|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online November 24, 2004
doi: 10.1242/10.1242/jcs.01543
Research Article |
Department of Cell Biology and Anatomy, Chicago Medical School, 3333 Green Bay Road, North Chicago, IL 60064, USA
* Author for correspondence (e-mail: joseph.dimario{at}rosalindfranklin.edu)
Accepted 15 September 2004
| Summary |
|---|
|
|
|---|
Key words: Myosin heavy chain, Ryanodine, Avian, Skeletal muscle, Fiber type
| Introduction |
|---|
|
|
|---|
Similarly, a subset of avian secondary muscle fibers formed from fetal myoblasts expresses the slow MyHC2 gene in vivo. However, this expression is partly dependent on functional innervation. Administration of curare during embryonic and fetal chick development reduced slow MyHC2 gene expression in secondary muscle fibers of the medial adductor (Crow and Stockdale, 1986
; DiMario and Funk, 1999
). In addition, slow MyHC2 gene expression in fetal muscle fibers is regulated in a fiber type dependent manner in vitro (DiMario and Stockdale, 1997
). Muscle fibers formed from fetal medial adductor (MA) myoblasts in vitro expressed the slow MyHC2 gene only when innervated. By contrast, muscle fibers formed from fetal pectoralis major (PM) myoblasts did not express the slow MyHC2 gene, whether the fibers were innervated or not by the same pool of neurons.
The calcium-calmodulin-dependent protein phosphatase, calcineurin, has been proposed to be a mediator of a signaling cascade based on cell specific calcium transients leading to activation of muscle fiber type specific gene promoters. Its activity has been linked to dephosphorylation and activation of the transcription factor myocyte enhancer factor 2 (MEF2). MEF2 belongs to the family of MADS box transcription factors and binds to A/T-rich cis-elements in muscle-specific promoters. MEF2 binding sites are present in a variety of muscle-specific genes characteristic of both fast and slow muscle fiber types [e.g. MyHCIIa and troponin I-slow (TnIs) and myosin light chain 2 slow genes] (Dunn et al., 2001
; Esser et al., 1999
). MEF2 activity is dependent on its phosphorylation state (Wu et al., 2001
). Dephosphorylation of MEF2 by calcineurin in response to nerve activity has been proposed as a mechanism for MEF2-mediated transcription of fiber type specific genes (Dunn et al., 2001
).
Calcineurin also regulates activation of the nuclear factor of activated T cells (NFAT) transcription factor. Dephosphorylation of NFAT causes nuclear import and subsequent activation of NFAT-dependent promoters (Beals et al., 1997
; Crabtree, 2001
). The calcineurin-NFAT signaling pathway is potentially a mechanism by which cells decode complex calcium signaling. However, the complexity of calcium signaling has extended beyond the calcineurin-NFAT interactions, as it is now clear that multiple regulatory effects modulate the direct activation of NFAT by calcineurin. Some muscle-specific promoters such as the myoglobin and TnIs promoters are upregulated by constitutively active calcineurin (Chin et al., 1998
). Therefore, on the basis of the activation of genes associated with the slow muscle fiber phenotype, it has been proposed that calcineurin-NFAT activation by slow muscle fiber calcium transients selectively regulates slow muscle fiber specific genes. This hypothesis was supported by in vivo studies in which inhibition of calcineurin by cyclosporine A reduced slow type I fiber composition in regenerating rat soleus muscle (Serrano et al., 2001
). However, discordance in the unidirectional activation of slow muscle fiber specific genes by calcineurin activation of NFAT has also been reported. Calcineurin, but not NFATc3, increased slow MyHC gene expression in C2C12 cells (Delling et al., 2000
). Furthermore, fiber type specific calcium transients, calcineurin and NFAT also regulate fast muscle fiber specific genes. The fast MyHCIIa promoter was activated by increased calcium, NFAT and MEF2 (Allen and Leinwand, 2002
). The avian slow MyHC2 promoter in slow muscle fibers is activated by both NFAT and MEF2, and both are required for innervation-induced expression of the slow muscle fiber phenotype (Jiang et al., 2004
). Furthermore, regulation of NFAT transcriptional activity was fiber-type dependent. Innervation of slow muscle fibers preferentially activated NFAT-dependent reporter genes relative to innervated fast muscle fibers. However, constitutively active NFAT in the presence of MEF2 activity was not sufficient to induce slow MyHC2 promoter activity. In total, these studies indicated that NFAT and MEF2 participate in transcriptional regulation of muscle and fiber type specific genes and that fiber type specific mechanisms control activation of these factors.
Repression of slow MyHC2 gene expression in innervated avian fast muscle fibers is mediated by a signal transduction cascade initiated by innervation itself. Release of acetylcholine from motor neurons at neuromuscular junctions is sufficient to activate vasodilation of muscle-associated arterioles via the muscarinic acetylcholine receptor (mAchR) as well as muscle fiber activity via the nicotinic acetylcholine receptor (nAchR) (Welsh and Segal, 1997
). Inhibition of mAchR activity and associated signaling via G
q in innervated fast muscle fibers is sufficient to induce slow MyHC2 gene expression (Jordan et al., 2003
). Similarly, slow MyHC2 gene expression is induced in muscle fibers in which protein kinase C (PKC) activity is reduced (DiMario, 2001
; DiMario and Funk, 1999
). Conversely, slow MyHC2 gene expression is repressed by increased PKC activity.
Excitation-contraction coupling in both fast and slow skeletal muscle fibers involves calcium release from intracellular stores. Intracellular calcium levels briefly rise to
1 µM in fast fibers and to a more sustained increase of
200 nM in slow fibers (Chin and Allen, 1996
). The longer duration and lower amplitude calcium transient in slow muscle fibers is thought to activate calcineurin and NFAT (Timmerman et al., 1996
; Dolmetsch et al., 1997
). The initial release of calcium from the sarcoplasmic reticulum (SR) is mediated by the voltage-sensitive dihydropyridine receptor (DHPR) and by its physical interaction with the large sarcoplasmic reticulum (SR)-associated ryanodine receptor (RyR) - a tetrameric calcium release channel with individual polypeptide subunits of 565 kDa (Sutko and Airey, 1996
). The RyR is also characterized by its high affinity for the plant alkaloid, ryanodine, which inhibits RyR-mediated calcium release. RyRs display single channel conductance resulting in localized transient increases in intracellular calcium in the form of calcium sparks (Nelson et al., 1995
). Genes encoding three distinct isoforms of the RyR have been cloned from mammals and sequenced. The use of isoform-specific nucleotide probes and antibodies has shown a wide distribution of RyR isoforms in various tissues. RyR1 is the predominant RyR isoform in vertebrate skeletal muscle (Takeshima et al., 1989
). RyR2 is abundant in cardiac muscle (Otsu et al., 1990
), and RyR3 is present in brain tissue (Hakamata et al., 1992
). In addition to the three mammalian RyR isoforms, a slow fiber type specific isoform, termed RyR1-slow, has been identified in fish skeletal muscle (Franck et al., 1998
; Morrissette et al., 2000
). However, to date no mammalian or avian fiber type specific variant isoform of RyR1 has been found.
The differential calcium transients of fast and slow muscle fibers, released partly by RyR1, potentially affect several signaling pathways. For instance, PKC
isoform activity, which is abundant in skeletal muscle, is dependent on calcium, and its activity is increased in fast versus slow muscle fibers (DiMario and Funk, 1999
; Donnelly et al., 1994
). Calcineurin is maximally activated by low amplitude, long duration calcium transients indicative of slow muscle fiber type calcium regulation (Dolmetsch et al., 1997
). In addition, regulation of calcium release via RyR1 in skeletal muscle may be regulated by interactions between calcineurin and RyR1 via the RyR1 accessory protein, FKBP12 (Shin et al., 2002
).
In the present study, the control of slow MyHC2 gene expression and the slow muscle fiber phenotype by RyR activity in innervated fast and slow muscle fibers is examined. RyR activity was inhibited by ryanodine, and the effects on slow MyHC2 gene expression and promoter activity were assessed. RyR activity-induced NFAT and MEF2 transcription factor activation were also assessed by the use of transcription factor-specific reporter genes and interactions with the slow MyHC2 promoter.
| Materials and Methods |
|---|
|
|
|---|
Immunocytochemistry and western blots
Cells were immunostained on day 7 of incubation. All procedures were performed at room temperature. Cells were washed three times with phosphate buffered saline (PBS), pH 7.2, and then fixed. For immunodetection of fast MyHCs and slow MyHC2, cells were fixed with 100% ethanol for 5 minutes. For immunodetection of RyR1, cells were fixed with 3.7% paraformaldehyde and permeabilized with 0.1% Triton X-100 for 10 minutes. Cells were washed three times with PBS and blocking solution consisting of 5% horse serum and 2% bovine serum albumin (BSA) in PBS was added to the cells for 1 hour. F59 and S58 monoclonal antibodies that specifically recognize fast MyHCs and slow MyHC2, respectively, were diluted 1:10 in blocking solution and added to the cells for 1 hour. The generation and specificities of these antibodies have been previously described (Crow and Stockdale, 1986
). RyR1 antibody (Affinity Bioreagents) was diluted 1:100 in blocking solution and added to the cells for 1 hour. Cells were washed three times with PBS and incubated in fluorochrome-conjugated secondary antibodies diluted 1:100 in blocking solution. FITC-conjugated anti-rabbit IgG (Vector Labs) detected the RyR1 antibody. F59 and S58 antibodies were detected with Texas Red-conjugated anti-mouse IgG (Vector Labs) and FITC-conjugated anti-mouse IgA (Southern Biotech). Cells were washed three times with PBS, and a drop of 2.5% diazabicyclooctane in 90% glycerol was added before viewing by epifluorescence.
Protein for western blot analysis was extracted from ED13 whole muscle and muscle fiber cultures on day 7 of incubation using 0.5 ml 20 mM Tris, pH 7.5, 0.5 mM ethylenediaminetetraacetic acid (EDTA), 0.5 mM ethyleneglycotetraacetic acid (EGTA), 0.5% Triton X-100, plus protease inhibitors (Boehringer Mannheim). Cells were homogenized in a glass dounce homogenizer, and the extracts were set on ice for 10 minutes. Protein extracts were clarified by centrifugation at 20,000 g for 5 minutes in an Eppendorf centrifuge. Protein concentrations were determined using a BCA protein assay reagent (Pierce). Protein was denatured at 95°C for 5 minutes in SDS-PAGE sample buffer, electrophoresed in a 7.5% SDS polyacrylamide gel and transferred to a nitrocellulose membrane. Blots were incubated in blocking solution consisting of 2% nonfat dry milk, 0.05% Tween-20 in PBS for 2 hours. RyR1 and
-actin (Sigma) antibodies were diluted 1:2500 and 1:2000 in blocking solution, respectively, and incubated with the blots for 1 hour. Blots were washed three times with PBS and then incubated for 1 hour in horseradish peroxidase (HRP)-conjugated anti-rabbit IgG (Santa Cruz Biotech) for RyR1 blots and HRP-conjugated anti-mouse IgM (Sigma) for
-actin blots diluted 1:500 and 1:1000, respectively. Blots were washed as before and developed by chemiluminescence (Pierce).
PKC activity assays
PKC activities were determined in muscle fiber cultures on day 7 of incubation. Cells were washed once with PBS and homogenized in cold 25 mM Tris, pH 7.2, 1 mM EDTA, 50 mM NaCl and protease inhibitors. Supernatants were clarified by centrifugation at 20,000 g for 10 minutes at 4°C in an Eppendorf centrifuge. Membrane pellets were resuspended in extraction buffer containing 0.5% Triton X-100 and set on ice for 30 minutes. The extracts were centrifuged as before and membrane protein fractions were collected. Protein concentrations were determined using a BCA protein assay reagent (Pierce). PKC activities were determined using a PKC assay kit (Upstart Biotech) according to the manufacturer's protocol.
DNA transfections
Myogenic cultures were transfected on day 2 of incubation with the full-length wild-type slow MyHC2 promoter-luciferase reporter construct, 2279SM2Luc (3 µg/35 mm dish). This construct has been previously characterized (Jiang et al., 2004
). NFAT and MEF2 sensor constructs containing multimerized NFAT and MEF2 binding sites, respectively, coupled to the luciferase gene (3 µg/35 mm dish) were kindly provided by E. Olson (University of Texas Southwestern Medical Center, Dallas, TX). The serum response element (SRE) sensor construct, SRELuc, was obtained from Stratagene. Transfection of pSVßGAL (1 µg/35 mm dish) served as a control of transfection efficiency. Constructs were transfected using Lipofectamine Plus (Invitrogen). Reporter gene assays were performed on day 7 of incubation. Luciferase activities from 2279SM2Luc and the NFAT, MEF2 and SRE sensors were normalized to ß-galactosidase activities derived from pSVßGAL transfection.
Electromobility shift assays (EMSAs)
Nuclear extracts from PM and MA muscle fiber cultures were prepared as previously described (Parakati and DiMario, 2002
). Protein content was determined by BCA protein assay (Pierce). Complementary oligonucleotides containing either the MEF2 or NFAT binding sites of the slow MyHC2 promoter were commercially synthesized (Integrated DNA Technology). The MEF2 oligonucleotide consisted of the sequence, 5' ACAGGAGTAAAAATAACCAGGCTG 3' and its complement. The NFAT oligonucleotide consisted of the sequence 5' GAGGCAGAAAGGAAAGCTCTCAGT 3' and its complement. EMSA reactions were prepared as previously described (Parakati and DiMario, 2002
). MEF2A and NFATc1 antibodies (4 µg) were added to the reaction mixtures and incubated overnight at 4°C. Protein-DNA complexes were resolved by 5% nondenaturing polyacrylamide gel electrophoresis with 1X Tris borate EDTA buffer. Gels were dried and exposed to x-ray film overnight or for 7 days (NFAT supershifts).
Statistics
Differences in mean values were assessed by Student's t-test with significant differences set at P<0.05.
| Results |
|---|
|
|
|---|
|
Immunodetection of RyR1 in PM and MA muscle fiber cultures
Although three isoforms of RyR have been described, RyR1 is the predominant isoform expressed in skeletal muscle (McPherson and Campbell, 1997; Franzini-Armstrong and Jorgensen, 1994
). RyR3 may be transiently expressed during development of some muscle fibers or exist in minor abundance (Flucher et al., 1999
). To detect RyR1 in PM and MA muscle fibers in vitro, innervated and noninnervated cultures of each were immunostained with an RyR1-specific antibody (Fig. 2A). All muscle fibers contained RyR1. However, any obvious differences in the amount of RyR1 in these cultures were not observed. To more critically determine whether differences in RyR1 abundance existed in the different muscle fiber types, western blots of PM and MA muscle fibers were developed with the RyR1 antibody and quantitated (Fig. 2B,C). Western blots and RT-PCR analyses of muscle fiber cultures revealed expression of RyR1, but not RyR3 (data not shown). Extracts from ED13 PM in vivo contained significantly (P<0.03) more RyR1 than ED13 MA in vivo. Similarly, RyR1 was more abundant in noninnervated PM versus MA (P<0.03) and innervated PM versus MA (P<0.01). These results indicate that fast muscle fibers whether innervated or not contain significantly greater amounts of RyR1 relative to slow muscle fibers.
|
Ryanodine and innervation inhibit protein kinase C activity
We have previously shown that inhibition of PKC activity was sufficient to induce slow MyHC2 gene expression in noninnervated MA muscle fibers and that PKC inhibition in conjunction with innervation induced slow MyHC2 gene expression in fast PM muscle fibers (DiMario and Funk, 1999
; DiMario, 2001
). Furthermore, increased PKC activity repressed slow MyHC2 gene expression. Therefore, we hypothesized that administration of ryanodine to PM and MA muscle fibers would lower PKC activity and that the ryanodine-induced pattern of slow MyHC2 gene expression in PM muscle fibers correlated with reduced PKC activities. To address this hypothesis, PKC activities in innervated and noninnervated PM and MA muscle fiber cultures incubated in medium with or without 100 µM ryanodine were determined (Fig. 3). In PM muscle fibers, PKC activity was not significantly reduced by innervation or ryanodine alone. However, the combination of both innervation and ryanodine significantly reduced (P<0.05) PKC activity in these fibers. The combined effects of innervation and ryanodine had elicited slow MyHC2 gene expression in fast PM muscle fibers (Fig. 1). In MA muscle fibers, innervation alone significantly reduced PKC activity relative to noninnervated control MA muscle fibers, and inhibition of RyR1 activity in innervated MA muscle fibers did not further reduce PKC activity. These results indicate that RyR1 activity in PM muscle fibers normally enhances PKC activity.
|
RyR1 activity regulates the slow MyHC2 promoter
To determine the extent to which RyR1 activity regulates slow MyHC2 gene expression, the slow MyHC2 promoter, containing 1358 bp of DNA upstream from coding sequence, coupled to the luciferase reporter gene was transfected into PM and MA myogenic cultures. This slow MyHC2 promoter sequence and its partial characterization have been previously reported (Jiang et al., 2004
). Innervation was provided to half of the transfected PM and MA muscle fiber cultures by the addition of spinal cord explants, and cells were incubated in control medium or medium containing 100 µM ryanodine. The resulting slow MyHC2 promoter activities are presented in Fig. 4. Slow MyHC2 promoter activity in MA muscle fibers was increased 2.5-fold by innervation in agreement with previous findings (Jiang et al., 2004
). In PM muscle fiber cultures, addition of innervation or ryanodine alone did not significantly increase slow MyHC2 promoter activity. However, addition of both innervation and 100 µM ryanodine caused a significant (P<0.02) 2.3-fold increase in slow MyHC2 promoter activity. These results are in agreement with the immunofluorescent detection of slow MyHC2 in PM muscle fibers cultured only in the presence of both innervation and ryanodine (Fig. 1).
|
RyR1 activity regulates NFAT and MEF2 activities
Transcription of the slow MyHC2 gene is dependent on NFAT and MEF2 transcription factors (Jiang et al., 2004
). In addition, we have previously shown that NFAT transcriptional activity in MA muscle fibers is regulated by innervation. Therefore, we hypothesized that the regulation of slow MyHC2 gene expression by RyR1 in PM muscle fibers was also mediated by regulation of NFAT and MEF2 transcription factor activities. To determine the effects of ryanodine treatment on NFAT and MEF2 activities, NFATLuc and MEF2Luc sensor constructs were individually transfected into PM myogenic cultures. Half of the muscle fiber cultures received spinal cord explants with control medium or with medium containing 100 µM ryanodine. NFAT-mediated transcriptional activity was not significantly affected in PM muscle fibers by innervation or ryanodine alone compared with noninnervated muscle fibers in control medium (Fig. 5). However, the combination of innervation and ryanodine caused a significant (P<0.05) increase of 2.6-fold in NFAT-mediated transcription. Similar results were obtained with the MEF2Luc sensor (Fig. 5). Innervation or ryanodine treatment alone did not significantly affect MEF2-mediated transactivation of the MEF2Luc sensor. The combinatorial effects of innervation and RyR1 inhibition caused a twofold increase (P<0.02) in MEF2 activity relative to noninnervated muscle fibers in control medium. In addition, incubation of innervated muscle fibers in medium containing ryanodine caused a significant (P<0.05) increase in MEF2 activity relative to innervated muscle fibers in control medium. As a control to determine whether the increased transcriptional activity was specific to NFAT and MEF2 transcription factors versus a generalized increase in transcription factor function, SREluc containing the serum response element (SRE) binding site for serum response factor was also transfected into the myogenic cells. Transcriptional activity via the SRE of the SRELuc sensor did not increase under these experimental conditions (Fig. 5, lower panel). These results indicate that inhibition of RyR1 enhances NFAT and MEF2-mediated transcription.
|
RyR1 inhibition increases NFAT and MEF2 binding to their respective binding sites in the slow MyHC2 promoter
NFAT and MEF2 transcription factor activities in skeletal muscle are dependent on calcium signaling events and innervation (Jiang et al., 2004
). To determine whether NFAT and MEF2 occupancy of their respective binding sites in the slow MyHC2 promoter was regulated by RyR1 activity, electromobility shift and supershift assays were performed using nuclear extracts from PM and MA muscle fibers cultured in the absence and presence of innervation as well as 100 µM ryanodine. Nuclear extracts of innervated PM muscle fibers cultured in medium containing 100 µM ryanodine formed a protein-DNA complex with the slow MyHC2 NFAT binding site (Fig. 6A). Nuclear extracts from PM muscle fibers without innervation or ryanodine did not form this complex. In addition, innervated PM muscle fibers cultured in control medium and noninnervated PM muscle fibers cultured in medium with ryanodine did not form this protein-DNA complex. Nuclear extracts from innervated MA muscle fibers formed a similar protein-DNA complex with and without ryanodine. However, no protein-DNA complex was detected from nuclear extracts without innervation. The differentially regulated protein-DNA complex formed by PM and MA nuclear extracts was supershifted by inclusion of an NFATc1 antibody (Fig. 6B). These results indicate that RyR1 activity in innervated PM muscle fibers inhibits NFATc1 occupancy of the slow MyHC2 promoter which is required for full promoter activation.
|
Electromobility shift assays of the same nuclear extracts with the slow MyHC2 MEF2 binding site oligonucleotide yielded similar, but not identical, results (Fig. 7A). Addition of ryanodine to the culture medium caused the formation of a specific protein-DNA complex. Similarly, innervation of PM muscle fibers caused the formation of a shifted complex. Formation of this complex was enhanced by the addition of ryanodine to innervated PM muscle fibers. A shifted complex formed using extracts from noninnervated MA muscle fibers cultured in medium containing ryanodine. Formation of this complex was enhanced using extracts from innervated MA muscle fibers in control medium, but was not obviously further enhanced by addition of ryanodine to innervated MA muscle fibers. The specific protein-DNA complex formed by PM and MA nuclear extracts was supershifted by inclusion of a MEF2A antibody (Fig. 7B). These results indicate that RyR1 activity inhibits MEF2 occupancy of the slow MyHC2 promoter which is required for full promoter activity in PM muscle fibers. The combinatorial effects of innervation and RyR1 inhibition in PM muscle fibers resulted in maximal MEF2 binding to the slow MyHC2 promoter, and it was these conditions that resulted in slow MyHC2 gene expression (Fig. 1).
|
| Discussion |
|---|
|
|
|---|
Secondary muscle fibers of chicken skeletal muscle express either fast MyHC genes exclusively or both fast MyHC genes and slow MyHC2. Therefore, expression of the slow MyHC2 gene is a significant distinguishing feature of diverse fiber types in chicken muscle. Partial characterization of the transcriptional regulatory mechanism of the slow MyHC2 gene has been reported (Jiang et al., 2004
). Slow MyHC2 promoter activity is dependent on innervation and the transcription factors NFAT and MEF2. Furthermore, regulation of slow MyHC2 gene expression was restricted in a fiber type specific manner. Innervation was sufficient to induce NFAT activation, slow MyHC2 promoter activation and expression of the endogenous slow MyHC2 gene in slow MA muscle fibers. However, innervation of fast PM muscle fibers did not induce NFAT transcriptional activity or slow MyHC2 promoter activity.
On the basis of the role of RyR as a regulator of innervation-induced Ca2+ release and thereby intracellular Ca2+ concentration, and on the basis of the knowledge that slow MyHC2 promoter activity is dependent on innervation, NFAT and MEF2, we hypothesized that disruption of RyR activity in skeletal muscle cells would affect slow MyHC2 gene expression. More specifically, we hypothesized that reduction of RyR activity by ryanodine would induce slow MyHC2 gene expression in innervated fast PM muscle fibers, mimicking the pattern of gene expression displayed by innervated slow MA muscle fibers with normal RyR activity. As a corollary hypothesis, RyR activity normally inhibits slow MyHC2 gene expression in fast PM muscle fibers.
To address these hypotheses, the well-defined RyR1 inhibitor, ryanodine, was added to cultures of innervated and noninnervated PM and MA muscle fibers. As previously observed, innervated MA muscle fibers expressed the slow MyHC2 gene, whereas innervated PM muscle fibers in control medium did not. However, inclusion of 100 µM ryanodine in the medium of innervated PM muscle fibers induced slow MyHC2 gene expression. These results indicate that fiber type identity based on MyHC gene expression is dependent on innervation and regulated Ca2+ release via the RyR1 after muscle fiber depolarization.
Multiple signaling molecules regulate slow MyHC2 gene expression in MA and PM muscle fibers. Many of these signaling molecules and transcription factors are themselves regulated by intracellular Ca2+. Slow MyHC2 gene expression is repressed in PM muscle fibers by G
q signaling leading to increased PKC activity (Jordan et al., 2003
). In noninnervated MA muscle fibers, slow MyHC2 gene expression is induced by a reduction of PKC activity, and slow MyHC2 gene expression is repressed in innervated MA muscle fibers by increased PKC activity (DiMario, 2001
; DiMario and Funk, 1999
). PKC
, a predominant PKC isoform in skeletal muscle, is activated by Ca2+. Therefore, we hypothesized that PKC activity is dependent on RyR1 activity and that inhibition of RyR1 activity would decrease PKC activity. Addition of ryanodine to noninnervated PM and MA muscle fibers did not significantly reduce PKC activity. This was probably due to the inability of ryanodine to inhibit RyR activity in muscle fibers in which RyR was not activated by innervation. Addition to innervated PM muscle fibers did significantly reduce PKC activity. The data suggest that Ca2+ release via PM RyR1, which is two to three times more abundant than MA RyR1, results in a high amplitude Ca2+ spike, providing a positive regulator of PKC activity. This is further suggested by previous reports of increased PKC activity in fast versus slow avian and mammalian muscle fibers (DiMario and Funk, 1999
; Donnelly et al., 1994
).
Regulated Ca2+ release has also been proposed as a mechanism by which the activities of transcription factors NFAT and MEF2 are controlled. The slow MyHC2 promoter is dependent on NFAT and MEF2 transactivation in MA muscle fibers (Jiang et al., 2004
). To determine whether inhibition of RyR1 by ryanodine affected slow MyHC2 promoter activity, innervated and noninnervated PM and MA muscle fibers transfected with the slow MyHC2 promoter-luciferase construct were incubated in control medium and medium with 100 µM ryanodine. As shown previously (Jiang et al., 2004
), slow MyHC2 promoter activity significantly increased in MA muscle fibers because of innervation. In PM muscle fibers, innervation or ryanodine treatment alone did not significantly increase promoter activity in fast PM muscle fibers. However, the combinatorial effects of innervation and ryanodine treatment significantly increased slow MyHC2 promoter activity in PM muscle fibers. This increase in promoter activity was reflected by significant increases in NFAT- and MEF2-mediated transcriptional activity. Additionally, activation of the slow MyHC2 promoter by innervation and ryanodine was reflected by occupancy of the NFAT and MEF2 binding sites within the promoter by NFATc1 and MEF2A.
These results suggest that RyR1 activity in innervated PM and MA muscle fibers differentially regulates slow MyHC2 gene expression. In MA muscle fibers, slow MyHC2 gene expression is positively regulated by innervation and the subsequent release of Ca2+ via RyR1 activity. However, in fast PM muscle fibers, innervation represses slow MyHC2 gene expression via RyR1 activity. It is likely that the fiber type specific activity of RyR1 controls Ca2+ release to establish fiber type specific conditions that either activate (MA muscle fibers) or repress (PM muscle fibers) slow MyHC2 gene expression. Further evidence of this regulation was detected by decreased slow MyHC2 promoter activity in innervated MA muscle fibers in the presence of ryanodine. These results suggest the testable hypothesis that defined ranges of intracellular Ca2+ regulate downstream effector molecules such as PKC, NFAT and MEF2. Increased Ca2+ amplitudes via increased RyR1 activity, characteristic of fast muscle fibers, appear to activate signaling components (e.g. PKC) that repress slow MyHC2 gene expression. Conversely, the lower amplitude, longer duration Ca2+ transient characteristic of slow muscle fibers may activate slow MyHC2 gene transcription.
| References |
|---|
|
|
|---|
Allen, D. L. and Leinwand, L. A. (2002). Intracellular calcium and myosin isoform transitions. Calcineurin and calcium-calmodulin kinase pathways regulate preferential activation of the IIa myosin heavy chain promoter. J. Biol. Chem. 277, 45323-45330.
Beals, C. R., Clipstone, N. A., Ho, S. N. and Crabtree, G. R. (1997). Nuclear localization of NF-ATc by a calcineurin-dependent, cyclosporine-sensitive intramolecular interaction. Genes Dev. 11, 824-834.
Buck, E., Zimanyi, I., Abramson, J. J. and Pessah, I. N. (1992). Ryanodine stabilizes multiple conformational states of the skeletal muscle calcium release channel. J. Biol. Chem. 267, 23560-23567.
Celio, M. R. and Heizmann, C. W. (1983). Calcium-binding protein parvalbumin is associated with fast contracting muscle fibres. Nature 297, 504-506.
Chin, E. R. and Allen, D. G. (1996). Changes in intracellular free Ca2+ concentration during constant 10 Hz stimulation of mouse single skeletal muscle fibres. Physiologist 39, A75.
Chin, E. R., Olson, E. N., Richardson, J. A., Yang, Q., Humphries, C., Shelton, J. M., Wu, H., Zhu, W., Bassel-Duby, R. et al. (1998). A calcineurin-dependent transcriptional pathway controls skeletal muscle fiber type. Genes Dev. 12, 2499-2509.
Crabtree, G. R. (2001). Calcium, calcineurin, and the control of transcription. J. Biol. Chem. 276, 2313-2316.
Crow, M. T. and Stockdale, F. E. (1986). Myosin expression and specialization among the earliest muscle fibers of the developing avian limb. Dev. Biol. 113, 238-254.[CrossRef][Medline]
Delling, U., Tureckova, J., Lim, H. W., DeWindt, L. J., Rotwein, P. and Molkentin, J. D. (2000). A calcineurin-NFATc3-dependent pathway regulates skeletal muscle differentiation and slow myosin heavy-chain expression. Mol. Cell. Biol. 20, 6600-6611.
DiMario, J. X. (2001). Protein kinase C signaling controls skeletal muscle fiber types. Exp. Cell Res. 263, 23-32.[CrossRef][Medline]
DiMario, J. X. and Funk, P. E. (1999). Protein kinase C activity regulates slow myosin heavy chain 2 gene expression in slow lineage skeletal muscle fibers. Dev. Dyn. 216, 177-189.[CrossRef][Medline]
DiMario, J. X. and Stockdale, F. E. (1997). Both myoblast lineage and innervation determine fiber type and are required for expression of the slow myosin heavy chain 2 gene. Dev. Biol. 188, 167-180.[CrossRef][Medline]
Dolmetsch, R. E., Lewis, R. S., Goodnow, C. C. and Healy, J. I. (1997). Differential activation of transcription factors induced by Ca2+ response amplitude and duration. Nature 386, 855-858.[CrossRef][Medline]
Donnelly, R., Reed, M. J., Azhar, S. and Reaven, G. M. (1994). Expression of the major isoenzyme of protein kinase-C in skeletal muscle, nPKC
, varies with muscle type and in response to fructose-induced insulin resistance. Endocrinology 135, 2369-2374.[Abstract]
Dunn, S. E., Simard, A. R., Bassel-Duby, R., Williams, R. S. and Michel, R. N. (2001). Nerve activity-dependent modulation of calcineurin signaling in adult fast and slow muscle fibers. J. Biol. Chem. 276, 45243-45254.
Esser, K., Nelson, T., Lupa-Kimball, V. and Blough, E. (1999). The CACC box and myocyte enhancer factor-2 sites within the myosin light chain 2 slow promoter cooperate in regulating nerve-specific transcription in skeletal muscle. J. Biol. Chem. 274, 12095-12102.
Flucher, B. E., Conti, A., Takeshima, H. and Sorrentino, V. (1999). Type 3 and type 1 ryanodine receptors are localized in triads of the same mammalian skeletal muscle fibers. J. Cell Biol. 146, 621-630.
Franck, J. P. C., Morrissette, J., Keen, J. E., Londraville, R. L., Beamsley, M. and Block, B. A. (1998). Cloning and characterization of fiber type-specific ryanodine receptor isoforms in skeletal muscles of fish. Am. J. Physiol. 275, C401-C415.
Franzini-Armstrong, C. and Jorgensen, A. O. (1994). Structure and development of E-C coupling units in skeletal muscle. Annu. Rev. Physiol. 56, 509-534.[CrossRef][Medline]
Hakamata, Y., Nakai, J., Takeshima, H. and Imoto, K. (1992). Primary structure and distribution of a novel ryanodine receptor/calcium release channel from rabbit brain. FEBS Lett. 312, 229-235.[CrossRef][Medline]
Jiang, H., Jordan, T., Li, J., Li, H. and DiMario, J. X. (2004). Innervation-dependent and fiber type specific transcriptional regulation of the slow myosin heavy chain 2 promoter in avian skeletal muscle fibers. Dev. Dyn. 231, 292-302.[CrossRef][Medline]
Jordan, T., Li, J., Jiang, H. and DiMario, J. X. (2003). Repression of slow myosin heavy chain 2 gene expression in fast skeletal muscle fibers by muscarinic acetylcholine receptor and G
q signaling. J. Cell Biol. 162, 843-850.
Kennedy, J. M., Kamel, S., Tambone, W. W., Vrbova, G. and Zak, R. (1986). The expression of myosin heavy chain isoforms in normal and hypertrophied chicken slow muscle. J. Cell Biol. 103, 977-983.
McPherson, P. S. and Campbell, K. P. (1993). The ryanodine receptor/Ca2+ release channel. J. Biol. Chem. 268, 13765-13768.
Miller, J. B. and Stockdale, F. E. (1986). Developmental origins of skeletal muscle fibers: clonal analysis of myogenic cell lineages based on expression of fast and slow myosin heavy chains. Proc. Natl. Acad. Sci. USA 83, 3860-3864.
Morrissette, J., Xu, L., Nelson, A., Meissner, G. and Block, B. A. (2000). Characterization of RyR1-slow, a ryanodine receptor specific to slow-twitch skeletal muscle. Am. J. Physiol. 279, R1889-R1898.
Nelson, M. T., Cheng, H., Rubart, M., Santana, L. F., Bonev, A. D., Knot, H. J. and Lederer, W. J. (1995). Relaxation of arterial smooth muscle by calcium sparks. Science 270, 633-637.
O'Neill, M. C. and Stockdale, F. E. (1972). A kinetic analysis of myogenesis in vitro. J. Cell Biol. 52, 52-65.
Otsu, K., Willard, H. F., Khanna, V. K., Zorzato, F., Green, N. M. and MacLennan, D. H. (1990). Molecular cloning of cDNA encoding the Ca2+ release channel (ryanodine receptor) of rabbit cardiac muscle sarcoplasmic reticulum. J. Biol. Chem. 265, 13472-13483.
Page, S., Miller, J. B., DiMario, J. X., Hager, E. J., Moser, A. and Stockdale, F. E. (1992). Developmentally regulated expression of three slow isoforms of myosin heavy chain: diversity among the first fibers to form in avian muscle. Dev. Biol. 154, 118-128.[CrossRef][Medline]
Parakati, R. and DiMario, J. X. (2002). Sp1- and Sp3-mediated transcriptional regulation of the fibroblast growth factor receptor 1 gene in chicken skeletal muscle cells. J. Biol. Chem. 277, 9278-9285.
Serrano, A. L., Murgia, M., Pallafacchina, G., Calabria, E., Coniglio, P., Lømo, T. and Schiaffino, S. (2001). Calcineurin controls nerve activity-dependent specification of slow skeletal muscle fibers but not muscle growth. Proc. Natl. Acad. Sci. USA 98, 13108-13113.
Shin, D. W., Pan, Z., Bandyopadhyay, A., Bhat, M. B., Kim, D. H. and Ma, J. (2002). Ca2+-dependent interaction between FKBP12 and calcineurin regulates activity of the Ca2+ release channel in skeletal muscle. Biophys. J. 83, 2539-2549.
Stockdale, F. E. (1992). Myogenic cell lineages. Dev. Biol. 154, 284-298.[CrossRef][Medline]
Sutko, J. L. and Airey, J. A. (1996). Ryanodine receptor Ca2+ release channels: does diversity in form equal diversity in function? Physiol. Rev. 76, 1027-1071.
Takeshima, H., Nishimura, S., Matsumoto, T., Ishida, H., Kangawa, K., Minamino, N., Matsuo, H., Ueda, M., Hanaoka, M. and Hirose, T. (1989). Primary structure and expression from complementary DNA of skeletal muscle ryanodine receptor. Nature 339, 439-445.[CrossRef][Medline]
Timmerman, L. A., Clipstone, N. A., Ho, S. N., Northrop, J. P. and Crabtree, G. R. (1996). Rapid shuttling of NF-AT in discrimination of Ca2+ signals and immunosuppression. Nature 383, 837-840.[CrossRef][Medline]
Welsh, D. G. and Segal, S. S. (1997). Coactivation of resistance vessels and muscle fibers with acetylcholine release from motor neurons. Am. J. Physiol. 273, H156-H163.
Wu, H., Rothermel, B., Kanatous, S., Rosenberg, P., Naya, F. J., Shelton, J. M., Hutcheson, K. A., DiMaio, J. M., Olson, E. N., Bassel-Duby, R. et al. (2001). Activation of MEF2 by muscle activity is mediated through a calcineurin-dependent pathway. EMBO J. 20, 6414-6423.[CrossRef][Medline]
Zimanyi, I., Buck, E., Abramson, J. J., Mack, M. M. and Pessah, I. N. (1992). Ryanodine induced persistent inactivation of the Ca2+ release channel from skeletal muscle sarcoplasmic reticulum. Mol. Pharmacol. 42, 1049-1057.[Abstract]
This article has been cited by other articles:
![]() |
H. Shi, J. M. Scheffler, J. M. Pleitner, C. Zeng, S. Park, K. M. Hannon, A. L. Grant, and D. E. Gerrard Modulation of skeletal muscle fiber type by mitogen-activated protein kinase signaling FASEB J, August 1, 2008; 22(8): 2990 - 3000. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Valdes, E. Gaggero, J. Hidalgo, N. Leal, E. Jaimovich, and M. A. Carrasco NFAT activation by membrane potential follows a calcium pathway distinct from other activity-related transcription factors in skeletal muscle cells Am J Physiol Cell Physiol, March 1, 2008; 294(3): C715 - C725. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Sato, S. Wu, M. C. A. Ibarra, Y. K. Hayashi, H. Fujita, M. Tojo, S. J. Oh, I. Nonaka, S. Noguchi, and I. Nishino Congenital neuromuscular disease with uniform type 1 fiber and RYR1 mutation Neurology, January 8, 2008; 70(2): 114 - 122. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-S. Liang, A. Kobiyama, A. Shimizu, T. Sasaki, S. Asakawa, N. Shimizu, and S. Watabe Fast skeletal muscle myosin heavy chain gene cluster of medaka Oryzias latipes enrolled in temperature adaptation Physiol Genomics, April 24, 2007; 29(2): 201 - 214. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Jordan, H. Jiang, H. Li, and J. X. DiMario Regulation of skeletal muscle fiber type and slow myosin heavy chain 2 gene expression by inositol trisphosphate receptor 1 J. Cell Sci., May 15, 2005; 118(10): 2295 - 2302. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||