spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    


Right arrow Help viewing high resolution images
Right arrow Return to article
(Downloading may take up to 30 seconds.
If the slide opens in your browser, select File -> Save As to save it.)

Click on image to view larger version.



Fig. 8. Cessation of Snail expression reversed the mesenchymal phenotype into an epithelial phenotype. (A) MDCK cells expressing low levels of Snail (MDCK-Sna-L) and revertant cell lines lacking Snail expression were immunostained with the indicated antibodies. (B) Snail and E-cadherin expression were examined by immunoblotting. Owing to low expression levels, HA-tagged Snail proteins were collected with an anti-HA antibody and then subjected to immunoblot analysis. (C) The Snail-HA gene and the positions of the primers used to detect the transgene. The following specific primers were used. Snail 5' primer, ACTATGCCGCGCTCTTTCCTC and HA 3' primer, GTCGTAGGGGTA GCCGATATC. (D) Detection of the transgene. PCR was performed on genomic DNA isolated from the three A431 cell lines indicated. The transgene could not be detected in A431-Sna-L revertant cells.





Right arrow Return to article