|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 20 January 2004
doi: 10.1242/jcs.00878
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
Membrane Biochemistry Section, Laboratory of Molecular and Cellular Neurobiology, National Institute of Neurological Disorders and Stroke, The National Institutes of Health, Bethesda, MD 20892, USA
* Author for correspondence (e-mail: fishmanp{at}ninds.nih.gov)
Accepted 17 September 2003
| Summary |
|---|
|
|
|---|
Key words: ß-Adrenergic receptor, Endocytosis, Recycling, Clathrin, Arrestin
| Introduction |
|---|
|
|
|---|
In addition, ß2AR endocytosis is dependent on arrestins (Ferguson et al., 1996
; Goodman et al., 1996
) that were first identified as mediators of agonist-initiated desensitization (Krupnick and Benovic, 1998
; Lefkowitz et al., 1998
). Desensitization involves phosphorylation of ß2AR by protein kinase A and GPCR kinases (GRKs). GRK-mediated phosphorylation targets the receptors for binding of arrestins and uncoupling from Gs (Lohse et al., 1990
; Gurevich et al., 1995
). Arrestins also bind both clathrin and the AP-2 adaptor complex and thereby recruit the receptors into clathrin-coated pits (Goodman et al., 1996
; Laporte et al., 2000
). Following endocytosis, the receptors traffic through divergent endosomal pathways that lead to different fates. Some are resensitized by dephosphorylation, and recycled back to the cell surface (Yu et al., 1993
; Pippig et al., 1995
). Others undergo down-regulation by being targeted to lysosomes where they are degraded (Kallal et al., 1998
; Moore et al., 1999
). Sorting of ß2AR between the two pathways involves a specific sequence at the C terminus of the receptor (Cao et al., 1999
). Mutating this sequence reduces the recycling and increases the down-regulation of ß2AR.
In contrast to our knowledge of ß2AR, less is known about the internalization of ß1AR. As the human ß1AR is less susceptible to agonist-mediated internalization than ß2AR (Suzuki et al., 1992
; Green and Liggett, 1994
; Zhou et al., 1995
; Shiina et al., 2000
), it may use a different endocytic pathway. In this regard, not all GPCRs are internalized through the clathrin-mediated, dynamin- and arrestin-dependent pathway including subtypes of the same receptor family (Vickery and von Zastrow, 1999
; Claing et al., 2000
). Several GPCRs are internalized through caveolae (de Weerd and Leeb-Lundberg, 1997
; Feron et al., 1997
). Both ß1AR and ß2AR have been reported to be located in caveolae (Schwencke et al., 1999
; Ostrom et al., 2001
) but other studies have found only ß2AR to be targeted to caveolae (Rybin et al., 2000
). If the two subtypes do reside in different plasma membrane microdomains, they may not use the same endocytic pathway. Moreover, even if both subtypes are endocytosed via clathrin-coated pits, they may be sorted into divergent endosomal pathways (Tsao et al., 2001
). Whether divergence occurs before or after endocytosis, it may result in differences in the recycling and down-regulation of the two subtypes. It also may regulate subtype interaction with alternative signaling pathways through scaffolding complexes (Pierce et al., 2000
; Ferguson, 2001
). Thus, ß2AR couples to both Gs and Gi whereas ß1AR only activates Gs, which allows the two subtypes to mediate different physiological responses in the heart, both normal and pathological (Xiao, 2000
; Zhu et al., 2001
).
The present study was undertaken to identify the endocytic route of ß1AR and compare it with that of ß2AR using a combination of biochemical and morphological approaches. In the course of demonstrating that both subtypes undergo arrestin- and dynamin-dependent, clathrin-mediated endocytosis, we observed that each is sorted to a different endosomal compartment. We believe our findings will have important implications for the function and regulation of both ß-subtypes.
| Materials and Methods |
|---|
|
|
|---|
Plasmid construction
The expression vectors Zem228c and Zem229 from E. Mulvihill (Zymogenetics, Seattle, WA) have an inducible metallothionein promoter, and neomycin or dihydrofolate reductase selectable markers, respectively. The vector pEGFP-N1, encoding an enhanced, red-shifted GFP variant, was from Clontech (Palo Alto, CA). The following constructs have been described previously: Zem228c-ß1AR and -ß2AR (Zhou et al., 1995
), pcDNA3-arrestin-2 and -3, -dynamin-K44A, -arrestin-2-(319-418) (Krupnick et al., 1997
; Gagnon et al., 1998
) and -Flag-ß2AR and -ß2AR-GFP (Kallal et al., 1998
), the latter generously provided by J. Benovic (Thomas Jefferson University, Philadelphia). Zem229-Arr2 was generated by excising the coding region of the arrestin-2 cDNA with NotI and ApaI and inserting it into the corresponding sites created in the BamHI cloning site of Zem229. pcDNA3.1-HA-ß1AR with an N-terminal hemagglutinin (HA) epitope, Met-Tyr-Pro-Tyr-Asp-Val-Pro-Asp-Tyr-Ala-Gly-Ala-Gly-, was generated by PCR. To generate pE-ß1AR-GFP, ß1AR was amplified by PCR using an N-terminal primer, CCCGGAATTCCGCAGCTCGGCATGGGCGCGG, and a C-terminal primer, CGCCGGATCCTCCACCTTGGATTCCGAGGCGAA. This replaced the stop codon with a BamHI site encoding an extra glutamate and aspartate. The PCR product and pEGFP-N1 were cut with EcoRI/BamHI, the two purified fragments ligated, and the ligated product cloned. To avoid sequencing the entire PCR-generated ß1AR portion, a BglI/XhoI region was replaced with an EcoRI/XhoI region of the original ß1AR. The BglI and EcoRI ends were blunted with Klenow before ligation, eliminating both restriction sites in the final product, which was sequenced through the PCR-generated regions.
Cell culture and transfections
Baby hamster kidney (BHK), clone tk-ts13, and human embryo kidney (HEK 293) cells were from the American Type Culture Collection and grown in Dulbecco's modified Eagle's medium (DMEM) with 10% fetal bovine serum. HEK 293 cells stably expressing HA-ß2AR were a generous gift from R. Clark (University of Texas Medical School, Houston). HEK 293 cells were grown in polylysine-coated culture ware. Cells were transfected with a ßAR construct or cotransfected with Zem229-Arr2 using calcium phosphate precipitation (Zhou et al., 1995
) or LipofectAMINE Plus and selected for resistance to G418, or to both G418 and methotraxate. Clonal lines stably expressing ßAR or co-expressing ßAR and arrestin-2 were obtained by limiting dilution of the resistant cultures. For transient transfections, cells 80-90% confluent were transfected with equal amounts of plasmid DNA (usually 0.1 µg of each construct per cm2 of culture area) using LipofectAMINE Plus according to the manufacturer's instructions. After 4 hours, the medium was replaced and the cells were assayed 48 hours post-transfection. For some experiments, cells were subcultured after 24 hours into 48-well plates or on glass coverslips or dishes (see below).
Internalization and recycling assays
ßAR internalization was assayed as described previously (Dunigan et al., 2000
; Dunigan et al., 2002
). Briefly, cells grown in 24-well plates were incubated at 37°C in 1 ml of DMEM/25 mM Hepes and exposed to 1 µM ISO for increasing times up to 30 minutes. The plates were placed on a bed of ice, rapidly washed twice with ice-cold Dulbecco's phosphate-buffered saline (DPBS), and incubated in 250 µl of Eagle's minimal essential medium (EMEM)/Hepes containing 30 µg/ml of BSA and 5 nM [3H]CGP-12177 with or without 10 µM propranolol at 4°C for 1 hour. The cells were washed as above, dissolved in 1 M NaOH and assayed for 3H and protein. For cells in 48-well plates, all volumes were reduced by half. We confirmed that binding reached equilibrium for both BHK-hß1 and -hß2 cells by varying the time from 5 minutes to 4 hours. Maximum binding occurred in <1 hour and half-maximum binding in 9.6 and 6.6 minutes, respectively. For recycling of internalized ßAR back to the cell surface, cells exposed to 1 µM ISO for 15-30 minutes were washed twice with warm DMEM/Hepes, incubated in the same medium at 37°C for increasing times up to 1 hour, and assayed for surface receptors as described above.
Internalization of CT-B was determined as described previously (Fishman, 1982
; Orlandi and Fishman, 1998
). Briefly, cells in 24-well plates were incubated with or without inhibitors for 30 minutes at 37°C and then with 10 nM CT-B for 30 minutes at 4°C. After the cells were washed with DPBS, some were warmed to 37°C with or without fresh inhibitors for 1 hour. The cells were incubated with anti-CT-B and then with 125I-protein A, each for 1 hour at 4°C followed by three washes with DPBS. Finally, the cells were dissolved in 1 M NaOH and assayed for 125I and protein.
Confocal fluorescence microscopy
A Zeiss LSM 410 or 510 laser scanning confocal microscope with a 63x1.40 NA oil immersion objective was used to examine the cells. Viable cells were grown in 35 mm glass-bottomed dishes (MatTek), and on the microscope stage, were maintained at 37°C in Phenol Red-free medium and exposed to ISO for increasing times. Otherwise, HEK 293 cells were grown on polylysine-coated coverslips, exposed to Texas Red®-conjugated transferrin and ISO as indicated in the figure legends, washed with ice-cold DPBS, fixed with 4% paraformaldehyde in DPBS without calcium and magnesium at room temperature for 10 minutes, and washed three times with DPBS. For antibody staining, the cells were permeabilized with 0.2% Triton X-100 in DPBS for 10 minutes, blocked with Blotto (3% dry milk and 0.05% Triton X-100 in DPBS) for 20 minutes and incubated with primary and then secondary antibodies in Blotto each for 60 minutes with 3x5-minute washes with DPBS after each antibody and a 20 minute block in Blotto between antibodies. Concentrations of antibodies (µg/ml) were: anti-HA, 4; anti-Flag, 1; anti-clathrin, 1; anti-ß1AR C-tail, 7, and secondary, 3. The coverslips were mounted on slides with ProLong. In some experiments, HEK 293 cells co-expressing HA-ß1AR and Flag-ß2AR were stained at 4°C with Cy3-conjugated anti-Flag (10 µg/ml) and Alexa Fluor 488-conjugated anti-HA (2 µg/ml), washed, warmed up to 37°C for 5 minutes and incubated for 15 minutes in the absence and presence of ISO and then fixed. The images were processed using Adobe Photoshop 5.5 or 6.0.
Phosphorylation experiments
Phosphorylation of receptors in BHK-hß1 and -hß2 cells was done using a modification of published methods (Seibold et al., 2000
; Dunigan et al., 2002
). Briefly, cells were incubated for 3 hours in phosphate-free medium containing 100 µCi/ml of [32P]orthophosphate, stimulated with 1 µM ISO for up to 15 minutes, washed and lysed in 1 mM Tris-HCl/2 mM EDTA, pH 7.4, containing 1 mM EGTA, 100 nM okadaic acid and protease inhibitors. The lysates were centrifuged at 500 g for 5 minutes and the postnuclear supernatants containing 90% of the receptors were mixed with S volume of 5xRIPA buffer containing phosphatase inhibitors. The samples were rotated for 45 minutes, centrifuged at 14,000 g for 20 minutes, and the supernatants containing the soluble receptors were immunoprecipitated with anti-ßAR antibodies preabsorbed to protein A-agarose (Dunigan et al., 2002
). The immunoprecipitates were washed four times with RIPA buffer and eluted with SDS sample buffer. The elutes were resolved by SDS-PAGE and the gels were dried and exposed to a Bio-Rad storage phosphor screen-BI. The screen was scanned and the labeled bands were detected and quantified using a Bio-Rad GS525 Molecular Imager System and Multi-Analysis/PC software.
Subcellular fractionation
Subcellular fractionation by sucrose density gradient centrifugation was done as described previously (Kassis and Sullivan, 1986
) with modifications. Cells grown in 75 cm2 flasks were treated as described above for internalization, washed and incubated at 4°C in EMEM/Hepes containing 0.25 mg/ml of ConA for 30 minutes to increase the resolution of the plasma membranes on the gradients (Waldo et al., 1983
). The cells were washed, allowed to swell for 10 minutes in 1 mM Tris-HCl/2 mM EDTA, pH 7.4, then scraped and lysed in 1 ml of the same solution. Portions (400 µl) were layered on top of discontinuous sucrose gradients formed in 0.5x2-inch ultracentrifuge tubes from 1.1, 2.5 and 1.5 ml portions of 15, 30 and 45% sucrose in 10 mM Tris-HCl, pH 7.4. The gradients were centrifuged in a Beckman SW55Ti rotor at 35,000 rpm for 1 hour at 4°C, and fractions were collected from the top of the gradient and assayed for binding.
Other methods
Protein was measured using BCA reagent and a microtiter plate assay. Cells were assayed for cAMP accumulation by radioimmune assay (Fishman, 1982
). Membranes were prepared and assayed for adenylyl cyclase activity (Zhou et al., 1995
). Cell lysates were assayed for saturation and competition binding with 125ICYP (Dunigan et al., 2000
). ßARs were detected by western blotting with rabbit antibodies against synthetic peptides corresponding to the C-tails of ß1AR (Ala456-Ser475) and ß2AR (Val394-Leu413) (Dunigan et al., 2002
). Cells were biotinylated and biotin-labeled ßARs detected by immunoprecipitation and blotting with HRP-streptavidin as described previously (Dunigan et al., 2002
). Unless otherwise indicated, all experiments were done with at least two clonal lines, each experiment was repeated at least three times and within an experiment, each data point was done in triplicate. Data were fitted to curves by nonlinear regression analysis and analyzed for statistical significance by a two-tailed t-test using Prism 3 (GraphPad Software, San Diego, CA).
| Results |
|---|
|
|
|---|
1.5 pmol/mg protein of both subtypes, after which saturation appeared to be reached. Similar differences were observed in HEK 293-hß1 and -hß2 cells although both subtypes were internalized more than in BHK cells (Fig. 1C). It has been reported that ß1AR expressed in HEK 293 cells does not internalize upon agonist stimulation (Shiina et al., 2000
|
To determine the effects of arrestins on agonist-mediated internalization, we used cells stably cotransfected with arrestin-2 and either ß1AR or ß2AR. Arr2-BHK-hß1 and -hß2 cells exhibited 3.2- and 1.6-fold more internalization (Fig. 1D) and expressed
50-fold more arrestins (data not shown) than BHK-hß1 and -hß2 cells, respectively. To compare arrestin-2 and -3, we used transiently cotransfected BHK and HEK 293 cells. In both cell lines, ß1AR was internalized less than ß2AR, and again internalization was greater in HEK 293 than in BHK cells (Fig. 2). Co-expression of either arrestin-2 or -3 in BHK cells increased internalization of ß1AR
6- to 8-fold and ß2AR
2-fold. Significant but smaller increases occurred in HEK 293 cells, as internalization of both subtypes was high without arrestin co-expression. These cell-specific differences may be due to BHK cells having no endogenous arrestin-2 and only one-third of the arrestin-3 found in HEK 293 cells, the latter having both in a 2:3 ratio (Santini et al., 2000
).
|
ß1AR internalization is dependent on arrestins, dynamin and clathrin
To further establish a role for arrestins in ß1AR internalization, we transiently cotransfected the cells with each subtype and arrestin-2-(319-418), a dominant-negative mutant containing the C-terminal clathrin-binding domain. Expression of the mutant totally blocked agonist-mediated internalization of ß1AR in BHK cells and significantly reduced it in HEK 293 cells as well as blocking internalization of ß2AR in both cell lines (Fig. 2). Similar results were obtained when dynamin-K44R, a dominant-negative mutant defective in GTP binding, was co-expressed. Thus, the internalization of ß1AR appeared to be dependent on arrestins and dynamin as has been found for ß2AR. To determine whether it was also dependent on clathrin-coated pits, we treated stably transfected cells with two known blockers of clathrin-mediated endocytosis, ConA and hypertonic sucrose (Yu et al., 1993
; Pippig et al., 1995
). As ConA may inhibit clathrin-independent endocytosis (Hansen et al., 1993
), we also measured the internalization of cholera toxin B-subunit, which enters cells through caveolae (Orlandi and Fishman, 1998
). Both treatments inhibited the internalization of both ßAR subtypes, but did not block that of cholera toxin B-subunit (Table 1).
|
Differences in phosphorylation of ßAR subtypes
As arrestin binding to ß2AR is facilitated by GRK-catalyzed phosphorylation of the receptor C-tail (Gurevich et al., 1995
), we investigated whether ß1AR was less susceptible than ß2AR to phosphorylation. BHK-hß1 and -hß2 cells, as well as untransfected BHK cells, were labeled with [32P]orthophosphate, stimulated with agonist for 15 minutes, and the receptors were solubilized, immunoprecipitated and analyzed for incorporation of label. No labeled proteins were detected in the immunoprecipitates from untransfected cells (Fig. 3A). Labeled proteins were detected in the transfected cells (Fig. 3A) and identified as receptors by western blotting (not shown). Whereas agonist stimulation increased the phosphorylation of ß2AR 3-fold, it had no effect on the phosphorylation of ß1AR (Fig. 3B). The phosphorylation of ß2AR was rapid, reaching a maximum level in 5 minutes whereas that of ß1AR showed little change (Fig. 3C).
|
Characterization of ß1AR-GFP
For visualizing the endocytic route used by ß1AR, we constructed a ß1AR-GFP chimera in which GFP was fused to the C terminus of the receptor, transfected BHK cells with the construct and isolated clonal cell lines stably expressing ß1ARGFP. We analyzed several different clonal lines and found the pharmacological and functional properties of ß1AR-GFP were very similar to those of wild-type ß1AR (Fig. 4). Both had a similar affinity for the radioligand 125ICYP and the ß1-selective antagonist CGP-20712A, whereas ß1AR-GFP had a slightly lower affinity for the agonist ISO (Fig. 4C). ß1AR-GFP was functional as it mediated agonist-stimulated cAMP formation in intact cells (Fig. 4D) with a similar EC50 value but a one-third lower Vmax value compared with wild-type ß1AR. When cell membranes were assayed for adenylyl cyclase activity, the respective EC50 and Vmax values were not significantly different (data not shown). Furthermore, ß1AR-GFP underwent agonist-mediated internalization but not as effectively as ß2AR-GFP (30% versus 78%). Thus both GFP-tagged subtypes were internalized
2-fold more than their wild-type counterparts (compare with Fig. 1A) without any change in the rate (t
3 minutes for all). Possibly, the increased size of the C terminus makes the receptors more susceptible to agonist-mediated internalization. Our results differ from another study using stably transfected HEK 293 cells in which each ßAR-GFP internalizes more slowly than its wild-type counterpart but to the same extent (McLean and Milligan, 2000
).
|
Western blotting was used to determine whether all the receptors in cells expressing ß1AR-GFP contained the GFP tag and retained it during agonist-mediated internalization. Wild-type ß1AR appeared as a doublet of 57 and 74 kDa proteins that increased to 86 and 97 kDa for ß1AR-GFP (not shown). The increases are consistent with the 28 kDa mass of GFP. The receptors from control and agonist-treated cells appeared the same and there was no evidence of wild-type receptors being expressed or generated in cells transfected with GFP-tagged receptors.
Visualization of ß1AR and ß2AR internalization
Having confirmed that ß1AR-GFP was similar to wild-type ß1AR, we used confocal fluorescence microscopy to visually follow the internalization of the receptor upon agonist stimulation. In unstimulated BHK cells, ß1AR-GFP predominantly appeared on the cell surface with some intracellular fluorescence localized mostly in small vesicles around the perinuclear region (Fig. 5, top row). When the cells were exposed to ISO, there was a modest decrease in surface fluorescence and small punctate structures appeared in the cytoplasm. Even after 20 minutes, however, ß1AR-GFP mostly remained at the cell surface. In unstimulated cells expressing ß2AR-GFP, there was more intracellular fluorescence than in cells expressing ß1AR-GFP (Fig. 5, second row). Upon agonist stimulation, there was a rapid and extensive redistribution of cell surface ß2AR-GFP to large perinuclear structures, and by 20 minutes, only a faint surface fluorescence remained. When we co-expressed arrestin-2 (Fig. 5, third row) or arrestin-3 (Fig. 5, bottom row) in the cells, the agonist-mediated redistribution of ß1AR-GFP was greatly enhanced and by 20 minutes very little surface fluorescence was visible. The internalized ß1AR-GFP, however, appeared in smaller, more peripheral structures than ß2AR-GFP. Co-expression of arrestins had little effect on ß2AR-GFP redistribution (data not shown). Thus, the qualitative fluorescence results were consistent with the quantitative binding data shown in Figs 1 and 2.
|
To further identify the ß1AR endocytic pathway, HEK 293 cells were transiently transfected with ß1AR-GFP alone or with arrestin-2. The cells were exposed to Texas-Red®-labeled transferrin, an established marker for clathrin-mediated endocytosis, incubated with or without agonist, fixed and processed for immunofluorescence (Fig. 6A-I). In unstimulated cells, ß1AR-GFP (green in Fig. 6) was mainly on the surface, transferrin (red) was mostly in endosomes and colocalization of the two (yellow) was minimal (Fig. 6A-C). In agonist-treated cells, localization of transferrin with ß1AR-GFP in endosomes was enhanced (Fig. 6D-F). Co-expression of arrestin-2 increased both the internalization of ß1AR-GFP (Fig. 6G-I) and the extent of its localization with transferrin (Fig. 6F compared with 6I). As was observed in BHK cells, ß1AR-GFP appeared in small vesicles and when we stained similar cells with an anti-clathrin antibody (Fig. 6J-R), we were able to observe considerable colocalization (yellow) of ß1AR-GFP (green) and clathrin (red) in control cells (Fig. 6J-L) and ISO-treated cells without (Fig. 6M-O) and with (Fig. 6P-Q) arrestin-2.
|
In order to exclude the possibility that ß1AR-GFP may traffic differently than wild-type ß1AR, HEK 293 cells were cotransfected with HA-ß1AR, Flag-ß2AR and arrestin-2 (to enhance ß1AR internalization), incubated for 15 minutes with and without agonist, fixed, permeabilized and stained with anti-HA and anti-Flag antibodies and fluorescent second antibodies (Fig. 7A-F). We also incubated the cells at 4°C with fluorescent anti-HA and anti-Flag antibodies, warmed them up for 15 minutes with and without agonist, and then fixed them (Fig. 7G-L). In unstimulated cells, both HA-ß1AR and Flag-ß2AR were localized to the plasma membrane with only modest colocalization (Fig. 7C,I). In agonist-stimulated cells, HA-ß1AR was redistributed to small endosomes as had been observed for ß1AR-GFP (Fig. 7D,J). In contrast, Flag-ß2AR in the same cells was redistributed to larger endosomes (Fig. 7E,H) and had little localization with HA-ß1AR (Fig. 7F,L). Similar results were obtained with HEK 293 cells stably expressing HA-ß2AR and co-transfected with ß1AR and arrestin-2, stained with anti-HA and anti-ß1AR C-tail antibodies and fluorescent second antibodies (Fig. 7M-Q). Even though both ß1AR (green) and HA-ß2AR (red) were cleared from the plasma membrane by agonist stimulation, colocalization (yellow) was not extensive (Fig. 7P-R).
|
ß-Subtypes differ in agonist-mediated redistribution to subcellular fractions
The redistribution of receptors from plasma membranes to endosomes in response to agonist can also be determined by using sucrose density gradient centrifugation to separate subcellular fractions (Waldo et al., 1983
; Kassis and Sullivan, 1986
; Marullo et al., 1999
). Initially, we used linear 15-40% sucrose gradients but were unable to resolve plasma membranes from endosomes. We then tried discontinuous gradients (Kassis and Sullivan, 1986
) and readily observed that ß2AR from agonist-treated BHK cells appeared in both dense and light gradient fractions, but were unable to detect a similar distribution of ß1AR (data not shown). This may be because of the limited internalization of ß1AR in BHK cells (Fig. 1A). Therefore, we turned to Arr2-BHK-hß1 and -hß2 cells, in which agonist-mediated internalization is >50% for both subtypes (Fig. 1D). In fractionated control cells assayed for 125ICYP binding, the bulk of each subtype appeared in the dense gradient fractions with small amounts in the lighter fractions near the top of the gradients (Fig. 8A,B). When the fractions were assayed for [3H]CGP-12177 binding, the hydrophilic radioligand bound to the receptors in the dense but not in the light fractions. When fractions from agonist-treated cells were similarly assayed, differences were observed in the distribution of ß1AR and ß2AR (Fig. 8C,D). As expected, ß2AR was about equally distributed between the plasma membrane and endosomal fractions; in contrast, more ß1AR remained in the plasma membrane fractions and the distribution was
2:1. In addition, most of the ß2AR (88.3±3.3%, n=3) remaining in the plasma membrane fractions was detected by [3H]CGP-12177 binding, whereas only 63.7±4.2% (n=4) of the ß1AR was detected.
|
As the procedure separates subcellular organelles mainly by their density, it appeared that some of the internalized ß1AR was in structures that sediment with the plasma membranes. To rule out the possibility that some ß1AR had not undergone endocytosis, but was still on the plasma membrane and only inaccessible to the hydrophilic radioligand, we used a biotinylation procedure that differentiates between cell surface and internal proteins. Briefly, control and agonist-treated cells were labeled at 4°C with a non-permeable biotin derivative that reacts with amino groups, then lysed and extracted with detergent. ßARs in the soluble extracts were immunoprecipitated with anti-ßAR antibodies, separated by SDS-PAGE and detected by blotting with HRP-streptavidin (Fig. 9A). The biotinylation of both ß1AR and ß2AR was reduced in the agonist-treated cells and the decreases were essentially the same as the decreases in [3H]CGP-12177 binding (Fig. 9B). By contrast in cells first labeled with biotin and then exposed to agonist, the levels of biotin-labeled receptors were similar to those of control cells. This is consistent with the loss of surface receptors by internalization and not by down-regulation. As we assayed the cells for 125ICYP binding in the same experiments, we confirmed there was little if any down-regulation during the initial 15-30 minutes of agonist treatment (mean ± s.e.m. for ß1AR, 96.4±1.8 and for ß2AR, 97.1±2.1% of control; n=6-8).
|
Recycling of ß1AR and ß2AR differ in sensitivity to monensin
As the two subtypes appeared to be sorted to different endosomal compartments, we determined whether they also differed in their ability to be recycled. We exposed BHK-hß1 and -hß2 cells to ISO for 30 minutes to induce maximum internalization, washed out the agonist and allowed recycling to occur for increasing times (Fig. 10A). While both subtypes recycled back to the cell surface, the extent of ß1AR recycling was very small because of its limited ability to be internalized. To increase internalization, recycling was measured in Arr2-BHK-hß1 and -hß2 cells and both subtypes were found to recycle with similar kinetics (Fig. 10B). The respective tG values (means ± s.e.m., n=3-5) were 13.8±1.4 and 13.7±1.3 minutes. Similar results were obtained with HEK 293-hß1 and -hß2 cells (Fig. 10C); the tG values were 10.8±1.2 and 10.7±1.25 minutes. For both subtypes, a greater proportion of the internalized receptors was recycled in HEK 293 than in Arr2-BHK cells. In the presence of monensin, an inhibitor of recycling (Pippig et al., 1995
), ß2AR recycling was substantially reduced in both cell lines whereas monensin had little if any effect on ß1AR recycling (Fig. 10C,D). Although we initially used 100 µM monensin (Pippig et al., 1995
), we found that 10 µM was as effective at inhibiting ß2AR recycling.
|
| Discussion |
|---|
|
|
|---|
To directly visualize endocytosis, we constructed a ß1ARGFP that had properties similar to wild-type ß1AR. We showed colocalization of the chimera with clathrin and with transferrin. Although we now have established that ß1AR uses the same endocytic pathway as ß2AR, this could not be deduced a priori. In fact, given the well-documented quantitative differences in their internalization, it was equally possible that each subtype used a different pathway. Also, considering the many studies comparing the internalization of the subtypes, it is somewhat unexpected that the endocytic route of ß1AR had not been previously identified.
Although quantitative differences in agonist-mediated internalization of ß1AR and ß2AR are well documented both here (Fig.1) and elsewhere (Suzuki et al., 1992
; Green and Liggett, 1994
; Zhou et al., 1995
; Shiina et al., 2000
), the underlying basis has not been completely identified. We showed that the endocytosis of ß1AR was increased to that of ß2AR by co-expressing arrestins. Our results differ from those of other workers who found that arrestin-2 or -3 co-expression in HEK 293 cells has little effect on ß1AR internalization (Shiina et al., 2000
). They also found that arrestins have a lower affinity for ß1AR than ß2AR, that arrestins recognize the receptor C-tails and third intracellular loops, and that using chimeras, these two regions have the most influence on internalization. We obtained similar results when we expressed the same chimeras in BHK cells (unpublished observations). It had been shown that deletion of a proline-rich region in the third intracellular loop of ß1AR increases its internalization (Green and Liggett, 1994
), and that GRK-catalyzed phosphorylation of the ß2AR C-tail promotes binding of arrestins (Gurevich et al., 1995
). Arrestins also bind to non-phosphorylated ß2AR with lower affinity (Gurevich et al., 1995
) and rescue the internalization of ß2AR mutants in which the potential GRK phosphorylation sites are removed by substitution or truncation (Ferguson et al., 1996
). Thus differences between ß1AR and ß2AR as substrates for GRK-mediated phosphorylation may explain their dissimilar capacities for arrestin-dependent endocytosis. In support of this concept, agonist-stimulated phosphorylation of ß1AR is much less than that of ß2AR in HEK 293 cells (Shiina et al., 2001
) and we found that in BHK cells, agonist stimulation increased the phosphorylation of ß2AR by 3-fold, but had little effect on the phosphorylation of ß1AR.
Our other major finding is that although both subtypes use the same pathway of endocytosis, they are sorted to different endosomal compartments. The following supports this conclusion. First, using confocal fluorescence microscopy, we observed that in response to agonist stimulation, ß1AR appeared in small cytoplasmic vesicles close to the cell membrane whereas ß2AR accumulated in large perinuclear vesicles. It is unlikely that the quantitative differences in subtype internalization account for the qualitative difference in trafficking as co-expression of arrestin-2 increased ß1AR endocytosis without affecting its trafficking. When both subtypes were co-expressed in HEK 293 cells, the differences in subcellular distribution were very obvious as was the limited colocalization. The latter indicates that there is some sharing of endosomal compartments by the two subtypes. Probably sharing occurs early after endocytosis as colocalization of each subtype and transferrin is observed. Second, the cells were subjected to subcellular fractionation by sucrose density gradient centrifugation, which separated more dense plasma membranes from less dense endosomes. Whereas ß2AR redistributed from the plasma membrane fractions to the endosomal fractions in proportion to the amount of agonist-mediated internalization that it underwent, ß1AR redistribution was not proportional. Some of the internalized ß1AR remained in the plasma membrane-containing fractions, but inaccessible to the hydrophilic [3H]CGP-12177. As this pool of ß1AR was not labeled by surface biotinylation of intact cells, it most probably represents internalized receptors in vesicles that cosediment with the plasma membranes. In some ways, these vesicles resemble the peripheral endosomes in which ß2AR accumulates when internalization is done at low temperatures (Marullo et al., 1999
). The latter are smaller and denser than the perinuclear endosomes to which ß2AR is targeted at 37°C.
Finally, when we compared the recycling of the two subtypes, we found that recycling of ß2AR was monensin-sensitive whereas recycling of ß1AR was not. Although monensin acts by inhibiting endosomal acidification, it blocks recycling but not dephosphorylation of ß2AR (Pippig et al., 1995
). This is somewhat unexpected as during the recycling process, ß2AR is dephosphorylated by a specific endosomal-associated phosphatase and neutralization of the endosomes with NH4Cl blocks the dephosphorylation (Krueger et al., 1997
). Thus, monensin must be acting at a later step in the recycling pathway. As to the effect of endosomal pH on the dephosphorylation of cytoplasmic domains of the receptor, it has been proposed that endosomal acidification induces a conformational change in the receptor that facilitates the interaction of the phosphatase with the cytoplasmic domains (Krueger et al., 1997
).
One possible explanation for the dissimilar effects of monensin on recycling by the subtypes is that they traffic to different populations of recycling endosomes that vary in sensitivity to monensin. Although there is evidence for more than one recycling pathway, they have different kinetics. Many GPCRs including ß2AR are recycled with rapid kinetics whereas others, typified by the vasopressin V2 receptor, are recycled very slowly via a distinct `long' pathway (Innamorati et al., 2001
). Given the almost identical tG values for recycling of ß1AR and ß2AR in two different cell lines, it is unlikely that ß1AR is taking the `long' pathway. A second possibility that is consistent with our other findings is that after endocytosis, ß1AR, not requiring dephosphorylation, is targeted by default to recycling endosomes whereas ß2AR has to traffic through the dephosphorylation compartment before entering the recycling compartment. It is this latter step that may be inhibited by monesin. As is discussed below, recycling of ß2AR requires binding of a specific sorting protein to its C-terminus after the latter has been dephosphorylated. Binding may depend on a pH-induced conformation of the receptor that is blocked by monensin, and results in dissociation of the sorting protein and interruption of receptor recycling.
There is substantial evidence that the endocytosis and subsequent trafficking of GPCRs are determined and controlled by the interactions of cellular `sorting' proteins with specific cytoplasmic sequences in the receptors (Tsao et al., 2001
). The C-terminal four residues (DSLL) of ß2AR represent a binding motif for PDZ domain-containing proteins of the Na+/H+-exchanger regulatory factor (NHERF) family, and when the motif is mutated or phosphorylated by GRK-5, receptor trafficking is shifted from recycling to degradation (Cao et al., 1999
). ß1AR also terminates in a PDZ-interacting sequence (ESKV) that is recognized by PSD-95 and MAGI-2, which respectively inhibits and enhances receptor internalization (Hu et al., 2000
; Xu et al., 2001
). The interaction between PSD-95 and ß1AR is inhibited when the sequence is phosphorylated by GRK-5 (Hu et al., 2002
). Both PSD-95 and MAGI-2 are only expressed in highly differentiated cells such as neurons where they function as post-synaptic scaffolding proteins. Finally, mutation of the PDZ motif of mouse ß1AR enhances agonist-mediated endocytosis in mouse cardiac myocytes, and the mutated ß1AR is able to interact with Gi (Xiang et al., 2002
).
In summary, we have demonstrated that the agonist-mediated endocytosis of the human ß1AR was through clathrin-coated pits and was both arrestin- and dynamin-dependent. Although the same mechanism is used for endocytosis of the human ß2AR, the two subtypes are sorted to different endosomal compartments. In turn, this compartmentalization may have physiological consequences by providing each subtype with a different milieu for alternate signaling and further trafficking. In cardiac myocytes, each subtype has a different physiological role: ß1AR only couples to Gs, does not activate ERK and is pro-apoptotic, whereas ß2AR couples to both Gs and Gi, activates ERK and is anti-apoptotic (Xiao, 2000
; Zhu et al., 2001
; Shizukuda and Buttrick, 2002
). Finally, ß1AR is more resistant than ß2AR to agonist-mediated down-regulation (Suzuki et al., 1992
; Zhou et al., 1995
; Dunigan et al., 2002
). Thus, each subtype may be in endosomes that differ in their trafficking to lysosomes.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Barak, L. S., Ferguson, S. S. G., Zhang, J., Martenson, C., Meyer, T. and Caron, M. G. (1997). Internal trafficking and surface mobility of a functionally intact ß2-adrenergic receptor-green fluorescent protein conjugate. Mol. Pharmacol. 51, 177-184.
Cao, T. T., Deacon, H. W., Reczek, D., Bretscher, A. and von Zastrow, M. (1999). A kinase-regulated PDZ-domain interaction controls endocytic sorting of the ß2-adrenergic receptor. Nature 401, 286-290.[CrossRef][Medline]
Claing, A., Perry, S. J., Achiriloaie, M., Walker, J. K., Albanesi, J. P., Lefkowitz, R. J. and Premont, R. T. (2000). Multiple endocytic pathways of G protein-coupled receptors delineated by GIT1 sensitivity. Proc. Natl. Acad. Sci. USA 97, 1119-1124.
de Weerd, W. F. C. and Leeb-Lundberg, L. M. F. (1997). Bradykinin sequesters B2 bradykinin receptors and the receptor-coupled G
subunits G
q and G
i in caveolae in DDT1 MF-2 smooth muscle cells. J. Biol. Chem. 272, 17858-17866.
Dunigan, C. D., Curran, P. K. and Fishman, P. H. (2000). Detection of ß-adrenergic receptors by radioligand binding. Methods Mol. Biol. 126, 329-343.[Medline]
Dunigan, C. D., Hoang, Q., Curran, P. K. and Fishman, P. H. (2002). Complexity of agonist- and cyclic AMP-mediated downregulation of the human ß1-adrenergic receptor: Role of internalization, degradation, and mRNA destabilization. Biochemistry 41, 8019-8030.[CrossRef][Medline]
Ferguson, S. S. G. (2001). Evolving concepts in G protein-coupled receptor endocytosis: the role in receptor desensitization and signaling. Pharmacol. Rev. 53, 1-24.
Ferguson, S. S. G., Downey, W. E., III, Colapietro, A.-M., Barak, L. S., Ménard, L. and Caron, M. G. (1996). Role of ß-arrestin in mediating agonist-promoted G protein-coupled receptor internalization. Science 271, 363-366.[Abstract]
Feron, O., Smith, T. W., Michel, T. and Kelly, R. A. (1997). Dynamic targeting of the agonist-stimulated m2 muscarinic acetylcholine receptor to caveolae in cardiac myocytes. J. Biol. Chem. 272, 17744-17748.
Fishman, P. H. (1982). Internalization and degradation of cholera toxin by cultured cells: relationship to toxin action. J. Cell Biol. 93, 860-865.
Gagnon, A. W., Kallal, L. and Benovic, J. L. (1998). Role of clathrin-mediated endocytosis in agonist-induced down-regulation of the ß2-adrenergic receptor. J. Biol. Chem. 273, 6976-6981.
Goodman, O. B., Jr, Krupnick, J. G., Santini, F., Gurevich, V. V., Penn, R. B., Gagnon, A. W., Keen, J. H. and Benovic, J. L. (1996). ß-Arrestin acts as a clathrin adaptor in endocytosis of the ß2-adrenergic receptor. Nature 383, 447-450.[CrossRef][Medline]
Green, S. A. and Liggett, S. B. (1994). A proline-rich region of the third intracellular loop imparts phenotypic ß1-versus ß2-adrenergic receptor coupling and sequestration. J. Biol. Chem. 269, 26215-26219.
Gurevich, V. V., Dion, S. B., Onorato, J. J., Ptasienski, J., Kim, C. M., Sterne-Marr, R., Hosey, M. M. and Benovic, J. L. (1995). Arrestin interactions with G protein-coupled receptors. Direct binding studies of wild type and mutant arrestins with rhodopsin, ß2-adrenergic, and m2 muscarinic cholinergic receptors. J. Biol. Chem. 270, 720-731.
Hansen, S. H., Sandvig, K. and van Deurs, B. (1993). Molecules internalized by clathrin-independent endocytosis are delivered to endosomes containing transferrin receptors. J. Cell Biol. 123, 89-97.
Henley, J. R., Krueger, E. W., Oswald, B. J. and McNiven, M. A. (1998). Dynamin-mediated internalization of caveolae. J. Cell Biol. 141, 85-99.
Hu, L. A., Chen, W., Premont, R. T., Cong, M. and Lefkowitz, R. J. (2002). G protein-coupled receptor kinase 5 regulates ß1-adrenergic receptor association with PSD-95. J. Biol. Chem. 277, 1607-1613.
Hu, L. A., Tang, Y., Miller, W. E., Cong, M., Lau, A. G., Lefkowitz, R. J. and Hall, R. A. (2000). ß1-Adrenergic receptor association with PSD-95. Inhibition of receptor internalization and facilitation of ß1-adrenergic receptor interaction with N-methyl-D-aspartate receptors. J. Biol. Chem. 275, 38659-38666.
Innamorati, G., Le Gouill, C., Balamotis, M. and Birnbaumer, M. (2001). The long and the short cycle. Alternative intracellular routes for trafficking of G-protein-coupled receptors. J. Biol. Chem. 276, 13096-13103.
Kallal, L., Gagnon, A. W., Penn, R. B. and Benovic, J. L. (1998). Visualization of agonist-induced sequestration and down-regulation of a green fluorescent protein-tagged ß2-adrenergic receptor. J. Biol. Chem. 273, 322-328.
Kassis, S. and Sullivan, M. (1986). Desensitization of the mammalian ß-adrenergic receptor: analysis of receptor redistribution on nonlinear sucrose gradients. J. Cyclic Nucleotide Protein Phosphor. Res. 11, 35-46.[Medline]
Koenig, J. A. and Edwardson, J. M. (1997). Endocytosis and recycling of G protein-coupled receptors. Trends Pharmacol. Sci. 18, 276-287.[Medline]
Krueger, K. M., Daaka, Y., Pitcher, J. A. and Lefkowitz, R. J. (1997). The role of sequestration in G protein-coupled receptor resensitization. Regulation of ß2-adrenergic receptor dephosphorylation by vesicular acidification. J. Biol. Chem. 272, 5-8.
Krupnick, J. G. and Benovic, J. L. (1998). The role of receptor kinases and arrestins in G protein-coupled receptor regulation. Annu. Rev. Pharmacol. Toxicol. 38, 289-319.[CrossRef][Medline]
Krupnick, J. G., Goodman, O. B., Keen, J. H. and Benovic, J. L. (1997). Arrestin/clathrin interaction. Localization of the clathrin binding domain of nonvisual arrestins to the carboxy terminus. J. Biol. Chem. 272, 15011-15016.
Laporte, S. A., Oakley, R. H., Holt, J. A., Barak, L. S. and Caron, M. G. (2000). The inter-action of ß-arrestin with the AP-2 adaptor, rather than clathrin, is required for the clustering of ß2-adrenergic receptor into clathrin-coated pits. J. Biol. Chem. 275, 23120-23126.
Lefkowitz, R. J., Pitcher, J., Krueger, K. and Daaka, Y. (1998). Mechanisms of ß-adrenergic receptor desensitization and resensitization. Adv. Pharmacol. 42, 416-420.[Medline]
Lohse, M. J., Benovic, J. L., Codina, J., Caron, M. G. and Lefkowitz, R. J. (1990). ß-Arrestin: a protein that regulates ß-adrenergic receptor function. Science 248, 1547-1550.
Marullo, S., Faundez, V. and Kelly, R. B. (1999). ß2-Adrenergic receptor endocytic pathway is controlled by a saturable mechanism distinct from that of transferrin receptor. Recept. Channels 6, 225-269.
McLean, A. J. and Milligan, G. (2000). Ligand regulation of green fluorescent protein-tagged forms of the human ß1- and ß2-adrenoceptors: comparisons with the unmodified receptors. Br. J. Pharmacol. 130, 1825-1832.[CrossRef][Medline]
Moore, R. H., Sadovnikoff, N., Hoffenberg, S., Liu, S., Woodford, P., Angelides, K., Trial, J. A., Carsrud, N. D., Dickey, B. F. and Knoll, B. J. (1995). Ligand-stimulated ß2-adrenergic receptor internalization via the constitutive endocytic pathway into rab5-containing endosomes. J. Cell Sci. 108, 2983-2991.[Abstract]
Moore, R. H., Tuffaha, A., Millman, E. E., Dai, W., Hall, H. S., Dickey, B. F. and Knoll, B. J. (1999). Agonist-induced sorting of human ß2-adrenergic receptors to lysosomes during downregulation. J. Cell Sci. 112, 329-338.[Abstract]
Oh, P., McIntosh, D. P. and Schnitzer, J. E. (1998). Dynamin at the neck of caveolae mediates their budding to form transport vesicles by GTP-driven fission from the plasma membrane of endothelium. J. Cell Biol. 141, 101-114.
Orlandi, P. A. and Fishman, P. H. (1998). Filipin-dependent inhibition of cholera toxin: evidence for toxin internalization and activation through caveolae-like domains. J. Cell Biol. 141, 905-915.
Ostrom, R. S., Gregorian, C., Drenan, R. M., Xiang, Y., Regan, J. W. and Insel, P. A. (2001). Receptor number and caveolar co-localization determine receptor coupling efficiency to adenylyl cyclase. J. Biol. Chem. 276, 42063-42069.
Perkins, J. P., Hausdorf, W. P. and Lefkowitz, R. J. (1991). Mechanism of ligand-induced desensitization of beta-adrenergic receptors. In The Beta-Adrenergic Receptors (ed. J. P. Perkins), pp. 73-124. Clifton, NJ: Humana Press.
Pierce, K. L., Maudsley, S., Daaka, Y., Luttrell, D. K. and Lefkowitz, R. J. (2000). Role of endocytosis in the activation of the extracellular signal-regulated kinase cascade by sequestering and nonsequestering G protein-coupled receptors. Proc. Natl. Acad. Sci. USA 97, 1489-1494.
Pippig, S., Andexinger, S. and Lohse, M. J. (1995). Sequestration and recycling of ß2-adrenergic receptors permit receptor resensitization. Mol. Pharmacol. 47, 666-676.[Abstract]
Roseberry, A. G. and Hosey, M. M. (2001). Internalization of the M2 muscarinic acetylcholine receptor proceeds through an atypical pathway in HEK293 cells that is independent of clathrin and caveolae. J. Cell Sci. 114, 739-746.[Abstract]
Rybin, V. O., Xu, X., Lisanti, M. P. and Steinberg, S. F. (2000). Differential targeting of ß-adrenergic receptor subtypes and adenylyl cyclase to cardiomyocyte caveolae. A mechanism to functionally regulate the cAMP signaling pathway. J. Biol. Chem. 275, 41447-41457.
Santini, F., Penn, R. B., Gagnon, A. W., Benovic, J. L. and Keen, J. H. (2000). Selective recruitment of arrestin-3 to clathrin coated pits upon stimulation of G protein-coupled receptors. J. Cell Sci. 113, 2463-2470.[Abstract]
Schwencke, C., Okumura, S., Yamamoto, M., Geng, Y. J. and Ishikawa, Y. (1999). Colocalization of ß-adrenergic receptors and caveolin within the plasma membrane. J. Cell. Biochem. 75, 64-72.[CrossRef][Medline]
Seibold, A., Williams, B., Huang, Z. F., Friedman, J., Moore, R. H., Knoll, B. J. and Clark, R. B. (2000). Localization of the sites mediating desensitization of the ß2-adrenergic receptor by the GRK pathway. Mol. Pharmacol. 58, 1162-1173.
Shiina, T., Arai, K., Tanabe, S., Yoshida, N., Haga, T., Nagao, T. and Kurose, H. (2001). Clathrin box in G protein-coupled receptor kinase 2. J. Biol. Chem. 276, 33019-33026.
Shiina, T., Kawasakii, A., Nagao, T. and Kurose, H. (2000). Interaction with ß-arrestin determines the difference in internalization behavior between ß1-and ß2-adrenergic receptors. J. Biol. Chem. 275, 29082-29090.
Shizukuda, Y. and Buttrick, P. M. (2002). Subtype specific roles of ß-adrenergic receptors in apoptosis of adult rat ventricular myocytes. J. Mol. Cell. Cardiol. 34, 823-831.[CrossRef][Medline]
Shor, J., Curran, P. K. and Fishman, P. H. (2001). Targeting ß-adrenergic receptor subtypes to caveolae: Differences between endogenous and heterologously expressed ß1-but not ß2-adrenergic receptors. Mol. Biol. Cell 12, 443s.
Suzuki, T., Nguyen, C. T., Nantel, F., Bonin, H., Valiquette, M., Frielle, T. and Bouvier, M. (1992). Distinct regulation of ß1- and ß2-adrenergic receptors in Chinese hamster fibroblasts. Mol. Pharmacol. 41, 542-548.[Abstract]
Tsao, P., Cao, T. and von Zastrow, M. (2001). Role of endocytosis in mediating downregulation of G-protein-coupled receptors. Trends Pharmacol. Sci. 22, 91-96.[Medline]
Vickery, R. G. and von Zastrow, M. (1999). Distinct dynamin-dependent and -independent mechanisms target structurally homologous dopamine receptors to different endocytic membranes. J. Cell Biol. 144, 31-43.
von Zastrow, M. and Kobilka, B. K. (1992). Ligand-regulated internalization and recycling of human ß2-adrenergic receptors between the plasma membrane and endosomes containing transferrin receptors. J. Biol. Chem. 267, 3530-3538.
Waldo, G. L., Northup, J. K., Perkins, J. P. and Harden, T. K. (1983). Characterization of an altered membrane form of the beta-adrenergic receptor produced during agonist-induced desensitization. J. Biol. Chem. 258, 13900-13908.
Xiang, Y., Devic, E. and Kobilka, B. K. (2002). The PDZ binding motif of the ß1-adrenergic receptor modulates receptor trafficking and signaling in cardiac myocytes. J. Biol. Chem. 277, 33783-33790.
Xiao, R. P. (2000). Cell logic for dual coupling of a single class of receptors to G(s) and G(i) proteins. Circ. Res. 87, 635-637.
Xu, J., Paquet, M., Lau, A. G., Wood, J. D., Ross, C. A. and Hall, R. A. (2001). ß1-Adrenergic receptor association with the synaptic scaffolding protein membrane-associated guanylate kinase inverted-2 (MAGI-2). Differential regulation of receptor internalization by MAGI-2 and PSD-95. J. Biol. Chem. 276, 41310-41317.
Yu, S. S., Lefkowitz, R. J. and Hausdorff, W. P. (1993). ß-Adrenergic receptor sequestration. A potential mechanism of receptor resensitization. J. Biol. Chem. 268, 337-341.
Zhang, J., Ferguson, S. S. G., Barak, L. S., Ménard, L. and Caron, M. G. (1996). Dynamin and ß-arrestin reveal distinct mechanisms for G protein-coupled receptor internalization. J. Biol. Chem. 271, 18302-18305.
Zhou, X. M., Pak, M., Wang, Z. and Fishman, P. H. (1995). Differences in desensitization between human ß1- and ß2-adrenergic receptors stably expressed in transfected hamster cells. Cell. Signal. 7, 207-217.[CrossRef][Medline]
Zhu, W. Z., Zheng, M., Koch, W. J., Lefkowitz, R. J., Kobilka, B. K. and Xiao, R. P. (2001). Dual modulation of cell survival and cell death by ß2-adrenergic signaling in adult mouse cardiac myocytes. Proc. Natl. Acad. Sci. USA 98, 1607-1612.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
A. Meiser, A. Mueller, E. L. Wise, E. M. McDonagh, S. J. Petit, N. Saran, P. C. Clark, T. J. Williams, and J. E. Pease The Chemokine Receptor CXCR3 Is Degraded following Internalization and Is Replenished at the Cell Surface by De Novo Synthesis of Receptor J. Immunol., May 15, 2008; 180(10): 6713 - 6724. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Philip, P. Sengupta, and S. Scarlata Signaling through a G Protein-coupled Receptor and Its Corresponding G Protein Follows a Stoichiometrically Limited Model J. Biol. Chem., June 29, 2007; 282(26): 19203 - 19216. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Tran, J. Friedman, F. Baameur, B. J. Knoll, R. H. Moore, and R. B. Clark Characterization of beta2-Adrenergic Receptor Dephosphorylation: Comparison with the Rate of Resensitization Mol. Pharmacol., January 1, 2007; 71(1): 47 - 60. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Muro, M. Mateescu, C. Gajewski, M. Robinson, V. R. Muzykantov, and M. Koval Control of intracellular trafficking of ICAM-1-targeted nanocarriers by endothelial Na+/H+ exchanger proteins Am J Physiol Lung Cell Mol Physiol, May 1, 2006; 290(5): L809 - L817. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zaitseva, T. Romantseva, J. Manischewitz, J. Wang, D. Goucher, and H. Golding Increased CXCR4-dependent HIV-1 fusion in activated T cells: role of CD4/CXCR4 association J. Leukoc. Biol., December 1, 2005; 78(6): 1306 - 1317. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wang, C. G. Radu, L. V. Yang, L. A. Bentolila, M. Riedinger, and O. N. Witte Lysophosphatidylcholine-induced Surface Redistribution Regulates Signaling of the Murine G Protein-coupled Receptor G2A Mol. Biol. Cell, May 1, 2005; 16(5): 2234 - 2247. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Liang and P. H. Fishman Resistance of the Human {beta}1-Adrenergic Receptor to Agonist-induced Ubiquitination: A MECHANISM FOR IMPAIRED RECEPTOR DEGRADATION J. Biol. Chem., November 5, 2004; 279(45): 46882 - 46889. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||