panel b) each deposited lam5 that codistributed with integrin ß4 in Triton-insoluble hemidesmosome-like SACs. Lam5 is not detected (panel c) and Triton-resistant ß4 integrin (panel d) is absent in {alpha}3–/– MKs on collagen. We conclude that precleaved and noncleavable lam5 both promote the assembly of {alpha}6ß4 in SACs.

Noncleavable and precleaved lam5 rescue signaling via FAK
We determined whether deposits of noncleavable and precleaved lam5 that rescued adhesion also rescued transmembrane cell signals. {alpha}3–/– MKs or HFKs were plated onto surfaces of deposited recombinant lam5 for 30 minutes. Extracts of the cells were blotted with Abs against focal adhesion kinase that is phosphorylated on tyrosine 397 (FAK PY-397; Fig. 11). FAK PY-397 was present in {alpha}3–/– MKs adhering to recombinant precleaved or noncleavable lam5, but not in suspended cells or cells plated onto a nonadhesive BSA blocked surface or cells plated onto ECM from {alpha}3–/– MKs (Fig. 11). Similar results were obtained with HFKs adhering to the same surfaces. In controls, FAK was also phosphorylated in {alpha}3–/– MKs or HFKs plated on collagen I, on ECM from HFKs or ECM from {alpha}3+/+ MKs.



View larger version (60K):
[in this window]
[in a new window]
 
Fig. 11. Noncleavable and precleaved lam5 promote phosphorylation of focal adhesion kinase. As indicated, HFKs or {alpha}3–/– MKs were suspended with trypsin then either left in suspension or re-adhered to the indicated surfaces (collagen, HFK, {alpha}3+/+, etc.) for 30 minutes. Triton X-100 extracts were prepared containing 100 µM Na3VO4, 10 mM NaF, PMSF and NEM from the adherent cells and suspended cells. Extracts were assayed for phosphorylated focal adhesion kinase (P-FAK) by immunoblotting with antibody FAK P-Y397.

 

G4/5 in precursor {alpha}3 promotes deposition and reduces secretion of lam5
Here we used the recombinant lam5 characterized above to evaluate the role of G4/5 in secretion and deposition of lam5. {alpha}3–/– MKs expressing human {alpha}3200* or {alpha}3165* chains were metabolically labeled with 35S-Met. The adherent cells were removed with ammonium hydroxide and adherent ECM solubilized in urea and immunoprecipitated with the indicated antibodies (Fig. 12A). Noncleavable lam5 containing {alpha}3200* was readily detected in the ECM deposits (Fig. 12A lane 3). By contrast, relatively little precleaved lam5 containing {alpha}3165* was detected in the ECM (Fig. 12A lane 5). Clearly, lam5 containing {alpha}3165* was deposited sufficiently to rescue adhesion and survival but less than lam5 containing {alpha}3200* (Fig. 8B). Assays in Figs 8 and 12 are quite different. In Fig. 12, it was necessary to solubilize the ECM deposits with urea in a form that could still be immunoprecipitated. In controls, immunoprecipitation of the ECM extracts (Fig. 12A) with anti-ß1{gamma}1 antibody (R5922) failed to detect deposited lam6 or presumptive laminin 1. However, presumptive laminin 1 was immunoprecipitated with the anti-ß1{gamma}1 antibody (R5922) and was secreted into the conditioned culture medium by {alpha}3–/– MKs expressing {alpha}3200* (Fig. 12B lane 2) and {alpha}3165* (Fig. 12B, lane 3) or untransfected {alpha}3–/– (results not shown). This indicated that transfected cells were expressing similar levels of other secreted laminins and proteins, as untransfected cells, even though they were not being deposited.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 12. Non-cleavable lam5 is deposited while precleaved lam5 is secreted. {alpha}3–/– MKs expressing the noncleavable or precleaved human laminin {alpha}3 chain were cultured on collagen-coated plates in the presence of 35S-methionine for 3 days. In controls, HFKs were also labeled. Labeled proteins, either secreted into the conditioned culture media (CCM; B) or deposited into the ECM (A) were precipitated with antibody P5H10, against human laminin {alpha}3 chain ({alpha}3), or antibody R5922 against mouse/human laminin ß1 and {gamma}1 chains (ß1{gamma}1). The labeled precipitates were fractionated by SDS-PAGE followed by fluorography. (C) Cultures of {alpha}3–/– MKs expressing the noncleavable or precleaved human laminin {alpha}3 chain were pulse labeled (2 hours) with 35S-methionine. Labeled cells were chased for 0, 3, 8 or 24 hours in media without label. Conditioned culture media (CCM) was immunoprecipitated with antibody P5H10, specific for the human {alpha}3 chain, and fractionated by SDS-PAGE (6%, reducing). (D) Cultures of {alpha}3–/– MKs or {alpha}3–/– MKs expressing noncleavable or precleaved human laminin {alpha}3 chain (2.5x106 cells well) were cultured (24 hours) in KGM (1.0 ml). The adherent cells were extracted with Triton X-100 detergent. Total human {alpha}3 chain in the ECM and culture medium was quantitated by ELISA with anti-human {alpha}3 chain Mab (P5H10). As a control, total laminin ß1 and {gamma}1 chains in culture medium were quantitated with anti-ß1/{gamma}1 chain antibody (R5922). Each analysis was performed on three separate wells.

 

To corroborate the findings in Fig. 12A, we determined whether the differences in deposition of noncleavable and precleaved lam5 were reflected in levels of secreted lam5. MKs expressing precleaved {alpha}3165* or noncleavable {alpha}3200* were pulse-labeled with 35S-Met and chased for the indicated times (Fig. 12C). MKs expressing {alpha}3200* chain secreted almost no lam5 but relatively large amounts of lam6 (Fig. 12C, noncleavable). By contrast, MKs expressing {alpha}3165* secreted primarily lam5 and no lam6 (Fig. 12C, precleaved). It is also apparent from Fig. 12C, that noncleavable {alpha}3200*, but not {alpha}3165*, assembles into secreted lam6. This point will be the subject of a separate study (R.O.S., unpublished). In Fig. 12D, quantitation of deposited verses secreted human {alpha}3 chain in noncleavable and precleaved lam5 confirmed the qualitative results from Fig. 12A. The data shows that noncleavable lam5 is efficiently deposited while precleaved lam5 is poorly deposited but efficiently secreted. It should be pointed out that most of the noncleavable human {alpha}3 chain is secreted as lam6, as shown in Fig. 12B. As a control, secreted laminin ß1 and {gamma}1 chains were quantitated to assure that the {alpha}3–/– MKs transfected with noncleavable or precleaved human {alpha}3 chain were secreting comparable levels of lam1 while depositing different levels of lam5. For the study here, we conclude that noncleavable lam5 is efficiently deposited but poorly secreted, whereas precleaved lam5 is efficiently secreted but poorly deposited.


    Discussion
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The results establish, for the first time, that the G4/5 domain of the {alpha}3200 chain facilitates deposition of pre-lam5 in two culture models for assembly of the PBM. This conclusion is based on the following. (1) Pre-lam5 is deposited into the PBM of epidermal wounds before other BM components with which lam5 interacts. After deposition, {alpha}3200 is cleaved to the {alpha}3165 form releasing g4/5 (Fig. 1). (2) Exogenous soluble pre-lam5 was bound and deposited by {alpha}3–/– MKs (Fig. 3). The deposition was prevented by removal of G4/5 with thrombin before binding. However, thrombin did not detach lam5 after deposition, suggesting that G4/5 is not required for retention (Figs 4 and 5). (3) HFKs cultured on MF ECM deposited endogenous pre-lam5 along fibronectin fibrils analogous to deposition on dermis in wounds. Deposition of pre-lam5 into the PBM was blocked by thrombin digestion during, but not after, deposition (Figs 5 and 6). (4) Expression of recombinant precleaved or noncleavable human {alpha}3 chain in {alpha}3–/– MKs rescued assembly and deposition of lam5 sufficient for adhesion via both integrins {alpha}3ß1 and {alpha}6ß4. Adhesion rescued phosphorylation of FAK and survival. However, noncleavable lam5 was efficiently deposited but not secreted, whereas precleaved lam5 was efficiently secreted but not deposited. We conclude that the G4/5 domain of {alpha}3200 facilitates cell binding and deposition of pre-lam5. We suggest that G4/5 facilitates deposition of pre-lam5 into the PBM of epidermal wounds and that the deposition is required for subsequent cell adhesion, signaling and survival.

Recently we have shown that pre-lam5 deposited onto collagen, localized into `deposition contacts' at the rear of migrating HFKs and is necessary to generate polarized and linear migration of keratinocytes, termed processive migration (Frank and Carter, 2003Go). These deposition contacts localize to sites of collagen remodeling/removal. After deposition, the pre-lam5 ligates integrin {alpha}3ß1 to mediate adhesion and processive migration. Processive migration via {alpha}3ß1 is followed by a switch to integrin {alpha}6ß4 in SACs correlating with the end to migration. Deposition and subsequent adhesion do not occur if HFKs are treated with microtubule poisons (Frank and Carter, 2003Go). The results presented here indicate that G4/5 facilitates cell binding to an unidentified receptor(s) and deposition of pre-lam5 before ligation of {alpha}3ß1 and processive migration.

Deposition
Noncleavable {alpha}3200* chain assembled into recombinant lam5 and lam6. However, lam5 was deposited, and lam6 was secreted (Fig. 12). This suggests an important role for the ß3 or {gamma}2 chains in deposition as reported (Gagnoux-Palacios et al., 2001Go). However, when lam5 was assembled with precleaved {alpha}3165*, it was deposited inefficiently but efficiently secreted (Fig. 12C). This suggested that the {gamma}2 chain was insufficient for deposition of lam5 and that G4/5 was also necessary. Consistently, {alpha}3–/– MKs bound and deposited exogenous soluble pre-lam5, but not soluble pre-lam6 or cleaved lam5. In the absence of G4/5, precleaved lam5, or thrombin-digested lam5, were soluble and not efficiently deposited. However, precleaved is deposited at least on plastic dishes in culture sufficiently to rescue adhesion and survival. Together, the results suggest that the mechanism of deposition and retention of lam5 is complex and may involve multiple receptors or ligand-ligand interactions. For example, the binding and deposition of exogenous soluble pre-lam5 was accomplished by the {alpha}3–/– MKs, but not HT1080, CHO, NIH 3T3, HF or MF cells. HT1080 cells can adhere to exogenous lam5 via {alpha}3ß1 (Carter et al., 1991Go) or syndecan 1 (Okamoto et al., 2003Go) but are not competent for binding or deposition of exogenous pre-lam5. This suggests that neither {alpha}3ß1 nor syndecan 1 are sufficient for binding and deposition of pre-lam5. Consistently, neither null defects in integrins {alpha}3 (DiPersio et al., 1997Go), ß1 in epidermis (Grose et al., 2002Go; Grose and Werner, 2003Go; Raghavan et al., 2003Go), nor syndecan 1 (Stepp et al., 2002Go) nor 4 (Echtermeyer et al., 2001Go) have reported defects in lam5 deposition, only in organization of deposits. By contrast, the G4/5 domains of the laminin {alpha}2 (Li et al., 2002Go) and {alpha}3 chains appear to play similar roles in cell binding or deposition: The G4/5 domains may participate in laminin deposition by interacting with a nonintegrin receptor(s). Only after deposition does interaction with integrins facilitate adhesion (Frank and Carter, 2003Go). Our studies did not evaluate the interactions that retain lam5 along the fibronectin fibrils (Fig. 5) nor in the provisional BM of the wound (Fig. 1). Conceivably, the {gamma}2 chain of lam5 may play a role in retention by interacting with dermal ligands while G4/5 interacts with a cell receptor involved in binding or deposition. Significantly, thrombin digestion that removed G4/5 and inhibited deposition, did not cleave the {gamma}2 chain, an event reported to inhibit deposition of laminin 5 (Gagnoux-Palacios et al., 2001Go).

G4/5 as a regulator of {alpha}3ß1 and {alpha}6ß4 ligation
Lam5 interacts with integrin {alpha}6ß4 in hemidesmosome-like stable anchoring contacts (SACs) (Carter et al., 1990b) and hemidesmosomes (Ryan et al., 1999Go) and with {alpha}3ß1 in adhesion and motility (Carter et al., 1991Go; Frank and Carter, 2003Go). It has been suggested that cleaved lam5 is necessary for the nucleation of hemidesmosome-like structures in epithelial cell lines (Goldfinger et al., 1998Go). The G3 domain is reported as the major binding site for integrins but mutation studies failed to distinguish separate binding sites for {alpha}3ß1, {alpha}6ß1 or {alpha}6ß4 integrins (Hirosaki et al., 2000Go; Hirosaki et al., 2002Go). Here, noncleavable and precleaved lam5 both promoted the assembly of {alpha}6ß4 in SACs and cell spreading and signaling via {alpha}3ß1. The results (Figs 10 and 11) do not disprove the proposed role of G4/5 as a regulator of {alpha}3ß1 verses {alpha}6ß4 interactions; however, the current studies found no evidence for such regulation. In an alternative view, studies have raised the possibility that changes in cell signaling, not the proteolytic removal of G4/5, may regulate functional switching between {alpha}3ß1 and {alpha}6ß4 (Frank and Carter, 2003Go; Mercurio et al., 2001Go; Nguyen et al., 2000aGo; Nguyen et al., 2001Go).

Cleavage
Proteolytic cleavage of the G4/5 by endogenous protease was prevented by removal of a 46 amino acid sequence in the spacer region separating the G3 and G4 domains. Modeling of this region, based on the crystal structure of the laminin {alpha}2 G4/5 domains, predicts an exposed, flexible loop, easily accessible to proteases (Timpl et al., 2000Go). A variety of proteases can cleave the {alpha}3200 to {alpha}3165 chain in this region, including mammalian tolloid (Veitch et al., 2003Go), plasmin (Goldfinger et al., 1998Go) and thrombin (Fig. 2). Thrombin selectively converts {alpha}3200 to {alpha}3165 with release of G4/5 from both pre-lam5 and pre-lam6 (Fig. 2). Whatever the identity of the protease(s) responsible for G4/5 cleavage in cultured keratinocytes, deletion of the spacer region eliminates G domain cleavage without inactivating deposition or adhesive function. Conceivably, removal of the 46 amino acid spacer may generate conformational changes that disrupt interactions of G4/5 with G1-3 that mimic proteolytic removal of G4/5. For example, deletion of the spacer between G3 and G4 may expose binding sites in G1-3 for integrin {alpha}6ß4. By analogy, recombinant lam6 reportedly requires cleavage of the G domains to function as an adhesive ligand (Hirosaki et al., 2002Go). However, our results indicate that unprocessed pre-lam6 will support cell adhesion and spreading but only when immobilized on a surface (Fig. 3).

Reasonably, the {alpha}3–/– MKs, and the recombinant precleaved and noncleavable lam5 provide novel tools to evaluate the coupling between deposition of pre-lam5 and processive migration via {alpha}3ß1 (Frank and Carter, 2003Go). Further, we identified a novel cell surface receptor, p80/gp140/CDCP1, whose tyrosine phosphorylation is responsive to the deposition and adhesion to lam5 (Brown, 2004; Xia et al., 1996Go). The use of these tools may facilitate identification of a receptor that mediates binding and deposition of pre-lam5 onto a dermal equivalent.


    Acknowledgments
 
This work was supported by: National Institutes of Health Grants CA49259 (WGC) and DK59221 (JO/WGC); University of Washington Engineered Biomaterials (UWEB) NSF EEC 9529161UWEB (WGC); and BioStratum Inc. Durham NC (WGC). Medical Student Research Training Grant from the NIDDK (MB).


    Footnotes
 
* Present address: Seagen, 21823 - 30th Drive S.E., Bothell, WA 98021, USA Back


    References
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

Aumailley, M., Khal, A. E., Knoss, N. and Tunggal, L. (2003). Laminin 5 processing and its integration into the ECM. Matrix Biol. 22, 49-54.[CrossRef][Medline]

Backes, B. J., Harris, J. L., Leonetti, F., Craik, C. S., Ellman, J. A. (2000). Synthesis of positional-scanning libraries of fluorogenic peptide substrates to define the extended substrate specificity of plasmin and thrombin. Nat. Biotechnol. 18, 187-193.[CrossRef][Medline]

Baker, S. E., DiPasquale, A. P., Stock, E. L., Quaranta, V., Fitchmun, M. and Jones, J. C. (1996). Morphogenetic effects of soluble laminin-5 on cultured epithelial cells and tissue explants. Exp. Cell Res. 228, 262-270.[CrossRef][Medline]

Borradori, L. and Sonnenberg, A. (1999). Structure and function of hemidesmosomes: more than simple adhesion complexes. J. Invest. Dermatol. 112, 411-418.[CrossRef][Medline]

Boyce, S. T. and Ham, R. G. (1985). Cultivation, frozen storage, and clonal growth of normal human epidermal keratinocytes in serum-free media. J. Tissue Cult. Methods 9, 83-93.

Brown, T. A., Yang, T. A., Zaitsevskaia, T., Xia, T., Dunn, C. A., Sigle, R. O., Knudsen, B. and Carter, W. G. (2004). Adhesion or plasmin regulate tyrosine phosphorylation of a novel membrane glycoprotein p80/gp140/CDCP1 in epithelia. J. Biol. Chem. 279, 14772-14783.[Abstract/Free Full Text]

Carter, W. G. (1982). Transformation-dependent alterations is glycoproteins of extracellular matrix of human fibroblasts. Characterization of GP250 and the collagen-like GP140. J. Biol. Chem. 257, 13805-13815.[Abstract/Free Full Text]

Carter, W. G., Kaur, P., Gil, S. G., Gahr, P. J. and Wayner, E. A. (1990). Distinct functions for intergrins {alpha}3ß1 in focal adhesions and {alpha}6ß4/bullous pemphigoid antigen in a new stable anchoring contact (SAC) of keratinocytes: relationship to hemidesmosomes. J. Cell Biol. 111, 3141-3154.[Abstract/Free Full Text]

Carter, W. G., Ryan, M. C. and Gahr, P. J. (1991). Epiligrin, a new cell adhesion ligand for integrin {alpha}3ß1 in epithelial basement membranes. Cell 65, 599-610.[CrossRef][Medline]

deHart, G. W., Healy, K. E. and Jones, J. C. (2003). The role of alpha3beta1 integrin in determining the supramolecular organization of laminin-5 in the extracellular matrix of keratinocytes. Exp. Cell Res. 283, 67-79.[CrossRef][Medline]

DiPersio, C. M., Hodivala-Dilke, K. M., Jaenisch, R., Kreidberg, J. A. and Hynes, R. O. (1997). alpha3beta1 integrin is required for normal development of the epidermal basement membrane. J. Cell Biol. 137, 729-742.[Abstract/Free Full Text]

Dowling, J., Yu, Q. C. and Fuchs, E. (1996). Beta4 integrin is required for hemidesmosome formation, cell adhesion and cell survival. J. Cell Biol. 134, 559-572.[Abstract/Free Full Text]

Echtermeyer, F., Streit, M., Wilcox-Adelman, S., Saoncella, S., Denhez, F., Detmar, M. and Goetinck, P. (2001). Delayed wound repair and impaired angiogenesis in mice lacking syndecan-4. J. Clin. Invest. 107, R9-R14.

Frank, D. and Carter, W. G. (2003). Laminin 5 deposition regulates keratinocyte polarized and persistent migration. J. Cell Sci. 117, 1351-1363.

Gagnoux-Palacios, L., Allegra, M., Spirito, F., Pommeret, O., Romero, C., Ortonne, J. P. and Meneguzzi, G. (2001). The short arm of the laminin gamma2 chain plays a pivotal role in the incorporation of laminin 5 into the extracellular matrix and in cell adhesion. J. Cell Biol. 153, 835-850.[Abstract/Free Full Text]

Georges-Labouesse, E., Messaddeq, N., Yehia, G., Cadalbert, L., Dierich, A. and le Meur, M. (1996). Absence of integrin alpha 6 leads to epidermolysis bullosa and neonatal death in mice. Nat. Genet. 13, 370-373.[CrossRef][Medline]

Gil, S. G., Brown, T. A., Ryan, M. C. and Carter, W. G. (1994). Junctional epidermolysis bullosis: defects in expression of epiligrin/nicein/kalinin and integrin beta 4 that inhibit hemidesmosome formation. J. Invest. Dermatol. 103, S31-S38.[CrossRef][Medline]

Gil, S. G., Sigle, R. O. and Carter, W. G. (2002). Detection and purification of instructive extracellular matrix components with monoclonal antibody technologies. Methods Cell Biol. 69, 27-52.[Medline]

Goldfinger, L. E., Stack, M. S. and Jones, J. C. (1998). Processing of laminin-5 and its functional consequences: role of plasmin and tissue-type plasminogen activator. J. Cell Biol. 141, 255-265.[Abstract/Free Full Text]

Goldfinger, L. E., Hopkinson, S. B., deHart, G. W., Collawn, S., Couchman, J. R. and Jones, J. C. (1999). The alpha3 laminin subunit, alpha6beta4 and alpha3beta1 integrin coordinately regulate wound healing in cultured epithelial cells and in the skin. J. Cell Sci. 112, 2615-2629.[Abstract]

Gospodarowicz, D. J. (1984). Extracellular matrices and the control of cell proliferation and differentiation in vitro. Prog. Clin. Biol. Res. 145, 103-128.[Medline]

Grose, R. and Werner, S. (2003). Wound healing studies in transgenic and knockout mice. A review. Methods Mol. Med. 78, 191-216.[Medline]

Grose, R., Hutter, C., Bloch, W., Thorey, I., Watt, F. M., Fassler, R., Brakebusch, C. and Werner, S. (2002). A crucial role of beta 1 integrins for keratinocyte migration in vitro and during cutaneous wound repair. Development 129, 2303-2315.[Abstract/Free Full Text]

Hall, H., Deutzmann, R., Timpl, R., Vaughan, L., Schmitz, B. and Schachner, M. (1997). HNK-1 carbohydrate-mediated cell adhesion to laminin-1 is different from heparin-mediated and sulfatide-mediated cell adhesion. Eur. J. Biochem. 246, 233-242.[Medline]

Haun, R. S. and Moss, J. (1992). Ligation-independent cloning of glutathione S-transferase fusion genes for expression in Escherichia coli. Gene 112, 37-43.[CrossRef][Medline]

Hirosaki, T., Mizushima, H., Tsubota, Y., Moriyama, K. and Miyazaki, K. (2000). Structural requirement of carboxyl-terminal globular domains of laminin alpha 3 chain for promotion of rapid cell adhesion and migration by laminin-5. J. Biol. Chem. 275, 22495-22502.[Abstract/Free Full Text]

Hirosaki, T., Tsubota, Y., Kariya, Y., Moriyama, K., Mizushima, H. and Miyazaki, K. (2002). Laminin-6 is activated by proteolytic processing and regulates cellular adhesion and migration differently from laminin-5. J. Biol. Chem. 277, 49287-49295.[Abstract/Free Full Text]

Hohenester, E., Tisi, D., Talts, J. F., Timpl, R. and Sasaki, T. (1999). The crystal structure of a laminin G-like module reveals the molecular basis of alpha-dystroglycan binding to laminins, perlecan, and agrin. Structural basis and potential role of heparin/heparan sulfate binding to the angiogenesis inhibitor endostatin. Mol. Cell 4, 783-792.[CrossRef][Medline]

Kainulainen, T., Hakkinen, L., Hamidi, S., Larjava, K., Kallioinen, M., Peltonen, J., Salo, T., Larjava, H. and Oikarinen, A. (1998). Laminin-5 expression is independent of the injury and the microenvironment during reepithelialization of wounds. J. Histochem. Cytochem. 46, 353-360.[Abstract/Free Full Text]

Katz, A. B. and Taichman, L. B. (1999). A partial catalog of proteins secreted by epidermal keratinocytes in culture. J. Invest. Dermatol. 112, 818-821.[CrossRef][Medline]

Lampe, P. D., Nguyen, B. P., Gil, S., Usui, M., Olerud, J., Takada, Y. and Carter, W. G. (1998). Cellular interaction of integrin a3b1 with laminin 5 promotes gap junctional communication. J. Cell Biol. 143, 1735-1747.[Abstract/Free Full Text]

Li, S., Harrison, D., Carbonetto, S., Fassler, R., Smyth, N., Edgar, D. and Yurchenco, P. D. (2002). Matrix assembly, regulation, and survival functions of laminin and its receptors in embryonic stem cell differentiation. J. Cell Biol. 157, 1279-1290.[Abstract/Free Full Text]

Li, S., Edgar, D., Fassler, R., Wadsworth, W. and Yurchenco, P. D. (2003). The role of laminin in embryonic cell polarization and tissue organization. Dev. Cell 4, 613-624.[CrossRef][Medline]

Lim, K. K., Su, W. P., McEvoy, M. T. and Pittelkow, M. R. (1996). Generalized gravis junctional epidermolysis bullosa: case report, laboratory evaluation, and review of recent advances. Mayo Clin. Proc. 71, 863-868.[Abstract]

Mercurio, A. M., Rabinovitz, I. and Shaw, L. M. (2001). The alpha 6 beta 4 integrin and epithelial cell migration. Curr. Opin. Cell Biol. 13, 541-545.[CrossRef][Medline]

Nakano, A., Chao, S. C., Pulkkinen, L., Murrell, D., Bruckner-Tuderman, L., Pfendner, E. and Uitto, J. (2002). Laminin 5 mutations in junctional epidermolysis bullosa: molecular basis of Herlitz vs. non-Herlitz phenotypes. Hum. Genet. 110, 41-51.[CrossRef][Medline]

Nguyen, B. P., Gil, S. G. and Carter, W. G. (2000a). Deposition of laminin 5 by keratinocytes regulates integrin adhesion and signaling. J. Biol. Chem. 275, 31896-31907.[Abstract/Free Full Text]

Nguyen, B. P., Gil, S. G., Ryan, M. C. and Carter, W. G. (2000b). Deposition of laminin 5 in epidermal wounds regulates integrin signaling and adhesion. Curr. Opin. Cell Biol. 12, 554-562.[CrossRef][Medline]

Nguyen, B. P., Ren, X. D., Schwartz, M. A. and Carter, W. G. (2001). Ligation of integrin alpha 3beta 1 by laminin 5 at the wound edge activates Rho-dependent adhesion of leading keratinocytes on collagen. J. Biol. Chem. 276, 43860-43870.[Abstract/Free Full Text]

Okamoto, O., Bachy, S., Odenthal, U., Bernaud, J., Rigal, D., Lortat-Jacob, H., Smyth, N. and Rousselle, P. (2003). Normal human keratinocytes bind to the alpha3LG4/5 domain of unprocessed laminin-5 through the receptor syndecan-1. J. Biol. Chem. 278, 44168-44177.[Abstract/Free Full Text]

Raghavan, S., Vaezi, A. and Fuchs, E. (2003). A role for alphabeta1 integrins in focal adhesion function and polarized cytoskeletal dynamics. Dev. Cell 5, 415-427.[CrossRef][Medline]

Ryan, M. C., Tizard, R., VonDevanter, D. R. and Carter, W. G. (1994). Cloning of the LamA3 gene encoding the {alpha}3 chain of the adhesive ligand epiligrin: expression in wound repair. J. Biol. Chem. 269, 22779-22787.[Abstract/Free Full Text]

Ryan, M. C., Lee, K., Miyashita, Y. and Carter, W. G. (1999). Targeted disruption of the LAMA3 gene in mice reveals abnormalities in survival and late stage differentiation of epithelial cells. J. Cell Biol. 145, 1309-1323.[Abstract/Free Full Text]

Smirnov, S. P., McDearmon, E. L., Li, S., Ervasti, J. M., Tryggvason, K. and Yurchenco, P. D. (2002). Contributions of the LG modules and furin processing to laminin-2 functions. J. Biol. Chem. 277, 18928-18937.[Abstract/Free Full Text]

Stepp, M. A., Gibson, H. E., Gala, P. H., Iglesia, D. D., Pajoohesh-Ganji, A., Pal-Ghosh, S., Brown, M., Aquino, C., Schwartz, A. M., Goldberger, O. et al. (2002). Defects in keratinocyte activation during wound healing in the syndecan-1-deficient mouse. J. Cell Sci. 115, 4517-4531.[Abstract/Free Full Text]

Taraboletti, G., Rao, C. N., Krutzsch, H. C., Liotta, L. A. and Roberts, D. D. (1990). Sulfatide-binding domain of the laminin A chain. J. Biol. Chem. 265, 12253-12258.[Abstract/Free Full Text]

Timpl, R., Tisi, D., Talts, J. F., Andac, Z., Sasaki, T. and Hohenester, E. (2000). Structure and function of laminin LG modules. Matrix Biol. 19, 309-317.[CrossRef][Medline]

Tsubota, Y., Mizushima, H., Hirosaki, T., Higashi, S., Yasumitsu, H. and Miyazaki, K. (2000). Isolation and activity of proteolytic fragment of laminin-5 alpha3 chain. Biochem. Biophys. Res. Commun. 278, 614-620.[CrossRef][Medline]

Utani, A., Nomizu, M., Matsuura, H., Kato, K., Kobayashi, T., Takeda, U., Aota, S., Nielsen, P. K. and Shinkai, H. (2001). A unique sequence of the laminin alpha 3 G domain binds to heparin and promotes cell adhesion through syndecan-2 and -4. J. Biol. Chem. 276, 28779-28788.[Abstract/Free Full Text]

van der Neut, R., Krimpenfort, P., Calafat, J., Niessen, C. M. and Sonnenberg, A. (1996). Epithelial detachment due to absence of hemidesmosomes in integrin beta 4 null mice. Nat. Genet. 13, 366-369.[CrossRef][Medline]

Veitch, D. P., Nokelainen, P., McGowan, K. A., Nguyen, T. T., Nguyen, N. E., Stephenson, R., Pappano, W. N., Keene, D. R., Spong, S. M., Greenspan, D. S. et al. (2003). Mammalian tolloid metalloproteinase, and not matrix metalloprotease 2 or membrane type 1 metalloprotease, processes laminin-5 in keratinocytes and skin. J. Biol. Chem. 278, 15661-15668.[Abstract/Free Full Text]

Wayner, E. A. and Carter, W. G. (1987). Identification of multiple cell adhesion receptors for collagen and fibronectin in human fibrosarcoma cells possessing unique alpha and common beta subunits. J. Cell Biol. 105, 1873-1884.[Abstract/Free Full Text]

Winder, S. J. (2001). The complexities of dystroglycan. Trends Biochem. Sci. 26, 118-124.[CrossRef][Medline]

Xia, Y., Gil, S. G. and Carter, W. G. (1996). Anchorage mediated by integrin alpha6beta4 to laminin 5 (epiligrin) regulates tyrosine phosphorylation of a membrane-associated 80-kD protein. J. Cell Biol. 132, 727-740.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Mol. Biol. CellHome page
E. Araki, Y. Momota, T. Togo, M. Tanioka, K. Hozumi, M. Nomizu, Y. Miyachi, and A. Utani
Clustering of Syndecan-4 and Integrin {beta}1 by Laminin {alpha}3 Chain-derived Peptide Promotes Keratinocyte Migration
Mol. Biol. Cell, July 1, 2009; 20(13): 3012 - 3024.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
M. L. Usui, J. N. Mansbridge, W. G. Carter, M. Fujita, and J. E. Olerud
Keratinocyte Migration, Proliferation, and Differentiation in Chronic Ulcers From Patients With Diabetes and Normal Wounds
J. Histochem. Cytochem., July 1, 2008; 56(7): 687 - 696.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Tran, P. Rousselle, P. Nokelainen, S. Tallapragada, N. T. Nguyen, E. F. Fincher, and M. P. Marinkovich
Targeting a Tumor-Specific Laminin Domain Critical for Human Carcinogenesis
Cancer Res., April 15, 2008; 68(8): 2885 - 2894.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
T. Ogawa, Y. Tsubota, J. Hashimoto, Y. Kariya, and K. Miyazaki
The Short Arm of Laminin {gamma}2 Chain of Laminin-5 (Laminin-332) Binds Syndecan-1 and Regulates Cellular Adhesion and Migration by Suppressing Phosphorylation of Integrin beta4 Chain
Mol. Biol. Cell, May 1, 2007; 18(5): 1621 - 1633.
[Abstract] [Full Text] [PDF]


Home page
Br J OphthalmolHome page
P S Tsai, J E Evans, K M Green, R M Sullivan, D A Schaumberg, S M Richards, M R Dana, and D A Sullivan
Proteomic analysis of human meibomian gland secretions.
Br J Ophthalmol, March 1, 2006; 90(3): 372 - 377.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
E. G. Harper, S. M. Alvares, and W. G. Carter
Wounding activates p38 map kinase and activation transcription factor 3 in leading keratinocytes
J. Cell Sci., August 1, 2005; 118(15): 3471 - 3485.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Tsubota, C. Yasuda, Y. Kariya, T. Ogawa, T. Hirosaki, H. Mizushima, and K. Miyazaki
Regulation of Biological Activity and Matrix Assembly of Laminin-5 by COOH-terminal, LG4-5 Domain of {alpha}3 Chain
J. Biol. Chem., April 15, 2005; 280(15): 14370 - 14377.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jcs.01310v1
117/19/4481    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sigle, R. O.
Right arrow Articles by Carter, W. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sigle, R. O.
Right arrow Articles by Carter, W. G.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?