|
|
![]() |
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 3 May 2005
doi: 10.1242/jcs.02360
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
Department of Pathology and Laboratory Medicine, Texas A&M University System Health Science Center, 208 Reynolds Medical Building, College Station, TX 77843-1114, USA
* Author for correspondence (e-mail: gedavis{at}tamu.edu)
Accepted 23 February 2005
| Summary |
|---|
|
|
|---|
Key words: Matrix metalloproteinase-1, Matrix metalloproteinase-10, Angiogenesis, Vascular regression, Endothelial cell, Serine protease
| Introduction |
|---|
|
|
|---|
Data from several laboratories suggest that extracellular matrix stability is required for a proper angiogenic response. Plasmin directly degrades fibrin, a major ECM substrate for angiogenesis (Pepper, 2001
; Senger, 1996
; Vernon and Sage, 1995
) and further activates MMP-1, MMP-3, MMP-9 and MMP-10 (He et al., 1989
; Jeffrey, 1998
; Lund et al., 1999
; Murphy et al., 1999
; Nagase, 1998
; Suzuki et al., 1990
). The activated forms of these proteinases promote degradation of collagen type I, or basement membrane matrices that represent other important angiogenic substrates (Davis et al., 2002
; Pepper, 2001
; Senger, 1996
; Vernon and Sage, 1995
). Furthermore, a recent study revealed that decreased plasmin generation by breast carcinomas adversely affected prognosis in patients with breast cancer (Chappuis et al., 2001
). These data support the hypothesis that proteolytic ECM degradation, or destruction of the angiogenic scaffold, leads to collapse of angiogenic networks.
Other studies present a different view, stating that proteinases such as plasmin and soluble MMPs stimulate angiogenic responses by promoting basement membrane degradation and ECM proteolysis necessary for EC invasion and sprouting (Carmeliet and Jain, 2000
; Foda and Zucker, 2001
; Pepper, 2001
; Sternlicht and Werb, 2001
; Werb et al., 1999
; Zucker et al., 2000
). Additional work has strongly implicated membrane-associated MMPs (i.e. MT-MMPs) as the major contributors to endothelial and epithelial tube morphogenesis in three-dimensions (Bayless and Davis, 2003
; Davis et al., 2002
; Hiraoka et al., 1998
; Hotary et al., 2000
). Proteinase inhibitors such as PAI-1 and TIMP-1 (which primarily block secreted proteinases) have no ability to inhibit morphogenesis, whereas inhibitors such as TIMP-2 and TIMP-3 inhibit morphogenic events (Bayless and Davis, 2003
; Davis et al., 2002
; Hiraoka et al., 1998
). Thus, one of the issues in capillary tube morphogenesis and regression is the role of soluble versus membrane-bound MMPs. Our work concerning plasminogen and MMP-1 dependent capillary tube regression in collagen matrices in vitro suggests that soluble proteinases primarily control regression events rather than morphogenic events (Davis et al., 2001
; Davis et al., 2002
). This concept, recently suggested as a new mechanism for vascular regression, is very similar to findings previously described for other types of tissue regression (Curry and Osteen, 2001
; Sternlicht and Werb, 2001
; Werb et al., 1996
; Werb et al., 1999
). Two such examples include mammary gland regression (Sympson et al., 1994
; Talhouk et al., 1992
; Werb et al., 1996
; Werb et al., 1999
) and uterine endometrial shedding (Curry and Osteen, 2001
; Kokorine et al., 1996
; Marbaix et al., 1996
). Thus, degradation of ECM is linked to regression events in the mammary gland, uterus and vasculature. Determination of the mechanism by which collagen/ECM degradation might occur is of central importance in these circumstances.
MMP zymogen activation is an essential step for the initiation of ECM proteolysis. Proper activation of the zymogen occurs after pro-peptide cleavage events (Nagase and Woessner, 1999
; Sternlicht and Werb, 2001
). Although plasmin has been described as a key activator of several MMPs, many other serine proteases (i.e. kallikrein, trypsin, neutrophil elastase, cathepsin G, tryptase and chymase) have also been shown to directly activate MMP-1, MMP-2, MMP-3, MMP-9 and MMP-10 in vitro or in vivo (Duncan et al., 1998
; Fang et al., 1997
; Gruber et al., 1989
; Nagase, 1995
; Nagase, 1998
; Okada et al., 1987
; Sepper et al., 1997
; Shamamian et al., 2001
; Zhu et al., 2001
). Stromelysins (i.e. MMP-3 or MMP-10) are particularly relevant in the context of capillary tube regression owing to their ability to both degrade various components of basement membrane matrix such as collagen type IV, laminin and proteoglycans (Baricos et al., 1988
; Bejarano et al., 1988
; Nagase, 1998
) and to activate MMPs capable of degrading the interstitial matrix (MMP-1, MMP-8 and MMP-13) (Knauper et al., 1996
; Nagase, 1998
; Nicholson et al., 1989
; Windsor et al., 1993
). In addition, it is well known that the serine protease plasmin and activated stromelysins show synergistic functions in generating an active form of MMP-1 that is approximately tenfold more efficient than the enzyme generated by serine proteases alone (He et al., 1989
; Suzuki et al., 1990
). For these reasons, we hypothesized that a member of the stromelysin family might be involved in the capillary tube regression response.
Building on our previously described system of EC tubular morphogenesis and regression (Davis et al., 2001
), we developed a quantifiable micro-well regression assay that is well suited to study ECM proteolysis in a cell-based system under serum-free conditions. Using this assay system, we report that multiple serine proteases activate MMP-1 zymogen, which leads to capillary tubular network regression in 3D collagen matrices in an MMP-1 dependent manner. Activation of EC-derived MMP-1 zymogen caused proteolysis of collagen type I, capillary tube collapse and collagen gel contraction. Additionally, we demonstrate for the first time that stromelysin-2 (MMP-10) zymogen is induced during human EC tubular morphogenesis in 3D collagen matrices and that MMP-10 pro-enzyme is activated by the above-mentioned serine proteases in a manner similar to MMP-1. We further demonstrate a direct role for both MMP-1 and MMP-10 in the regression response by inhibiting regression after transfecting ECs with MMP-1 or MMP-10 siRNAs and showing that tube regression is markedly accelerated in serine protease-treated ECs expressing increased levels of MMP-1 or MMP-10. Thus, activation of MMP-1 zymogen by multiple serine proteases and MMP-10 leads to collagen matrix degradation, EC network collapse and gel contraction. Overall, this work suggests a complementary role for MMP-1, MMP-10 and serine proteases in controlling vascular tube regression, a key event in tissue regression responses.
| Materials and Methods |
|---|
|
|
|---|
Human umbilical vein endothelial cells were obtained from Clonetics (San Diego, CA) and were cultured as described (Maciag et al., 1979
). ECs were used in our experiments from passages 2-6. The standard EC morphogenesis assay in 3D collagen gels was performed as described using 3.75 mg/ml of type I collagen (Davis and Camarillo, 1996
; Salazar et al., 1999
). The above enzymes were added at various concentrations to the serum-free culture media consisting of Medium 199, a 1:250 dilution of the Reduced Serum supplement II, 50 µg/ml of ascorbic acid, 50 ng/ml phorbol ester, 40 ng/ml recombinant VEGF-165 (Upstate Biochemical, Lake Placid, NY) and 40 ng/ml FGF-2 (Upstate Biochemical). In the regression assays using adenoviral infected ECs, phorbol ester was not added. To normalize viral infection, each adenovirus titer was determined with the Adeno-X Rapid Titer Kit (BD Biosciences, Palo Alto, CA). For viral infection, 1x106 ECs were infected with 2.2x107 IFU of adenovirus.
Time-lapse photography of individual cultures was performed at 4x and 10x magnification to demonstrate the capillary tube regression and gel contraction response. Cultures were fixed following gel contraction with 3% glutaraldehyde in PBS, pH 7.5 for at least 30 minutes prior to additional manipulation. In some cases, cultures were stained with 0.1% Toluidine Blue in 30% methanol and then destained prior to visualization and photography. In other cases, proteinase inhibitors were added to inhibit collagen proteolysis and gel contraction. Conditioned media were collected to examine differential proteinase expression at different times of culture. Conditioned media were run on 10% SDS-PAGE gels, transferred to PVDF membranes, and probed and developed as described (Salazar et al., 1999
). Three-dimensional collagen gels were also extracted in some cases to examine protein expression (Salazar et al., 1999
) during the regression process.
384 micro-well regression assays
To objectively quantify the capillary tube regression and gel contraction response, we developed a micro-well regression assay in 384-well tissues culture plates. EC cultures were prepared as described above. For quantitative analysis of gel contraction, 15 µl mixtures of ECs and collagen matrix (n=8 cultures per condition) were placed in 384-well tissue culture plates (VWR, West Chester, PA). Cultures were allowed to equilibrate for 60 minutes prior to addition of media with or without the described amounts of serine proteases. Addition of culture media denoted time zero and cultures were monitored every 4 hours for gel contraction. Upon initiation of gel contraction, gel area was recorded using an ocular grid and the percentage of collagen gel contraction was calculated as follows: [(original area current gel area)/original area]x100. When contraction was complete, cultures were fixed and media examined as described above. Data are reported as the mean percentage gel contraction (±s.d.).
Fluorescent collagenase assay
In order to quantify the collagenase activity of EC cultures, a commercially available, DQ collagenase assay kit was obtained (Molecular Probes, Eugene, OR). Conditioned media were collected at indicated time points and diluted 1:1 in 1x reaction buffer. For each condition and time point, triplicate samples were incubated overnight (16-20 hours) at room temperature in 25 µg/ml DQ collagen type I in black, 96-well plates. Control wells containing DQ collagen and 1x reaction buffer were incubated concurrently to determine background fluorescence. Collagenase activity was determined by measuring fluorescence in a Synergy HT fluorescent microplate reader using an excitation spectra of 485±20 nm and an emission spectra of 528±20 nm. Background fluorescence was subtracted prior to reporting of data as mean (±s.d.).
Treatment of ECs with MMP-1 siRNA for use in 384 micro-well regression assay
siGENOME SMARTpool human MMP-1, MMP-2, MMP-3, MMP-9 and MMP-10 siRNAs were obtained from Dharmacon (Lafayette, CO).
2 macroglobulin and luciferase GL2 duplex siRNA were used as controls. Confluent ECs were split into 25cm2 flasks at time 0. 6 hours after plating, ECs were washed and transfected with 200 nM siRNA in antibiotic-free media using 17.5 µl siPORT Amine (Ambion, Austin, TX). Five hours after transfection, cells were supplemented with 3 ml antibiotic-free growth media. After 12 hours, flasks were aspirated, supplemented with fresh, antibiotic-free growth media and allowed to recover. This transfection procedure was repeated 48 hours from the time of the first transfection. After the second transfection, cells were allowed to recover for 28 hours prior to utilization in the 384 micro-well regression assay. In experiments using both siRNA and adenoviral-mediated gene transfer, ECs were infected with adenovirus 24 hours after the second transfection and 3D cultures were established 16 hours later.
Generation of MMP-1, MMP-3 and MMP-10 adenoviruses
Recombinant adenoviruses were constructed containing the full-length cDNAs for MMP-1, MMP-3 and MMP-10. MMP-1 and MMP-3 clones were amplified by PCR from endothelial cell cDNA (MMP-1) and normal human dermal fibroblast cell cDNA (MMP-10) as described (Bell et al., 2001
; Davis et al., 2001
; Salazar et al., 1999
). The resulting PCR products were cloned using the indicated restriction enzymes into the pAdTrack-CMV vector: MMP-1 5': AGCTCGAGAGTATGCACAGCTTTCCTCCAC (XhoI) and 5'-AGAAGCTTCCATTCAAATTAGTAATGTTCAAT-3' (HindIII); MMP-3 5'-AGAGATCTGCCACCATGAAGAGTCTTCCAATCC-3' (BglII) and 5'-AGGATATCTCAACAATTAAGCCAGCTGTTAC (EcoRV).
The following primer set was utilized for the construction of full-length cDNA for MMP-10: 5'-AGAGATCTGCCACCATGATGCATCTTGCATTCC-3' (BglII) and 5'-AGCTCGAGCTAGCAATGTAACCAGCTGTTAC-3' (XhoI). The clone was amplified from ATCC vector MGC-1704, which contained the complete coding sequence for human MMP-10 zymogen. The PCR product was cloned using the indicated restriction enzymes into the pAdTrack-CMV vector.
Each pAdTrack-CMV clone was characterized by sequence analysis prior to recombination with pAdEasy-1 as described (He et al., 1998
). Details of our adenoviral production protocol have been described previously (Bayless and Davis, 2002
). For all constructs, protein production was verified by western blot analysis.
| Results |
|---|
|
|
|---|
|
|
To further determine the concentration effects of active kallikrein during capillary tube regression, varying doses of the activated enzyme were added to ECs in the 384 micro-well regression assay (Fig. 3A). Quantification of the capillary tube regression and gel contraction response is shown as the percentage of gel contraction over time. The addition of active plasma kallikrein resulted in a marked dose- and time-dependent activation of MMP-1 zymogen that directly correlated with capillary tube collapse and gel contraction (Fig. 3A). In our previous study, plasminogen/plasmin-induced capillary tube regression likewise correlated with MMP-1 zymogen activation and cleavage of the type I collagen matrix (Davis et al., 2001
). Additionally, we demonstrated in our prior study that plasminogen/plasmin-induced capillary tube regression led to time-dependent EC apoptosis, whereas ECs cultured in the absence of plasminogen did not undergo apoptosis (Davis et al., 2001
). In a similar manner, the addition of kallikrein to EC cultures induced capillary tube regression, collagen gel contraction and EC apoptosis. Western blot analysis of ECs undergoing kallikrein-induced tube regression showed marked induction of active caspase-3, decreased levels of pro-caspase-3 and pro-caspase-7, and cleavage of the caspase-3 substrates gelsolin and
-fodrin compared to control cultures (data not shown). Addition of the proteinase inhibitors, aprotinin (2900 KIU/ml), TIMP-1 (1 µg/ml) and PAI-1 (2.5 µg/ml), not only completely blocked the kallikrein-induced tube regression and collagen gel contraction response (as well as the development of EC apoptosis), but also inhibited activation of MMP-1 zymogen (not shown). Thus, kallikrein-induced MMP-1 dependent tube regression is inhibited by both serine protease and MMP inhibitors.
|
Addition of plasma prekallikrein induces capillary tube regression only in the presence of Factor XII or HMW kininogen
It is well known that the EC cell surface is an important regulator of plasma prekallikrein activation via two pathways, Factor XII or high molecular weight kininogen (HMWK) (Colman, 1999
; Kaplan et al., 2001
; Mahdi et al., 2002
; Schmaier, 2000
; Schousboe, 2001
). Dose-response experiments were performed with Factor XII zymogen, which was added to ECs in the 384 micro-well assay in the presence or absence of prekallikrein. As shown in Fig. 3B, the addition of Factor XII at doses as low as 32 ng/ml after 50 hours of culture induced capillary tube regression and collagen gel contraction only in the presence of plasma prekallikrein at 2 µg/ml. Western blot analysis of MMP-1 activation revealed that both Factor XII and prekallikrein were required to induce MMP-1 activation, which correlated with the tube regression and gel contraction response (Fig. 3B). The addition of Factor XII alone did not induce regression.
A dose-response experiment with varying doses of added HMWK was performed with 2 µg/ml prekallikrein in the presence of Zn2+, Mn2+ or no added divalent cations (Fig. 3C). Previous work has indicated that Zn2+ ions enhance the ability of HMWK to bind to the EC cell surface and activate plasma prekallikrein (Joseph et al., 1996
). Here, in the presence of 10 µg/ml HMW kininogen, collagen gel contraction occurred in the presence of prekallikrein without added divalent cations. However, at lower doses, the presence of Zn2+ ions but not Mn2+ markedly stimulated the ability of HMWK to induce collagen gel contraction. Doses of HMW kininogen at 1 µg/ml were sufficient to induce the regression response in the presence of both prekallikrein and Zn2+ ions. Zn2+ ions in the presence of HMWK and prekallikrein markedly induced MMP-1 activation, which directly correlated with capillary tube regression and collagen gel contraction. Overall, these data indicate that known physiological mechanisms to activate plasma prekallikrein on the EC surface lead to MMP-1 activation and capillary tube regression.
Activation of MMP-1 correlates with increased EC-derived collagenase activity during plasma kallikrein- and plasmin-induced capillary tube regression
Although activation of MMP-1 via western blot analysis correlated in each case with tube regression and gel contraction, we assayed conditioned media for total collagenase activity in a time-course experiment. ECs were cultured as previously described in the absence or presence of active plasmin or plasma kallikrein at two doses (0.5 µg/ml and 2.5 µg/ml). Conditioned media were collected at the indicated time points and were analyzed by western blotting and for collagenase activity using DQ collagen, a collagen preparation that emits limited fluorescence in its native, triple helical form, while emitting a strong fluorescent signal following proteolysis of the collagen triple helix (Della et al., 1999
). Conditioned media from ECs cultured in the absence of plasmin or kallikrein (Control) showed minimal collagenase activity (Fig. 4) and western blot analysis of this media indicated that MMP-1 remained in its zymogen form (arrow). In contrast, the addition of either active plasmin or plasma kallikrein induced a marked dose- and time-dependent increase in collagenase activity that directly correlated with both the degree of MMP-1 activation visible on western blots (arrowheads) and time to 50% collagen gel contraction. The capillary tube regression and gel contraction response was determined as in Fig. 3 and the time to 50% gel contraction is shown above each data set. Thus, the addition of both plasmin and kallikrein induced a dose-dependent activation of MMP-1, which led to time-dependent gel contraction and a corresponding increase in collagenase activity.
|
Multiple serine proteases induce MMP-1 zymogen activation, tube regression and gel contraction
The abilities of plasmin and plasma kallikrein to activate MMP-1 zymogen have been well described (Armour et al., 1984
; Nagase et al., 1982
; Nagase et al., 1990
; Suzuki et al., 1990
). Several other serine proteases (trypsin, neutrophil elastase, cathepsin G, tryptase and chymase) have been shown to active MMP zymogens in vitro (Duncan et al., 1998
; Fang et al., 1997
; Gruber et al., 1989
; Okada et al., 1987
; Sepper et al., 1997
; Shamamian et al., 2001
; Zhu et al., 2001
); however, the ability of these serine proteases to activate MMP-1 zymogen in the context of tissue regression events is unclear at present. To address this question, dose-response experiments were performed using the purified serine proteases described above in the 384 micro-well regression assay. Addition of each serine protease resulted in a dose-dependent activation of MMP-1 (data not shown), which directly correlated with the time to initiation and completion of the tube regression and gel contraction response (Table 1). This in vitro data provides evidence that multiple serine proteases, present during physiologic and pathological vascular regression events in vivo, are capable of activating MMP-1 and inducing capillary tube regression and collagen gel contraction in vitro.
|
Inhibition of capillary tube regression using an MMP-1 siRNA
In order to directly demonstrate a requirement for MMP-1 (the downstream effector of these serine proteases and the collagenase responsible for collagen proteolysis) during human capillary tube regression and collagen gel contraction, ECs were transfected with MMP-1 siRNA or control siRNAs (luciferase,
2 macroglobulin). After transfection, ECs were resuspended in collagen gels in the 384 micro-well regression assay as described above. Upon completion of gel contraction, media were collected and western blot analyses were performed (Fig. 5). To evaluate the effect of decreased MMP-1 protein expression on the capillary tube regression and gel contraction response, four different serine protease conditions were added to culture media (active kallikrein, prekallikrein and Factor XII, neutrophil elastase, cathepsin G). Transfection of ECs with MMP-1 siRNA delayed the time to both onset and completion of gel contraction when compared to control siRNAs when media was supplemented with active kallikrein (0.5 µg/ml), or prekallikrein (2 µg/ml) and Factor XII (1 µg/ml) (Fig. 5A). Western blot analysis of culture media showed a marked decrease in MMP-1 protein levels compared to control cultures in all groups. Similarly, transfection of ECs with MMP-1 siRNA dramatically delayed the time to gel contraction when compared to control siRNAs in the presence of the neutrophil serine proteases, neutrophil elastase and cathepsin G (data not shown). Again, western blot analysis of culture media showed a similar decrease in MMP-1 protein levels in the presence of MMP-1 siRNA compared to luciferase and
2 macroglobulin (data not shown). Importantly, treatment of ECs with MMP-1 siRNA had no effect on the ability of ECs to undergo morphogenesis unlike control siRNA (Fig. 5B).
|
MMP-10 zymogen is induced during EC morphogenesis and is activated by multiple serine proteases
In order to investigate whether additional MMPs are involved in the capillary tube regression response, a time course experiment was performed with ECs during capillary tube morphogenesis in collagen matrices as previously described (Bell et al., 2001
; Davis and Camarillo, 1996
). Under serine protease-free conditions, conditioned media were collected at different time points and western blot analyses were performed to determine the presence of MMP-3, MMP-10 or MMP-13 (Fig. 6A). Although MMP-3 and MMP-13 were not detectable, MMP-10 zymogen was markedly induced and appeared to remain in its pro-enzyme form during capillary tube morphogenesis (Fig. 6A). To determine the ability of various serine proteases to activate MMP-10, dose-response experiments were performed utilizing ECs suspended in collagen matrices using the 384 micro-well assay. MMP-10 zymogen was activated in a dose-dependent manner by plasma kallikrein (Fig. 6B). Activation of MMP-10 by kallikrein directly corresponded with capillary tube regression and gel contraction (indicated by +). MMP-10 was also activated in a dose-dependent manner by trypsin, neutrophil elastase, cathepsin G, tryptase and chymase (data not shown). These data suggest that MMP-10 may represent a novel mediator of the capillary tube regression response.
|
Increased expression of MMP-10 in ECs induces capillary tube regression and collagen gel contraction via activation of MMP-1 zymogen
To further define the involvement of MMP-10 (stromelysin-2) during capillary tube regression, a recombinant adenovirus encoding the gene for MMP-10 zymogen was generated. ECs were infected with control virus (GFP Ad) or MMP-10 virus (MMP-10 Ad) 24 hours prior to initiating cultures in the absence or presence of the serine proteases kallikrein, prekallikrein and Factor XII or plasminogen. Cultures were monitored over time for capillary tube regression and gel contraction and conditioned media were collected at the completion of gel contraction for western blot analysis of MMP-10. ECs infected with MMP-10 adenovirus induced a rapid capillary tube regression response (Fig. 7A), whereas ECs infected with control virus (GFP Ad) did not undergo regression in the absence of serine proteases (data not shown). Importantly, although each serine protease added to culture media accelerated regression and gel contraction when compared to control media, ECs expressing increased levels of MMP-10 were capable of initiating a regression response in the absence of any added serine protease. Two possible serine protease-independent mechanisms of MMP-10 activation include exposure to free radicals or auto-activation (Nakamura et al., 1998
; Peppin and Weiss, 1986
; Tyagi et al., 1993
; Tyagi et al., 1996
; Weiss et al., 1985
). Confirming this result, western blot analysis of MMP-10 levels (Fig. 7A) showed minimal MMP-10 zymogen levels for ECs infected with GFP Ad, whereas ECs infected with MMP-10 Ad showed markedly increased levels of both latent (arrows) and active (arrowheads) MMP-10 regardless of the presence or absence of the described serine protease.
|
To investigate these findings, we prepared another adenoviral vector expressing the related stromelysin, MMP-3 (stromelysin-1). Additional cultures were established using ECs infected with control virus (GFP Ad) or the adenovirus encoding MMP-3 zymogen (MMP-3 Ad) 24 hours prior to addition to the 384 micro-well regression assay (Fig. 7B). Gels were monitored for contraction and conditioned media collected as described for Fig. 7A. Similar to increased MMP-10 expression, ECs infected with MMP-3 Ad induced a rapid capillary tube regression response (Fig. 7B), whereas ECs infected with control virus (GFP Ad) did not undergo regression in the absence of serine proteases (data not shown). Although each serine protease added to culture media accelerated regression and gel contraction when compared to serine protease-free media, MMP-3 infected ECs also were induced to regress in the absence of any added serine protease in a manner similar to ECs expressing increased levels of MMP-10. Western blot analysis of conditioned media showed no detectable MMP-3 zymogen levels for ECs infected with GFP Ad, whereas ECs infected with MMP-3 Ad showed markedly increased levels of both latent (Fig. 7B, arrows) and active (arrowheads) MMP-3 regardless of the presence or absence of the described serine protease. To elucidate the mechanism through which MMP-10 and MMP-3 activation occurs in the absence of added serine proteases, ECs were infected with GFP Ad, MMP-10 Ad, or MMP-3 Ad 24 hours prior to suspension in collagen gels as previously reported (Davis et al., 2001
). Cultures were established in control media (without serine proteases) in the presence of: aprotinin (5800 KIU/ml), PAI-I (2.5 µg/ml), ecotin (25 µM), AEBSF (100 µM), TIMP-1 (3 µg/ml),
2 macroglobulin (25 µg/ml), or MMP Inhibitor-I (175 µM). Although regression was inhibited in the presence of TIMP-1,
2 macroglobulin and MMP Inhibitor I, regression was not sensitive to serine protease inhibitors (data not shown), suggesting that either ECs possess a mechanism to activate stromelysins in a manner that does not require serine proteases, or that these MMPs can auto-activate when expressed at sufficiently high levels.
|
|
To provide further support for the dual role of MMP-1 and MMP-10 in tube regression, ECs were transfected with MMP-10 or luciferase control siRNA before being infected with adenoviruses encoding MMP-1 zymogen (MMP-1 Ad) or a control (GFP Ad) (Fig. 8D). ECs were suspended in collagen matrices in the 384 micro-well regression assay in the absence or presence of 2 µg/ml plasminogen. At 56 hours, conditioned media were collected for analysis of MMP-10 levels. ECs expressing increased levels of MMP-1 and treated with control siRNA rapidly induced the tube regression and gel contraction response at 32-36 hours (Fig. 8D, closed triangles), however, ECs expressing increased MMP-1 levels and treated with MMP-10 siRNA underwent delayed tube regression and gel contraction (open triangles, 40-48 hours). ECs infected with GFP Ad and treated with control siRNA induced tube regression at 36-44 hours (closed circles), whereas ECs infected with GFP Ad and treated with MMP-10 siRNA exhibited a delayed tube regression response (48-56 hours, open circles). Western blot analysis of MMP-10 indicated a marked decrease in MMP-10 levels for cells transfected with MMP-10 siRNA when compared to control siRNA. These experiments demonstrate that both EC-derived MMP-1 and MMP-10 are involved in regulating proteinase-induced capillary tube regression response in 3D collagen matrices.
| Discussion |
|---|
|
|
|---|
The concept that proteinases mediate capillary tube regression through ECM degradation is appealing for several reasons. It is well known that EC survival is dependent on EC-ECM adhesion, and disruption of these contacts results in EC apoptosis or anoikis (Frisch and Screaton, 2001
; Meredith, Jr et al., 1993
). Furthermore, the matrix scaffold is required for the integrity of EC-lined tubes in three dimensions (Davis et al., 2001
; Davis et al., 2002
; Vernon and Sage, 1995
; Zhu et al., 2000
) and physical alterations in this scaffold will cause tube collapse (Davis et al., 2001
). Proteinase-mediated mechanisms underlie tissue regression phenomena in other tissues, such as the mammary gland. Werb and colleagues have shown in pioneering studies that proteinase-induced degradation of ECM controls mammary gland regression (Sternlicht and Werb, 2001
; Sympson et al., 1994
; Talhouk et al., 1992
; Werb et al., 1996
; Werb et al., 1999
). Furthermore, plasma kallikrein, plasminogen and MMPs are involved in these events (Selvarajan et al., 2001
; Werb et al., 1996
), showing similar conclusions to the work presented here. Thus, it appears that proteinase-induced endothelial or epithelial tube regression is a phenomenon of general importance to tissue regression. In support of these conclusions, the proteinase inhibitor RECK knockout mouse resulted in a vascular lethal phenotype at embryonic day 10.5 (Oh et al., 2001
). Analysis by electron microscopy and immunostaining showed a marked loss of collagen type I fibrils suggesting that the loss of RECK resulted in increased interstitial collagenase activity, which allowed collagen scaffold breakdown and vascular regression. These in vivo findings from the RECK knockout are remarkably similar to the in vitro model of collagen proteolysis and EC tube regression presented here. The nature of the mouse MMP that might represent the equivalent of human MMP-1 is not clear at present, but could include MMP-13, MMP-8, or others (Jeffrey, 1998
). Interestingly, we have shown that adenoviral expression of murine MMP-13 in our EC culture system markedly accelerates the ability of serine proteases to induce EC tube regression (W.B.S. and G.E.D., unpublished observations). Thus, murine MMP-13 and human MMP-1 act as pro-regression agents, suggesting that murine MMP-13 may be capable of serving as the equivalent of human MMP-1 in regulating mouse capillary tube regression events.
Multiple serine proteases activate MMP-1 zymogen to regulate capillary tube regression in 3D collagen matrices
All of the serine proteases evaluated in this study caused MMP-1 activation that led to capillary tube regression. MMP-1, an interstitial collagenase, is activated in our system to initiate capillary tube collapse and collagen gel contraction. Previously, we reported that collagen type I degradation accompanied this regression response and that EC apoptosis also occurred during these events (Davis et al., 2001
). It is also important to note that MMP-1, which is of central importance to the capillary tube regression phenomena presented here, has been reported to regulate uterine gland regression during the menstrual cycle (Curry and Osteen, 2001
; Kokorine et al., 1996
; Marbaix et al., 1996
). MMP-1 has been shown to be transcriptionally regulated during this cycle and to be induced just prior to the initiation of gland regression. In this case, both endometrial and vascular tissue regression correlated with maximal MMP-1 expression. This work strongly implicates MMP-1 as a key factor in tissue regression phenomena in humans. In further support of such findings, a recent study showed that increased MMP-1 expression in human melanoma tumors correlated with tumor regression and a better clinical outcome (Nikkola et al., 2001
). MMP-1 has also been reported to be a positive regulator of tumor invasion and keratinocyte migration (Benbow et al., 1999
; Brinckerhoff et al., 2000
; Dumin et al., 2001
; Pilcher et al., 1997
; Pilcher et al., 1998
). Thus, MMP-1 and other MMPs appear to stimulate cell behaviors that are associated with tumor invasion and progression (Egeblad and Werb, 2002
). Our previous work and the current study describe a new function for MMP-1, which is to regulate capillary tube regression in 3D ECM environments (Davis et al., 2001
; Davis et al., 2002
). The ability of various serine proteases to initiate MMP activation leading to collagen and ECM proteolysis and tissue regression is compelling. It appears that these pathways overlap and act synergistically to regulate ECM proteolysis. Although this report focuses on EC capillary tube regression, we believe the results are relevant to a wide variety of physiological and pathological conditions. In addition, the data presented in this study provide strong additional evidence to support a role for MMP-1 as a vascular regression factor and not as an EC pro-morphogenesis/invasion factor. Inhibition of MMP-1 expression levels via siRNA dramatically delayed capillary tube regression and gel contraction, while having no effect on ECs undergoing tubular morphogenesis (Fig. 5). During the later stages of wound healing, granulation tissue regresses and the ECM undergoes wound contraction (Clark, 1996
). Consistent with the findings presented in this study, activation of MMP-1 during the later stages of wound healing might not only induce regression of granulation tissue, but also contribute to wound contraction. In support of this, several studies have detailed the ability of human fibroblasts and keratinocytes to contract collagen lattices in an MMP-1 or MMP-13 dependent manner, respectively (Netzel-Arnett et al., 2002
; Pins et al., 2000
).
MMP-10 (Stromelysin-2) is induced during EC morphogenesis and is activated by multiple serine proteases, leading to activation of MMP-1 and capillary tube regression
To our knowledge, this is the first report documenting the induction of MMP-10 protein during EC tubular morphogenesis in 3D matrices. The presence of a novel stromelysin that remains latent in the absence of serine proteases, but is activated by multiple serine proteases is compelling for many reasons. Stromelysins are known to degrade components of the supporting ECM scaffold, namely basement membrane molecules such as collagen type IV, laminin and perlecan (Baricos et al., 1988
; Bejarano et al., 1988
; Nagase, 1995
; Nagase, 1998
). Additionally, it is known that MMP-10 is capable of activating other MMPs, specifically interstitial collagenases (MMP-1 and MMP-8), whereas MMP-3 has been shown to activate MMP-1, MMP-8 and MMP-13. Importantly, in the presence of serine proteases and stromelysins, MMP-1 is activated to a `super-active' state with an approximately tenfold increase in its ability to degrade collagen (He et al., 1989
; Suzuki et al., 1990
). Thus, during EC tube regression and gel contraction, MMP-1 is not only activated directly by the serine proteases plasmin, kallikrein, neutrophil elastase, cathepsin G, tryptase and chymase, but is also activated directly by MMP-10 (Figs 3, 4, Fig. 7C, Table 1). The involvement of MMP-10 in the capillary tube regression response is shown in Fig. 6. siRNA targeting MMP-10 dramatically delayed tube regression and gel contraction in a manner similar to treatment with MMP-1 siRNA. Interestingly, in this experiment, treatment with MMP-2 or MMP-9 siRNA did not affect capillary tube regression. MMP-2 and MMP-9 are capable of degrading denatured collagen as well as other substrates; but importantly, serine proteases are also capable of degrading denatured collagens (Chung et al., 2004
; Kapadia et al., 2004
). The redundancy in enzymes that degrade denatured collagen may represent one reason why siRNA suppression of MMP-2 or MMP-9 expression has no effect on the tube regression response. Additional evidence supporting a key role of MMP-10 during tube regression is provided in Fig. 8. ECs expressing MMP-10 at increased levels underwent a capillary tube regression response in a manner that was dependent on MMP-1.
Thus, our data are consistent with the conclusion that EC-derived MMP-10 and serine proteases function cooperatively to activate MMP-1 in order to accomplish proteolysis of collagen type I, capillary tube regression and collagen gel contraction (Fig. 9). We present clear evidence that MMP-10 plays a role in MMP-1 activation in that increased expression of MMP-10 accelerates MMP-1 activation (Fig. 7C) and siRNA suppression of MMP-10 delays MMP-1-mediated tube regression and gel contraction (Fig. 6C, Fig. 8D). The influence of MMP-10 on MMP-1 activation directly correlates with capillary tube regression. Our data indicate that both MMP-1 and MMP-10 are involved in the capillary tube regression response in 3D collagen matrices that is stimulated by serine proteases. MMP-10 may also degrade basement membrane matrix components such as collagen type IV, laminin and perlecan, which are critical molecules in the assembly of EC-derived basement membranes. Importantly, stromal-derived MMP-3 is also a plausible candidate for contributing to vascular and other regression events in vivo because of its ability to degrade basement membrane matrix components and to synergistically activate MMP-1 with serine proteases. Further studies are necessary to examine the specific role of these enzymes in basement membrane degradation during capillary tube regression events. Thus, MMP-1 and MMP-10 are known to target the two key ECM components responsible for the establishment and maintenance of vascular tube networks, namely interstitial collagen type I matrix and the associated basement membrane matrix directly surrounding EC-lined tubes (Fig. 9) (Davis et al., 2002
). Overall, these data further define critical molecular mechanisms involved in the disassembly of EC-lined tubes (i.e. capillary tube regression) and reveal a prominent role for specific MMPs (MMP-1 and MMP-10) as well as multiple serine proteases in these events.
| Acknowledgments |
|---|
2 macroglobulin. This work was supported by NIH grants HL59373, HL64372 and HL79460. | References |
|---|
|
|
|---|
Armour, P. C., Levi, S., Golds, E. E., Poole, A. R., Mort, J. S. and Roughley, P. J. (1984). Activation of latent collagenase by serum proteinases that interact with immobilized immunoglobulin G. Rheumatol. Int. 4, 151-155.[CrossRef][Medline]
Ausprunk, D. H., Falterman, K. and Folkman, J. (1978). The sequence of events in the regression of corneal capillaries. Lab. Invest. 38, 284-294.[Medline]
Bacharach, E., Itin, A. and Keshet, E. (1998). Apposition-dependent induction of plasminogen activator inhibitor type 1 expression: a mechanism for balancing pericellular proteolysis during angiogenesis. Blood 92, 939-945.
Bajou, K., Noel, A., Gerard, R. D., Masson, V., Brunner, N., Holst-Hansen, C., Skobe, M., Fusenig, N. E., Carmeliet, P., Collen, D. et al. (1998). Absence of host plasminogen activator inhibitor 1 prevents cancer invasion and vascularization. Nat. Med. 4, 923-928.[CrossRef][Medline]
Bajou, K., Masson, V., Gerard, R. D., Schmitt, P. M., Albert, V., Praus, M., Lund, L. R., Frandsen, T. L., Brunner, N., Dano, K. et al. (2001). The plasminogen activator inhibitor PAI-1 controls in vivo tumor vascularization by interaction with proteases, not vitronectin. Implications for antiangiogenic strategies. J. Cell Biol. 152, 777-784.
Baricos, W. H., Murphy, G., Zhou, Y. W., Nguyen, H. H. and Shah, S. V. (1988). Degradation of glomerular basement membrane by purified mammalian metalloproteinases. Biochem. J. 254, 609-612.[Medline]
Bayless, K. J. and Davis, G. E. (2002). The Cdc42 and Rac1 GTPases are required for capillary lumen formation in three-dimensional extracellular matrices. J. Cell Sci. 115, 1123-1136.
Bayless, K. J. and Davis, G. E. (2003). Sphingosine-1-phosphate markedly induces matrix metalloproteinase and integrin-dependent human endothelial cell invasion and lumen formation in three-dimensional collagen and fibrin matrices. Biochem. Biophys. Res. Commun. 312, 903-913.[CrossRef][Medline]
Bejarano, P. A., Noelken, M. E., Suzuki, K., Hudson, B. G. and Nagase, H. (1988). Degradation of basement membranes by human matrix metalloproteinase 3 (stromelysin). Biochem. J. 256, 413-419.[Medline]
Bell, S. E., Mavila, A., Salazar, R., Bayless, K. J., Kanagala, S., Maxwell, S. A. and Davis, G. E. (2001). Differential gene expression during capillary morphogenesis in 3D collagen matrices: regulated expression of genes involved in basement membrane matrix assembly, cell cycle progression, cellular differentiation and G-protein signaling. J. Cell Sci. 114, 2755-2773.
Benbow, U., Schoenermark, M. P., Mitchell, T. I., Rutter, J. L., Shimokawa, K., Nagase, H. and Brinckerhoff, C. E. (1999). A novel host/tumor cell interaction activates matrix metalloproteinase 1 and mediates invasion through type I collagen. J. Biol. Chem. 274, 25371-25378.
Bornstein, M. B. (1958). Reconstituted rattail collagen used as substrate for tissue cultures on coverslips in Maximow slides and roller tubes. Lab. Invest. 7, 134-137.[Medline]
Brinckerhoff, C. E., Rutter, J. L. and Benbow, U. (2000). Interstitial collagenases as markers of tumor progression. Clin. Cancer Res. 6, 4823-4830.
Browder, T., Folkman, J. and Pirie-Shepherd, S. (2000). The hemostatic system as a regulator of angiogenesis. J. Biol. Chem. 275, 1521-1524.
Cai, J. and Boulton, M. (2002). The pathogenesis of diabetic retinopathy: old concepts and new questions. Eye 16, 242-260.[CrossRef][Medline]
Campochiaro, P. A. and Hackett, S. F. (2003). Ocular neovascularization: a valuable model system. Oncogene 22, 6537-6548.[CrossRef][Medline]
Carmeliet, P. and Jain, R. K. (2000). Angiogenesis in cancer and other diseases. Nature 407, 249-257.[CrossRef][Medline]
Chappuis, P. O., Dieterich, B., Sciretta, V., Lohse, C., Bonnefoi, H., Remadi, S. and Sappino, A. P. (2001). Functional evaluation of plasmin formation in primary breast cancer. J. Clin. Oncol. 19, 2731-2738.
Chung, L., Dinakarpandian, D., Yoshida, N., Lauer-Fields, J. L., Fields, G. B., Visse, R. and Nagase, H. (2004). Collagenase unwinds triple-helical collagen prior to peptide bond hydrolysis. EMBO J. 23, 3020-3030.[CrossRef][Medline]
Clark, R. A. F. (1996). Wound repair: overview and general considerations. In The molecular and cellular biology of wound repair (ed. Clark, R. A. F.), pp. 3-50. New York: Plenum Press.
Colman, R. W. (1999). Biologic activities of the contact factors in vivopotentiation of hypotension, inflammation, and fibrinolysis, and inhibition of cell adhesion, angiogenesis and thrombosis. Thromb. Haemost. 82, 1568-1577.[Medline]
Curry, T. E., Jr and Osteen, K. G. (2001). Cyclic changes in the matrix metalloproteinase system in the ovary and uterus. Biol. Reprod. 64, 1285-1296.
Davis, G. E. and Camarillo, C. W. (1996). An alpha 2 beta 1 integrin-dependent pinocytic mechanism involving intracellular vacuole formation and coalescence regulates capillary lumen and tube formation in three-dimensional collagen matrix. Exp. Cell Res. 224, 39-51.[CrossRef][Medline]
Davis, G. E., Pintar Allen, K. A., Salazar, R. and Maxwell, S. A. (2001). Matrix metalloproteinase-1 and -9 activation by plasmin regulates a novel endothelial cell-mediated mechanism of collagen gel contraction and capillary tube regression in three-dimensional collagen matrices. J. Cell Sci. 114, 917-930.[Abstract]
Davis, G. E., Bayless, K. J. and Mavila, A. (2002). Molecular basis of endothelial cell morphogenesis in three-dimensional extracellular matrices. Anat. Rec. 268, 252-275.[CrossRef][Medline]
Della, P. P., Soeltl, R., Krell, H. W., Collins, K., O'Donoghue, M., Schmitt, M. and Kruger, A. (1999). Combined treatment with serine protease inhibitor aprotinin and matrix metalloproteinase inhibitor Batimastat (BB-94) does not prevent invasion of human esophageal and ovarian carcinoma cells in vivo. Anticancer Res. 19, 3809-3816.[Medline]
Dumin, J. A., Dickeson, S. K., Stricker, T. P., Bhattacharyya-Pakrasi, M., Roby, J. D., Santoro, S. A. and Parks, W. C. (2001). Pro-collagenase-1 (matrix metalloproteinase-1) binds the alpha(2)beta(1) integrin upon release from keratinocytes migrating on type I collagen. J. Biol. Chem. 276, 29368-29374.
Duncan, M. E., Richardson, J. P., Murray, G. I., Melvin, W. T. and Fothergill, J. E. (1998). Human matrix metalloproteinase-9: activation by limited trypsin treatment and generation of monoclonal antibodies specific for the activated form. Eur. J. Biochem. 258, 37-43.[Medline]
Egeblad, M. and Werb, Z. (2002). New functions for the matrix metalloproteinases in cancer progression. Nat. Rev. Cancer 2, 161-174.[Medline]
Fang, K. C., Raymond, W. W., Blount, J. L. and Caughey, G. H. (1997). Dog mast cell alpha-chymase activates progelatinase B by cleaving the Phe88-Gln89 and Phe91-Glu92 bonds of the catalytic domain. J. Biol. Chem. 272, 25628-25635.
Foda, H. D. and Zucker, S. (2001). Matrix metalloproteinases in cancer invasion, metastasis and angiogenesis. Drug Discov. Today 6, 478-482.[CrossRef][Medline]
Folkman, J. (1997). Angiogenesis and angiogenesis inhibition: an overview. EXS 79, 1-8.[Medline]
Frisch, S. M. and Screaton, R. A. (2001). Anoikis mechanisms. Curr. Opin. Cell Biol. 13, 555-562.[CrossRef][Medline]
Gruber, B. L., Marchese, M. J., Suzuki, K., Schwartz, L. B., Okada, Y., Nagase, H. and Ramamurthy, N. S. (1989). Synovial procollagenase activation by human mast cell tryptase dependence upon matrix metalloproteinase 3 activation. J. Clin. Invest. 84, 1657-1662.[Medline]
Hanahan, D. (1997). Signaling vascular morphogenesis and maintenance. Science 277, 48-50.
He, C. S., Wilhelm, S. M., Pentland, A. P., Marmer, B. L., Grant, G. A., Eisen, A. Z. and Goldberg, G. I. (1989). Tissue cooperation in a proteolytic cascade activating human interstitial collagenase. Proc. Natl. Acad. Sci. USA 86, 2632-2636.
He, T. C., Zhou, S., da Costa, L. T., Yu, J., Kinzler, K. W. and Vogelstein, B. (1998). A simplified system for generating recombinant adenoviruses. Proc. Natl. Acad. Sci. USA 95, 2509-2514.
Hiraoka, N., Allen, E., Apel, I. J., Gyetko, M. R. and Weiss, S. J. (1998). Matrix metalloproteinases regulate neovascularization by acting as pericellular fibrinolysins. Cell 95, 365-377.[CrossRef][Medline]
Holash, J., Wiegand, S. J. and Yancopoulos, G. D. (1999). New model of tumor angiogenesis: dynamic balance between vessel regression and growth mediated by angiopoietins and VEGF. Oncogene 18, 5356-5362.[CrossRef][Medline]
Hotary, K., Allen, E., Punturieri, A., Yana, I. and Weiss, S. J. (2000). Regulation of cell invasion and morphogenesis in a three-dimensional type I collagen matrix by membrane-type matrix metalloproteinases 1, 2, and 3. J. Cell Biol. 149, 1309-1323.
Jeffrey, J. J. (1998). Interstitial Collagenases. In Matrix Metalloproteinases (ed. Parks, W. C. and Mecham, R. P.), pp. 15-42. San Diego: Academic Press.
Joseph, K., Ghebrehiwet, B., Peerschke, E. I., Reid, K. B. and Kaplan, A. P. (1996). Identification of the zinc-dependent endothelial cell binding protein for high molecular weight kininogen and factor XII: identity with the receptor that binds to the globular "heads" of C1q (gC1q-R). Proc. Natl. Acad. Sci. USA 93, 8552-8557.
Kapadia, C., Ghosh, M. C., Grass, L. and Diamandis, E. P. (2004). Human kallikrein 13 involvement in extracellular matrix degradation. Biochem. Biophys. Res. Commun. 323, 1084-1090.[CrossRef][Medline]
Kaplan, A. P., Joseph, K., Shibayama, Y., Reddigari, S. and Ghebrehiwet, B. (2001). Activation of the plasma kinin forming cascade along cell surfaces. Int. Arch. Allergy Immunol. 124, 339-342.[CrossRef][Medline]
Knauper, V. and Murphy, G. (1998). Membrane-type matrix metalloproteinases and cell surface-associated activation cascades for matrix metalloproteinases. In Matrix metalloproteinases (ed. Parks, W. C. and Mecham, R. P.), pp. 199-218. San Diego: Academic Press.
Knauper, V., Murphy, G. and Tschesche, H. (1996). Activation of human neutrophil procollagenase by stromelysin 2. Eur. J. Biochem. 235, 187-191.[Medline]
Kokorine, I., Marbaix, E., Henriet, P., Okada, Y., Donnez, J., Eeckhout, Y. and Courtoy, P. J. (1996). Focal cellular origin and regulation of interstitial collagenase (matrix metalloproteinase-1) are related to menstrual breakdown in the human endometrium. J. Cell Sci. 109, 2151-2160.[Abstract]
Lund, L. R., Romer, J., Bugge, T. H., Nielsen, B. S., Frandsen, T. L., Degen, J. L., Stephens, R. W. and Dano, K. (1999). Functional overlap between two classes of matrix-degrading proteases in wound healing. EMBO J. 18, 4645-4656.[CrossRef][Medline]
Maciag, T., Cerundolo, J., Ilsley, S., Kelley, P. R. and Forand, R. (1979). An endothelial cell growth factor from bovine hypothalamus: identification and partial characterization. Proc. Natl. Acad. Sci. USA 76, 5674-5678.
Madri, J. A., Sankar, S. and Romanic, A. M. (1996). Angiogenesis. In The molecular and cellular biology of wound repair (ed. Clark, R. A. F.), pp. 355-371. New York: Plenum Press.
Mahdi, F., Madar, Z. S., Figueroa, C. D. and Schmaier, A. H. (2002). Factor XII interacts with the multiprotein assembly of urokinase plasminogen activator receptor, gC1qR, and cytokeratin 1 on endothelial cell membranes. Blood 99, 3585-3596.
Marbaix, E., Kokorine, I., Donnez, J., Eeckhout, Y. and Courtoy, P. J. (1996). Regulation and restricted expression of interstitial collagenase suggest a pivotal role in the initiation of menstruation. Hum. Reprod. 11 Suppl. 2, 134-143.
Mechoulam, H. and Pierce, E. A. (2003). Retinopathy of prematurity: molecular pathology and therapeutic strategies. Am. J. Pharmacogenomics 3, 261-277.[CrossRef][Medline]
Meredith, J. E., Jr, Fazeli, B. and Schwartz, M. A. (1993). The extracellular matrix as a cell survival factor. Mol. Biol. Cell 4, 953-961.[Abstract]
Murphy, G., Stanton, H., Cowell, S., Butler, G., Knauper, V., Atkinson, S. and Gavrilovic, J. (1999). Mechanisms for pro matrix metalloproteinase activation. APMIS 107, 38-44.[Medline]
Nagase, H. (1995). Human stromelysins 1 and 2. Methods Enzymol. 248, 449-470.[Medline]
Nagase, H. (1998). Stromelysins 1 and 2. In Matrix Metalloproteinases (ed. Parks, W. C. and Mecham, R. P.), pp. 43-84. San Diego: Academic Press.
Nagase, H. and Woessner, J. F., Jr (1999). Matrix metalloproteinases. J. Biol. Chem. 274, 21491-21494.
Nagase, H., Cawston, T. E., de Silva, M. and Barrett, A. J. (1982). Identification of plasma kallikrein as an activator of latent collagenase in rheumatoid synovial fluid. Biochim. Biophys. Acta 702, 133-142.[CrossRef][Medline]
Nagase, H., Enghild, J. J., Suzuki, K. and Salvesen, G. (1990). Stepwise activation mechanisms of the precursor of matrix metalloproteinase 3 (stromelysin) by proteinases and (4-aminophenyl)mercuric acetate. Biochemistry 29, 5783-5789.[CrossRef][Medline]
Nakamura, H., Fujii, Y., Ohuchi, E., Yamamoto, E. and Okada, Y. (1998). Activation of the precursor of human stromelysin 2 and its interactions with other matrix metalloproteinases. Eur. J. Biochem. 253, 67-75.[Medline]
Netzel-Arnett, S., Mitola, D. J., Yamada, S. S., Chrysovergis, K., Holmbeck, K., Birkedal-Hansen, H. and Bugge, T. H. (2002). Collagen dissolution by keratinocytes requires cell surface plasminogen activation and matrix metalloproteinase activity. J. Biol. Chem. 277, 45154-45161.
Nicholson, R., Murphy, G. and Breathnach, R. (1989). Human and rat malignant-tumor-associated mRNAs encode stromelysin-like metalloproteinases. Biochemistry 28, 5195-5203.[CrossRef][Medline]
Nikkola, J., Vihinen, P., Vlaykova, T., Hahka-Kemppinen, M., Kahari, V. M. and Pyrhonen, S. (2001). High collagenase-1 expression correlates with a favourable chemoimmunotherapy response in human metastatic melanoma. Melanoma Res. 11, 157-166.[CrossRef][Medline]
Oh, J., Takahashi, R., Kondo, S., Mizoguchi, A., Adachi, E., Sasahara, R. M., Nishimura, S., Imamura, Y., Kitayama, H., Alexander, D. B. et al. (2001). The membrane-anchored MMP inhibitor RECK is a key regulator of extracellular matrix integrity and angiogenesis. Cell 107, 789-800.[CrossRef][Medline]
Okada, Y., Nagase, H. and Harris, E. D., Jr (1987). Matrix metalloproteinases 1, 2, and 3 from rheumatoid synovial cells are sufficient to destroy joints. J. Rheumatol. 14 Spec No, 41-42.
Pepper, M. S. (2001). Role of the matrix metalloproteinase and plasminogen activator-plasmin systems in angiogenesis. Arterioscler. Thromb. Vasc. Biol. 21, 1104-1117.
Peppin, G. J. and Weiss, S. J. (1986). Activation of the endogenous metalloproteinase, gelatinase, by triggered human neutrophils. Proc. Natl. Acad. Sci. USA 83, 4322-4326.
Pilcher, B. K., Dumin, J. A., Sudbeck, B. D., Krane, S. M., Welgus, H. G. and Parks, W. C. (1997). The activity of collagenase-1 is required for keratinocyte migration on a type I collagen matrix. J. Cell Biol. 137, 1445-1457.
Pilcher, B. K., Sudbeck, B. D., Dumin, J. A., Welgus, H. G. and Parks, W. C. (1998). Collagenase-1 and collagen in epidermal repair. Arch. Dermatol. Res. 290 Suppl., S37-S46.
Pins, G. D., Collins-Pavao, M. E., van De, W. L., Yarmush, M. L. and Morgan, J. R. (2000). Plasmin triggers rapid contraction and degradation of fibroblast-populated collagen lattices. J. Invest Dermatol. 114, 647-653.[CrossRef][Medline]
Salazar, R., Bell, S. E. and Davis, G. E. (1999). Coordinate induction of the actin cytoskeletal regulatory proteins gelsolin, vasodilator-stimulated phosphoprotein, and profilin during capillary morphogenesis in vitro. Exp. Cell Res. 249, 22-32.[CrossRef][Medline]
Schmaier, A. H. (2000). Plasma kallikrein/kinin system: a revised hypothesis for its activation and its physiologic contributions. Curr. Opin. Hematol. 7, 261-265.[CrossRef][Medline]
Schousboe, I. (2001). Rapid and cooperative binding of factor XII to human umbilical vein endothelial cells. Eur. J. Biochem. 268, 3958-3963.[Medline]
Selvarajan, S., Lund, L. R., Takeuchi, T., Craik, C. S. and Werb, Z. (2001). A plasma kallikrein-dependent plasminogen cascade required for adipocyte differentiation. Nat. Cell Biol. 3, 267-275.[CrossRef][Medline]
Senger, D. R. (1996). Molecular framework for angiogenesis: a complex web of interactions between extravasated plasma proteins and endothelial cell proteins induced by angiogenic cytokines. Am. J. Pathol. 149, 1-7.[Medline]
Sepper, R., Konttinen, Y. T., Buo, L., Eklund, K. K., Lauhio, A., Sorsa, T., Tschesche, H., Aasen, A. O. and Sillastu, H. (1997). Potentiative effects of neutral proteinases in an inflamed lung: relationship of neutrophil procollagenase (proMMP-8) to plasmin, cathepsin G and tryptase in bronchiectasis in vivo. Eur. Respir. J. 10, 2788-2793.[Abstract]
Shamamian, P., Schwartz, J. D., Pocock, B. J., Monea, S., Whiting, D., Marcus, S. G. and Mignatti, P. (2001). Activation of progelatinase A (MMP-2) by neutrophil elastase, cathepsin G, and proteinase-3: a role for inflammatory cells in tumor invasion and angiogenesis. J. Cell Physiol 189, 197-206.[CrossRef][Medline]
Sternlicht, M. D. and Werb, Z. (2001). How matrix metalloproteinases regulate cell behavior. Annu. Rev. Cell Dev. Biol. 17, 463-516.[CrossRef][Medline]
Suzuki, K., Enghild, J. J., Morodomi, T., Salvesen, G. and Nagase, H. (1990). Mechanisms of activation of tissue procollagenase by matrix metalloproteinase 3 (stromelysin). Biochemistry 29, 10261-10270.[CrossRef][Medline]
Sympson, C. J., Talhouk, R. S., Alexander, C. M., Chin, J. R., Clift, S. M., Bissell, M. J. and Werb, Z. (1994). Targeted expression of stromelysin-1 in mammary gland provides evidence for a role of proteinases in branching morphogenesis and the requirement for an intact basement membrane for tissue-specific gene expression. J. Cell Biol. 125, 681-693.
Talhouk, R. S., Bissell, M. J. and Werb, Z. (1992). Coordinated expression of extracellular matrix-degrading proteinases and their inhibitors regulates mammary epithelial function during involution. J. Cell Biol. 118, 1271-1282.
Tyagi, S. C., Ratajska, A. and Weber, K. T. (1993). Myocardial matrix metalloproteinase(s): localization and activation. Mol. Cell Biochem. 126, 49-59.[CrossRef][Medline]
Tyagi, S. C., Kumar, S. and Borders, S. (1996). Reduction-oxidation (redox) state regulation of extracellular matrix metalloproteinases and tissue inhibitors in cardiac normal and transformed fibroblast cells. J. Cell Biochem. 61, 139-151.[CrossRef][Medline]
Vernon, R. B. and Sage, E. H. (1995). Between molecules and morphology. Extracellular matrix and creation of vascular form. Am. J. Pathol. 147, 873-883.[Abstract]
Weiss, S. J., Peppin, G., Ortiz, X., Ragsdale, C. and Test, S. T. (1985). Oxidative autoactivation of latent collagenase by human neutrophils. Science 227, 747-749.
Werb, Z., Sympson, C. J., Alexander, C. M., Thomasset, N., Lund, L. R., MacAuley, A., Ashkenas, J. and Bissell, M. J. (1996). Extracellular matrix remodeling and the regulation of epithelial-stromal interactions during differentiation and involution. Kidney Int. Suppl. 54, S68-S74.
Werb, Z., Vu, T. H., Rinkenberger, J. L. and Coussens, L. M. (1999). Matrix-degrading proteases and angiogenesis during development and tumor formation. APMIS 107, 11-18.[Medline]
Windsor, L. J., Grenett, H., Birkedal-Hansen, B., Bodden, M. K., Engler, J. A. and Birkedal-Hansen, H. (1993). Cell type-specific regulation of SL-1 and SL-2 genes. Induction of the SL-2 gene but not the SL-1 gene by human keratinocytes in response to cytokines and phorbolesters. J. Biol. Chem. 268, 17341-17347.
Zhu, W. H., Guo, X., Villaschi, S. and Francesco, N. R. (2000). Regulation of vascular growth and regression by matrix metalloproteinases in the rat aorta model of angiogenesis. Lab. Invest. 80, 545-555.[Medline]
Zhu, Y. K., Liu, X. D., Skold, C. M., Umino, T., Wang, H. J., Spurzem, J. R., Kohyama, T., Ertl, R. F. and Rennard, S. I. (2001). Synergistic neutrophil elastase-cytokine interaction degrades collagen in three-dimensional culture. Am. J. Physiol Lung Cell Mol. Physiol. 281, L868-L878.
Zucker, S., Cao, J. and Chen, W. T. (2000). Critical appraisal of the use of matrix metalloproteinase inhibitors in cancer treatment. Oncogene 19, 6642-6650.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
W. Koh, K. Sachidanandam, A. N. Stratman, A. Sacharidou, A. M. Mayo, E. A. Murphy, D. A. Cheresh, and G. E. Davis Formation of endothelial lumens requires a coordinated PKC{epsilon}-, Src-, Pak- and Raf-kinase-dependent signaling cascade downstream of Cdc42 activation J. Cell Sci., June 1, 2009; 122(11): 1812 - 1822. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Firth, V.-J. Uitto, and E. E. Putnins Mechanical Induction of an Epithelial Cell Chymase Associated with Wound Edge Migration J. Biol. Chem., December 12, 2008; 283(50): 34983 - 34993. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Blackburn and C. E. Brinckerhoff Matrix Metalloproteinase-1 and Thrombin Differentially Activate Gene Expression in Endothelial Cells via PAR-1 and Promote Angiogenesis Am. J. Pathol., December 1, 2008; 173(6): 1736 - 1746. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-C. Su, E. A. Mendoza, H.-i. Kwak, and K. J. Bayless Molecular profile of endothelial invasion of three-dimensional collagen matrices: insights into angiogenic sprout induction in wound healing Am J Physiol Cell Physiol, November 1, 2008; 295(5): C1215 - C1229. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Butler, R. A. Dean, E. M. Tam, and C. M. Overall Pharmacoproteomics of a Metalloproteinase Hydroxamate Inhibitor in Breast Cancer Cells: Dynamics of Membrane Type 1 Matrix Metalloproteinase-Mediated Membrane Protein Shedding Mol. Cell. Biol., August 1, 2008; 28(15): 4896 - 4914. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Koh, R. D. Mahan, and G. E. Davis Cdc42- and Rac1-mediated endothelial lumen formation requires Pak2, Pak4 and Par3, and PKC-dependent signaling J. Cell Sci., April 1, 2008; 121(7): 989 - 1001. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Y. Kassim, S. A. Gharib, B. H. Mecham, T. P. Birkland, W. C. Parks, and J. K. McGuire Individual Matrix Metalloproteinases Control Distinct Transcriptional Responses in Airway Epithelial Cells Infected with Pseudomonas aeruginosa Infect. Immun., December 1, 2007; 75(12): 5640 - 5650. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Shimoda, N. Fukazawa, K. Nonomura, and R. L. Fairchild Cathepsin G Is Required for Sustained Inflammation and Tissue Injury after Reperfusion of Ischemic Kidneys Am. J. Pathol., March 1, 2007; 170(3): 930 - 940. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. B. Saunders, B. L. Bohnsack, J. B. Faske, N. J. Anthis, K. J. Bayless, K. K. Hirschi, and G. E. Davis Coregulation of vascular tube stabilization by endothelial cell TIMP-2 and pericyte TIMP-3 J. Cell Biol., October 9, 2006; 175(1): 179 - 191. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Dollery and P. Libby Atherosclerosis and proteinase activation Cardiovasc Res, February 15, 2006; 69(3): 625 - 635. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. E. Davis and D. R. Senger Endothelial Extracellular Matrix: Biosynthesis, Remodeling, and Functions During Vascular Morphogenesis and Neovessel Stabilization Circ. Res., November 25, 2005; 97(11): 1093 - 1107. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||