|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online June 8, 2005
doi: 10.1242/10.1242/jcs.02374
Research Article |
1 is essential for early events in integrin signalling required for cell motility
1 Cancer Research UK Centre for Cell and Molecular Biology, Chester Beatty Laboratories, The Institute of Cancer Research, Fulham Road, London, SW3 6JB, UK
2 Cancer Research UK Centre for Cancer Therapeutics, The Institute of Cancer Research, Sutton, Surrey, SM2 5NG, UK
* Author for correspondence (e-mail: matilda{at}icr.ac.uk)
Accepted 10 March 2005
| Summary |
|---|
|
|
|---|
1, has previously been implicated in growth-factor-mediated chemotaxis but its position and roles in more-complex motility events remain poorly understood. This study links PLC
1 to early, integrin-regulated changes leading to cell motility. The key role of PLC
1 was supported by findings that specific depletion of PLC
1 by small interfering (si)RNA, or by pharmacological inhibition, or the absence of this isoform in PLC
1/ cells resulted in the failure to form cell protrusions and undergo cell spreading and elongation in response to integrin engagement. This integrin-PLC
1 pathway was shown to underlie motility processes involved in morphogenesis of endothelial cells on basement membranes and invasion of cancer cells into such three-dimensional matrices. By combining cellular and biochemical approaches, we have further characterized this signalling pathway. Upstream of PLC
1 activity, ß1 integrin and Src kinase are demonstrated to be essential for phosphorylation of PLC
1, formation of protein complexes and accumulation of intracellular calcium. Cancer cell invasion and the early morphological changes associated with cell motility were abolished by inhibition of ß1 integrin or Src. Our findings establish PLC
1 as a key player in integrin-mediated cell motility processes and identify other critical components of the signalling pathway involved in establishing a motile phenotype. This suggests a more general role for PLC
1 in cell motility, functioning as a mediator of both growth factor and integrin-initiated signals.
Key words: PLC
1, Signalling, Motility, Extracellular matrix
| Introduction |
|---|
|
|
|---|
Phosphoinositide-specific phospholipase C (PI-PLC) enzymes have been established as crucial signalling molecules involved in the regulation of a variety of cellular functions (Katan, 1998
; Rebecchi and Pentyala, 2000
; Rhee, 2001
). The evidence also suggests a critical involvement of members of the PLC
family (PLC
1 and PLC
2) in several aspects of motility regulation. A distinct regulatory feature of PLC
enzymes is that their activation is linked to an increase in phosphorylation of specific tyrosine residues. As a direct substrate for a number of receptors with intrinsic tyrosine kinase activity, including epidermal growth factor (EGF) and platelet-derived growth factor (PDGF) receptors, PLC
1 has been shown to mediate chemotaxis towards these growth factors as a rate-limiting component (reviewed by Kassis et al., 2001
; Wells, 2000
). This role of PLC
1 has been demonstrated in cells engineered to express wild-type and mutant PDGF or EGF receptors and variants of PLC
1 (Chen et al., 1994
; Kundra et al., 1994
; Ronnstrand et al., 1999
) as well as in several tumour cell lines, particularly those characterized by high levels of EGF receptor (Kassis et al., 1999
; Price et al., 1999
; Thomas et al., 2003
). It has also been suggested that EGF-driven and PLC
1-mediated chemotaxis could have an important role in invasion in several human tumour xenograft models in vivo (Turner et al., 1997
). However, possible contributions of ECM receptor signalling to haptotaxis or motility phenotypes resulting from inhibition of PLC
1 were difficult to dissect in these chemotaxis assays (Wells, 2000
).
The possibility that PLC
could also be an important signalling component in responses triggered directly by ECM receptors was initially suggested by observations that PLC
1 can become phosphorylated upon integrin engagement, or recruited to integrin complexes in fibroblasts (Langholz et al., 1997
; Zhang et al., 1999
). Recently, several studies in highly specialized cell types (platelets and osteoclasts) supported the role of PLC
isoforms in `outside-in' signalling, downstream of ECM receptors (Inoue et al., 2003
; Nakamura et al., 2001
; Wonerow et al., 2003
). However, it is not known whether the participation of PLC
enzymes in integrin signalling is a more general phenomenon, or which signalling components are involved or which physiological processes it could underlie in different cellular systems. In particular, the involvement in motility processes, such as those important for invasion and morphogenesis of cancer cells and endothelial cells during tumour progression, has not been addressed.
Here, we show that PLC
1 has a key role in integrin-dependent cell motility required for invasion of diverse cancer cell types and morphogenesis of endothelial cells on basement membranes. Depletion of PLC
1 and inhibition of PLC activity show that early events that follow attachment to the ECM are affected, resulting in lack of cell spreading and elongated cell morphology. By combining cellular studies and biochemical methods, we also suggest signalling components upstream (ß1-containing integrins, adaptor protein GIT1 and Src kinases) and downstream (increase in intracellular calcium concentrations) of PLC
1, providing a model of this novel signalling pathway. These data demonstrate that PLC
1 is involved in processes related to cell motility more widely than previously suggested and that, in addition to chemotaxis triggered by growth factor receptors, PLC
1 is stimulated through integrin activation in different cancer cell types and activated endothelial cells.
| Materials and Methods |
|---|
|
|
|---|
-tubulin and mouse and rabbit HRPO (horseradish peroxidase)-conjugated secondary antibodies were from Sigma. Texas-Red-X Phalloidin and Cell tracker Green CMFDA (Total cytoplasm label) were from Molecular Probes. EGF receptor inhibitor AG1478 and thapsigargin were from Biomol. siRNA oligonucleotides were obtained from Dharmacon and Oligofectamine Lipofectamine/Lipofectamine plus and OPTIMEM were from Invitrogen. Anti-PLC
1, anti-PKC(pan), anti-Src and anti-EGF receptor (blocking) were from Upstate. pPLC(Y783), pPKC(S660) and pSrc(Y416) were from Cell Signaling Technology. Anti-GAPDH was purchased from Research Diagnostics. Anti-PLC
2 was supplied by Santa Cruz. Anti-integrin ß1 (4B4 blocking) was supplied by Beckman Coulter and anti-integrin ß1 (TS2/16 activating) from Pierce Endogen. Anti-GIT1, anti-phosphotyrosine, cell recovery solution, Matrigel, growth factor-reduced Matrigel, laminin, collagen I and collagen IV were obtained from BD Bioscience. Protein-G agarose was from Roche and fluorescent secondary antibodies from Jackson Immunologicals. Mouse PLC
1/ and PLC
1+ (add back) fibroblast cells and rat PLC
1-GFP were a kind gift from Graham Carpenter (Vanderbilt University. Nashville, USA) and the catalytically inactive PLC
1 construct was a kind gift from Klaus Seedorf (Lilly, Hamburg, Germany).
Cell culture protocols
BE (colon carcinoma), DU145 (prostate carcinoma), A431 and Mouse PLC
1/ and PLC
1+ fibroblast cells were maintained at 37°C in DMEM supplemented with 10% FBS. The cells were starved for 24 hours in DMEM containing 1% heat-inactivated FBS. Human umbilical vein endothelial cells (HUVECs; pooled donors, TCS CellWorks) were maintained at 37°C in large endothelial cell growth media plus supplements (TCS CellWorks). These cells were starved for 1 hour in MCDB-131 media supplemented with 0.2 ng/ml EGF, 0.1 µg/ml hydrocortisone and 0.1% (w/v) BSA. For certain experiments, cell cytoplasms were pre-labelled with a green fluorescent tracker dye (1 nM; Molecular Probes) for 1 hour prior to trypsinization and use in experimental procedures. For siRNA protocols, pre-annealed purified siRNA probes were from Dharmacon and were rehydrated prior to transfection using their standard protocol. The siRNA sequence targeting PLC
1 is AAGAAGTCGCAGCGACCCGAG and the control non-targeting sequence is AAGCGCGCTTTGTAGGATTCG. siRNA probes (200 nM) were transfected using oligofectamine using a multiple transfection strategy that involved successive siRNA transfections on three consecutive days over a 3-day period. Treated cells were then either used for experiments 72 hours after the first transfection or were extracted for western blotting to check depletion levels. For siRNA rescue experiments, BE cells were transfected with either GFP or rat PLC
1-GFP on day 3 of the multiple transfection protocol prior to the third and final siRNA transfection. Briefly, 1 µg of DNA was transfected into the cells for 4 hours using the lipofectamine plus transfection system. Subsequently, following extensive washing, the third and final siRNA transfection was performed in a similar fashion to the previous two siRNA transfections. The effects of the rescue were then analysed 24 hours later (72 hours after the first siRNA transfection). Transfection of other cell lines (i.e. mouse fibroblasts) was also performed in a similar fashion using the lipofectamine plus system with effects analysed 24 hours post-transfection.
Preparation and processing of cell lysates
Cells were scrapped into ice-cold lysis buffer (20 mM Tris-HCl pH 7.4, 1 mM EDTA, 50 mM KCl, 1 mM DTT, 1 mM Na3VO4, 5 mM MgCl2, 5 mM NaF, 10%[v/v] Glycerol, 1%[v/v] Triton X-100) supplemented with protease inhibitor cocktail (Roche) and phosphatase inhibitor cocktail II (Sigma) and then homogenized by passing the lysate through a Hamilton syringe (gauge 22) 10 times. After standing on ice for 10 minutes, lysates were clarified by centrifugation (15,800 g/10 minutes) and the supernatant used as the cell lysate. Lysates were either used for immunoprecipitation (see below), protein concentration determination (by Bradford methods) or directly for SDS-PAGE/blotting following the addition of SDS-sample buffer. In certain circumstances, cell lysates were obtained from Matrigel. Briefly, cells on Matrigel were washed and then incubated for 30 minutes with PBS containing phosphatase inhibitor cocktail 2 (Sigma). Following this, the cells were scraped into a suitable volume (2 ml per cm2) of ice-cold, cell recovery solution (BD Biosciences) and left on ice for 1 hour to digest the Matrigel. Following digestion, the cell pellet was recovered by centrifugation (160 g/5 minutes) and the cells lysed and processed in accordance with the lysis protocol. For immunoprecipitation protocols, cell lysates were incubated first with washed protein-G agarose beads for 2 hours at 4°C as a pre-clearing step. Following this, the supernatant was incubated overnight at 4°C with the desired primary antibody. Washed protein-G agarose was added to this mixture and the incubation allowed to proceed for a further 2 hours at 4°C. The beads were then washed three times with lysis buffer and solublized with SDS-sample buffer. Samples were separated by 10% SDS-PAGE and the proteins transferred to PVDF membrane. After blocking, membranes were incubated with suitable primary antibody (1 in 1000 dilution) overnight at 4°C. Following washing with 0.1% TBS-Tween, membranes were incubated with suitable HRPO-conjugated secondary antibody for 2 hours at room temperature. After further washing, proteins were visualized using the ECL detection method (Amersham Bioscience).
Immunofluorescence
Cells were fixed in 3.7% formaldehyde in PBS and permeabilized in 0.2% Triton X-100 in PBS. Following blocking in 2% BSA in PBS for 1 hour, fixed cells were incubated directly with either Texas-Red Phalloidin (1 in 1000) or FITC anti-
-tubulin (1 in 1000) for 2 hours. After extensive washing, cells were observed by immunofluorescent microscopy (Nikon Eclipse E600) and Bio-Rad confocal setup plus Laser Sharp software (Biorad MRC1024).
Analysis of cell morphology and motility on Matrigel
Cell culture dishes were coated with a thin layer of Matrigel (diluted 2 parts to 1 part DMEM). This was then allowed to set at 37°C for 90 minutes (approx. 200 µl of this mix was used per cm of dish area). Green Tracker dye-labelled cells were then plated in the Matrigel in the presence or absence of inhibitor compounds and the ability of the cells to elongate was analysed at various time points using time-lapse and fixed-time-point (phase contrast and fluorescent) microscopy (Nikon microscope camera, Open-Lab software). For time-lapse microscopy, cells were placed on a motorized stage (Prior Scientific) within an incubation chamber (5% CO2 37°C). Images were recorded every 10 minutes over a 20-hour period (Nikon Elipse Microscope, Hamamatsu ORCA-ER camera, Simple PCI software). The images could then be converted into a movie and analysis carried out using Simple PCI software. For cell invasion studies, a similar method to that described before (Sahai and Marshall, 2003
) was employed. Briefly, 100 µl of growth factor-reduced Matrigel was prepared in a 8 µM pore Transwell chamber (Costar). Tracker dye-labelled serum-starved cells (30,000) were seeded in 1% heat-inactivated FBS/DMEM (containing inhibitors when required) on the opposite side of the Transwell from the Matrigel. The cells were allowed to adhere for 4 hours before filling the lower chamber of the Transwells (which contain the cells) with 1% heat-inactivated FBS/DMEM and the upper chamber with 10% FBS/DMEM. After 24 and 48 hours, the number of cells invading across the Transwell filter and into the matrix was analysed by fluorescent and phase contrast microscopy (Nikon Eclipse microscope, Hamamatsu ORCA-ER Camera, Open lab software). Invasion into the matrigel was assessed by Z-section confocal microscopy (see below for methodology) to confirm that invading cells not only crossed the Transwell filter but also invaded into the Matrigel. Where required, this methodology was adapted to enable 3D reconstruction of the invasion phenotype (Sahai and Marshall, 2003
). Briefly, cells treated as above were seeded into growth factor-reduced Matrigel-coated 8 µM pore Transwell chambers and 10% FBS in DMEM was used as a chemoattractant in the lower well. At set times, cells were fixed with 3.7% formaldehyde, washed, and fluorescent cells were analysed by Z-section confocal microscopy (1 section every 4 µM through the Matrigel) using a Bio-Rad MRC1024 confocal microscope (Bio-Rad-Laser Sharp software). Three-dimensional reconstruction of the cells was performed using velocity software (Improvision).
Calcium-release, PtdIns(4,5)P2-hydrolysis and in-vitro-phosphorylation assays
For calcium-release assays, BE cells were labelled with Fluo-3 dye (2 µM) for 1 hour prior to washing and trypsinization. Following centrifugation (5 minutes, 160 g) the cells were resuspended in serum-free DMEM at a concentration of 8 x105 cells per ml. Calcium measurements were performed as described in (Rodriguez et al., 2001
). Briefly, 2 ml of cell suspension was placed in a cuvette in the fluorimeter (excitation 490 nm, emission 525 nm) and the baseline measured for a few minutes. Stimulants (10 µg/ml TS2/16 or 5 mM MnCl2) were added through a Hamilton syringe and the calcium release measured over a 40-minute period. Calcium release was then quantified using standard calcium calibrations procedures for Fluo-3 dye (Kao et al., 1989
). For calcium signalling on Matrigel, BE cells were pre-labelled with Fura-2 dye (2 µM) for 1 hour prior to trypsinization. The labelled cells were then plated onto Matrigel and immediately visualized by fluorescent real-time video microscopy (dual-colour Nikon Elipse Microscope, Hamamatsu ORCA-ER camera, Simple PCI software) at excitation wavelengths of 380 nm (green: low/basal intracellular calcium) and 340 nm (red: high/released intracellular calcium) over a 30-minute period (emission 510 nM). For phosphatidylinositol (4,5)-bisphosphate [PtdIns(4,5)P2] hydrolysis assay, previously described methodology (Mullinax et al., 1999
) was used. The phosphorylation assay and purification of GST-tagged proteins was as previously described (Rodriguez et al., 2001
). Briefly, 2 µg of purified specific array domain of PLC
1 (
SA) protein (aa residues 484-936) was incubated for times indicated with Src-family kinases (0.5 µg) in a reaction buffer containing: 50 mM Tris (pH 8), 2 mM MnCl2, 2 mM MgCl2, 1 mM Na2VO4, 2 mM DTT and 50 µM ATP at 37°C. Reactions were stopped by the addition of 4 x SDS sample buffer, boiled and analysed by western blotting with appropriate antibodies [phosphotyrosine and pPLC
1(Y783)]. Where necessary, the degree of phosphorylation was quantified by densitometry (NIH image software).
| Results |
|---|
|
|
|---|
|
380%), with colorectal BE cells elongating significantly (
160%) and the prostate cell line DU145 (right panel) only slightly (
40%). Consequently, the cancer cells were not capable of generating very extensive networks but instead made shorter formations supporting the cell movement.
In a more commonly used migration assay for cancer cells invasion through Matrigel in response to a chemotactic gradient both BE and DU145 cells showed a polarized morphology and migrated towards serum; BE cells invaded slightly further than DU145 over a 24-hour time period (Fig. 1B).
Depletion of PLC
1 or pharmacological inhibition of PLC activity prevents early changes in morphology and subsequent movement of tumour and endothelial cells
To assess the role of PLC
1 in processes that follow initial cell-ECM interactions, tumour cells and endothelial cells were treated either with siRNA to PLC
1 or an inhibitor of PLC activity. The PLC
1 downregulation was specific and most effective in BE cells (Fig. 2A). Since the direct action of the commercially available PI-PLC inhibitor U73122 on different PI-PLC families has not been demonstrated, we confirmed that U73122 inhibited PLC
1 protein in a direct assay in vitro whereas the control compound U73343 had no effect (Fig. 2B).
|
1 siRNA showed rounded morphology even after 4 hours following the attachment to the matrix and were observed to be poorly motile; in comparison at this time point, the control cells were elongated and moving. The same round phenotype and lack of motility was observed when using PI-PLC inhibitor U73122 in both BE and DU145 cells. A similar rounded morphology in PLC
1 siRNA- or U73122-treated HUVECs was also observed, with these cells unable to move, elongate further or form capillary-like structures. Using a chemoinvasion assay, we also demonstrated that the treated BE and DU145 cells were not able to transmigrate through this matrix (Fig. 2F).
In a set of control experiments, we also confirmed the data described in Fig. 2D and E using another siRNA probe of similar potency (data not shown). In addition, we analysed PLC
1/ fibroblasts (Ji et al., 1998
) and found that the early morphological changes were delayed and partially inhibited (supplementary material Fig. S2) rather than diminished completely, as found following the treatment of BE and endothelial cells with PLC
1 siRNA probes (Fig. 2). Since one likely reason for such discrepancy could be previously observed upregulation of PLC
2 in PLC
1/ fibroblasts (Fleming et al., 1998
), this finding further supports involvement of PLC
1 in early ECM-induced cell morphological changes. Furthermore, transfection of rat PLC
1 into BE cells and transfection of PLC
1/ fibroblasts with the wild-type and catalytically inactive PLC
1 suggested that the elongated morphology could only fully be rescued by the wild-type PLC
1 (Fig. 2D and supplementary material Fig. S2). The catalytically inactive PLC
1 mutant could only partially rescue the elongated phenotype perhaps through the non-catalytic function of PLC
1 in regulating agonist-induced calcium entry (Patterson et al., 2002
). However, our data using siRNA, wild-type and catalytically PLC
1 rescue and various inhibitors suggest that non-catalytic or scaffold roles of PLC
1 do not make a major contribution in establishing this phenotype.
Further experiments established that the effects of PLC
1 downregulation or inhibition on cell morphology were not significant when other substrates such as collagen I, collagen IV, laminin or plastic were used (supplementary material Fig. S3). Whereas some degree of cell elongation was observed on these substratum, it was far less pronounced than that seen on Matrigel and was not accompanied by the characteristic cell grouping observed on Matrigel. This suggests that multicomponent, three-dimensional ECM is required for the observed phenotype and that PLC
1 is required specifically for the establishment of this Matrigel-dependent phenotype. It was also determined that the abilities of cells to adhere firmly to plastic and remain viable were not affected by the siRNA or U73122 treatments. The culture on this substrate, not accompanied by pronounced morphological differences, thus demonstrates that these treatments were not intrinsically harmful or toxic to the cells (Fig. 2C). Similarly, based on the time-lapse recordings, the initial attachment to and cell viability on the basement membrane matrices were not affected and, under the circumstances where U73122 was not replenished at suitable time points, cells recovered their elongated and motile phenotype over time (data not shown).
The data in Fig. 2 suggest that PLC
1 could have a role at early stages following the initial attachment of cells to the matrix, where further cell-ECM linkages, integrin-triggered signalling and cytoskeletal reorganization lead to more spread and elongated morphology (Friedl and Brocker, 2000
). Further studies of these early events were performed in BE cells, which are characterized by distinct morphological changes at these time points. As shown in Fig. 3, the early changes in actin organization included formation of protrusions that become more polarized, with the enrichment of actin in areas of cell-cell contacts; microtubules were excluded from the protrusions. The formation of these structures was greatly reduced in cells treated with PLC
1 siRNA or U73122 (Fig. 3, bottom panels). These data are consistent with previously suggested involvement of PLC
in cytoskeletal reorganization (Kassis et al., 2001
; Wells, 2000
). They were also further supported here by observations in the context of a different cellular response; using the same PLC
1 siRNA probe, the formation of lamellipodia and filopodia in response to serum stimulation was dramatically reduced in DU145 prostate carcinoma cells (supplementary material Fig. S4).
|
Activation of PLC
1 requires engagement of integrins and involvement of Src kinases
On the basis of previous studies of PLC
isoforms (Inoue et al., 2003
; Kassis et al., 2001
; Nakamura et al., 2001
; Wells, 2000
; Wonerow et al., 2003
), the requirement for PLC
1 observed in our experiments could be due to its role in growth factor signalling leading to modulation of the cytoskeleton and integrins or to the involvement of PLC
1 downstream of integrins. Although these pathways could have some of the components in common, the involvement of Src kinases in cell spreading and migration appears to be a distinct requirement for the integrin-triggered pathway yet is dispensable for motility responses to growth factors (Klinghoffer et al., 1999
; Nakamura et al., 2001
). Therefore, to distinguish between these possibilities, we used a combination of inhibitory and activating antibodies to integrins and inhibitors of Src kinases.
Since the phosphorylation of PLC
1 on Y783 has been linked to activation of PLC
1 (Rhee, 2001
), the phosphorylation of this residue was analysed in BE cells after attachment to the ECM ligands (Fig. 4A). This phosphorylation was clearly observed in control cells extracted from Matrigel, but it was abolished in the presence of an inhibitory antibody to ß1 integrin or the Src kinase inhibitor PP2. We also found that phosphorylation of Src kinases on residue Y416 (which in some, but not all, cell types is linked to the integrin engagement) (Cary et al., 2002
), was prevented by the inhibitory antibody to ß1 integrin. By contrast, treatment of BE cells on Matrigel with phosphoinositide 3-kinase (PI-3K) inhibitor, LY294002 compound, affected only phosphorylation of a PI-3K target, PKB-Akt kinase, without any effect on phosphorylation of Src and PLC
1 (data not shown). The involvement of ß1 integrins and Src kinases in signalling to PLC
1 was further supported by experiments where a stimulatory rather than inhibitory antibody to ß1 integrins or Mn2+ ions, known to trigger integrin `outside-in' signalling, were used. An increase in phosphorylation of both Src and PLC
1 was clearly detected following stimulation of serum-starved BE cells plated on plastic (Fig. 4B), where stimulation is performed in a more controlled and synchronized way than on Matrigel.
|
1 and Src kinases was examined further by analysis of protein complexes present in BE cells after attachment (Fig. 4C). It was shown for control BE cells that PLC
1 and Src kinase co-immunoprecipitated using either anti-PLC
1 or anti-Src antibody. Although PLC
1 and Src kinases could interact with several different proteins, recent data suggested that an adaptor protein GIT1 could mediate their interaction in different signalling contexts (Haendeler et al., 2003
1 or Src kinase antibodies. Furthermore, when the interaction with integrins was blocked by an inhibitory antibody, the presence of PLC
1 in complexes obtained with anti-Src antibodies and the presence of Src in the immunoprecipitates obtained with anti-PLC
1 antibody were greatly reduced. The interaction of GIT1 with PLC
1 also appeared to be dependent upon integrin engagement.
The data in Fig. 4A,B suggest that PLC
1 is placed downstream of Src kinases. In addition, it has been reported that PLC
isoforms can be phosphorylated directly by several members of the Src family (Liao et al., 1993
; Rodriguez et al., 2001
). In agreement with these previous observations, we found that purified Src, Fyn and Lck can phosphorylate PLC
1 in vitro. Furthermore, unlike Syk tyrosine kinase, they were capable of phosphorylating the tyrosine residue critical for activation, Y783 (Fig. 4D); this residue was also phosphorylated in BE cells attached to Matrigel (Fig. 4A). Although other tyrosine kinases could be responsible for phosphorylation of PLC
1 in cells, it is therefore also possible that Src kinases could be directly involved. In BE cells, Src was found to be the most highly expressed member of the Src-family kinases, although Fyn was also detectable (data not shown).
|
1.
The possibility that stimulation of EGF receptor contributes to PLC
1 signalling in responses to integrin engagement on Matrigel was also investigated. EGF receptor inhibitor AG1478 and a blocking anti-EGF receptor antibody did not have an effect on BE cell elongation on Matrigel (Fig. 5A). We also found that BE cells express low levels of EGF receptor and showed that, in A431 cells that express high levels of EGF receptor, inhibitor AG1478 was functional and prevented PKC phosphorylation (Fig. 6B). Furthermore, EGF receptor inhibition did not affect phosphorylation of PLC
1 and Src on Matrigel, and the EGF receptor was found not to co-immunoprecipitate with Src or PLC
1 (see legend to Fig. 4).
|
1, it is likely that the requirement for PLC
1 is due to its catalytic function rather than to a possible role as a scaffold protein (Patterson et al., 2002
To assess involvement of PI-PLC-mediated calcium accumulation and possible requirements for PKC in early morphological changes and cell movement dependent on interactions with the ECM, we used several well-characterized inhibitors. Exposure to 2-ABP, an inositol (1,4,5) trisphosphate [Ins(1,4,5)P3] receptor antagonist, the intracellular calcium-chelating agent BAPTA-AM or the sarcoplasmic-endoplasmic reticulum calcium ATPase inhibitor thapsigargin (which disrupts intracellular calcium gradients) resulted in rounded morphology of BE cells (Fig. 7A). Morphology of endothelial cells was similarly affected and their ability to form cellular networks was reduced (Fig. 7B). These compounds also inhibited chemoinvasion of BE and DU145 cells (Fig. 7C). Different results were obtained when using PKC inhibitors R0-31-8220 and GF109203X. These two inhibitory compounds affected cells at a later stage than observed with other inhibitors; both HUVECs and BE cells were elongated and grouped in smaller formations but were unable to form extensive networks (Fig. 7A,B). The invasion of cancer cells treated with these PKC inhibitors was also only partially affected (Fig. 7C). These data suggest the role of calcium mobilization downstream of PLC
; however, further experimental evidence is needed to assess to what extent calcium contributes to the downstream responses. The other second messenger generated by PI-PLC action, DAG, could also be important but it is unlikely that the early morphological changes are mediated by PKC.
|
| Discussion |
|---|
|
|
|---|
1 in a signal transduction pathway leading to a more spread and elongated morphology. Other important components, summarized in Fig. 8, include integrins, Src-family kinases and intracellular calcium mobilization. The supporting data are shown in Figs 2, 4, 5 and 6. Several previous observations using different, often highly specialized, cell types have also suggested a link between the components of the pathway proposed here and cell spreading. Cells generated from mice deficient in one (src/ osteoclasts) or several members (src/, fyn/, yes/ fibroblasts) of the Src-family kinases demonstrated impaired cell spreading and migration in response to integrin engagement. The inhibition of Src kinase activity in platelets also resulted in reduced cell spreading and loss of PLC
2 phosphorylation following the engagement of von Willebrand factor or
2ß1 and
IIbß3 integrins (Inoue et al., 2003
|
2 isoform (Inoue et al., 2003
2 (Mangin et al., 2003
1 isoform in similar processes, initial observations have indicated that a fibroblast cell line derived from PLC
1/ mice could have a more rounded morphology (Ji et al., 1998
could be an important and quite general pathway operating in a variety of cell types. Further comparison of different cell lines and ECM ligands described here also suggests that, depending on the type and strength of integrin-ECM interactions, the signalling through PLC
could contribute to early morphological changes to different degrees.
Although several lines of experimental evidence support an overlap and synergy between integrin-mediated and growth factor pathways, there is also evidence that they could operate independently. In particular, the involvement of Src kinases in integrin signalling is not required for the effects of growth factors on similar processes; thus, the cell spreading or migration in response to soluble growth factors, as well as PLC
phosphorylation, were not affected in fibroblasts and osteoclasts from mice deficient in Src kinases (Klinghoffer et al., 1999
; Nakamura et al., 2001
). It has also been shown that PDGF receptor lacking the tyrosine residue phosphorylated by Src retained and had even more enhanced chemotaxis towards PDGF, mediated by enhanced phosphorylation and activation of PLC
1 (Ronnstrand et al., 1999
). The link between Src kinase and PLC
1 shown here (Fig. 4) indicates that the main function of PLC
1 in our experimental system is in integrin rather than growth factor-triggered responses.
On the basis of broader studies in different cellular responses, PLC
isoforms can be linked to downstream processes though generation of second messengers or reduction in PtdIns(4,5)P2 concentrations, both of which require PLC catalytic activity, as well as through protein-protein interactions that are independent of this PLC activity (Katan, 1998
; Putney, 2002
; Rebecchi and Pentyala, 2000
; Rhee, 2001
). Although the role of PLC
as a scaffold protein was originally linked to cell proliferation (Smith et al., 1994
), other evidence from cellular systems where PLC
functions as an essential component of growth factor-induced chemotaxis suggests that, at least in this type of cell movement, the catalytic activity was required (Chen et al., 1994
; Ronnstrand et al., 1999
). Our experiments demonstrate that the inhibition of PLC activity leads to changes similar to those seen with depletion of PLC
1 and that only catalytically active PLC can fully rescue elongated morphology (Fig. 2 and supplementary material Fig. S2). On the basis of these observations, it is likely that integrin-regulated cell motility mediated by PLC
1 also requires its catalytic activity. Some of the previous studies have documented that an increase in cellular calcium resulting from PLC
activation coincided with the cytoskeletal rearrangements and formation of lamellipodia and filopodia; both calcium responses and formation of such protrusions were reduced in PLC
2-deficient platelets (Mangin et al., 2003
; Wonerow et al., 2003
). Although a similar conclusion can be drawn from this work (Figs 3, 6 and 7), a direct link between an increase in intracellular calcium concentrations and changes in actin cytoskeleton remain speculative. More generally, despite considerable circumstantial evidence for the involvement of PLC
in reorganization of cytoskeletal components (Kassis et al., 2001
; Wells, 2000
), there are only a few observations that suggest an underlying mechanism or a link with the known regulators of actin cytoskeleton such as small GTPases from the Rho family (Fleming et al., 1998
; Nogami et al., 2003
; Raucher et al., 2000
).
The physiological implications of our results also need to be considered. The findings that depletion of PLC
1 and inhibition of PLC activity resulted in a rounded and poorly motile phenotype of endothelial cells on basement membranes (Fig. 2) suggest a critical role of PLC
1 in morphogenesis of blood vessels. Consistent with this possibility is the analysis of PLC
1/ embryos. Although the disruption of PLC
1 in these embryos resulted in lethality soon after E9.0 without major differences from the wild type at this stage of development (Ji et al., 1997
), a more detailed analysis established that PLC
1/ embryos had significantly diminished vasculogenesis and development of endothelial cells; it has been suggested that this failure to form blood vessels could be one of the major causes of the lethality (Liao et al., 2002
). However, considering possible multiple signalling roles of PLC
1 in endothelial cells (Zachary, 2003
), these observations cannot be directly linked to the requirements for PLC
1 in integrin signalling suggested here. We have also observed striking similarities between endothelial cells and two cancer cell lines regarding their migration on the basement membranes and requirements for PLC
1 in early morphological changes (Figs 1 and 2). Although the observation that cancer cells can adopt movements resembling those of endothelial cells during morphogenesis (Fig. 1A; supplementary material Movies 2, 3 and Fig. S1) illustrates the recently emphasized plasticity of cancer cells, where environmental conditions can modulate or even switch mechanisms of migration for a given cell type (Sahai and Marshall, 2003
; Wolf et al., 2003
), its physiological significance remains unclear. Movements of cancer cells encountering basal membrane in vivo may be more similar to the type of movement observed in the chemoinvasion assay and could be dependent on and modified by different extracellular factors. Nevertheless, reconstruction of cell morphology in a model of invasion in vivo demonstrated fibroblast-like morphology of BE cells (Sahai and Marshall, 2003
), consistent with a mesenchymal mechanism of migration that is dependent on interaction with integrins (Friedl and Brocker, 2000
; Friedl and Wolf, 2003
). Since the requirement for PLC
1 has been linked to initial stages of interactions with ECM leading to more spread and elongated morphology, it is likely that, in addition to the types of migration analysed here (Fig. 2), other mechanisms of migration involving a similar type of ECM are likely to be inhibited.
| Acknowledgments |
|---|
1-GFP construct, and Klaus Seedorff for his gift of the catalytically inactive PLC
1 construct. Work is funded by Cancer Research UK. | Footnotes |
|---|
| References |
|---|
|
|
|---|
Cary, L. A., Klinghoffer, R. A., Sachsenmaier, C. and Cooper, J. A. (2002). SRC catalytic but not scaffolding function is needed for integrin-regulated tyrosine phosphorylation, cell migration, and cell spreading. Mol. Cell. Biol. 22, 2427-2440.
Chen, P., Xie, H., Sekar, M. C., Gupta, K. and Wells, A. (1994). Epidermal growth factor receptor-mediated cell motility: phospholipase C activity is required, but mitogen-activated protein kinase activity is not sufficient for induced cell movement. J. Cell Biol. 127, 847-857.
Connolly, J., Simpson, N., Hewlett, L. and Hall, A. (2002). Rac regulates endothelial morphogenesis and capillary assembly. Mol. Biol. Cell 13, 2474-2485.
Davis, G. E., Bayless, K. J. and Mavila, A. (2002). Molecular basis of endothelial cell morphogenesis in three-dimensional extracellular matrices. Anat. Rec. 268, 252-275.[CrossRef][Medline]
Fleming, I. N., Elliott, C. M. and Exton, J. H. (1998). Phospholipase C-gamma, protein kinase C and Ca2+/calmodulin-dependent protein kinase II are involved in platelet-derived growth factor-induced phosphorylation of Tiam1. FEBS Lett. 249, 229-233.
Friedl, P. and Brocker, E. B. (2000). The biology of cell locomotion within three-dimensional extracellular matrix. Cell. Mol. Life Sci. 57, 41-64.[CrossRef][Medline]
Friedl, P. and Wolf, K. (2003). Tumour-cell invasion and migration: diversity and escape mechanisms. Nat. Rev. Cancer 3, 362-374.[CrossRef][Medline]
Haendeler, J., Yin, G., Hojo, Y., Saito, Y., Melaragno, M., Yan, C., Sharma, V. K., Heller, M., Aebersold, R. and Berk, B. C. (2003). GIT1 mediates Src-dependent activation of phospholipase C
by angiotensin II and epidermal growth factor. J. Biol. Chem. 278, 49936-49944.
Inoue, O., Suzuki-Inoue, K., Dean, W. L., Frampton, J. and Watson, S. P. (2003). Integrin
2ß1 mediates outside-in regulation of platelet spreading on collagen through activation of Src kinases and PLC
2. J. Cell Biol. 160, 769-780.
Ji, Q. S., Winnier, G. E., Niswender, K. D., Horstman, D., Wisdom, R., Magnuson, M. A. and Carpenter, G. (1997). Essential role of the tyrosine kinase substrate phospholipase C-gamma1 in mammalian growth and development. Proc. Natl. Acad. Sci. USA 94, 2999-3003.
Ji, Q. S., Ermini, S., Baulida, J., Sun, F. L. and Carpenter, G. (1998). Epidermal growth factor signaling and mitogenesis in Plcg1 null mouse embryonic fibroblasts. Mol. Biol. Cell 9, 749-757.
Kao, J. P. Y., Harootunian, A. T. and Tsien, R. Y. (1989). Photochemically generated cytosolic calcium pulses and their detection by Fluo-3. J. Biol. Chem. 264, 8179-8184.
Kassis, J., Moellinger, J., Lo, H., Greenberg, N. M., Kim, H. G. and Wells, A. (1999). A role for phospholipase C-gamma-mediated signaling in tumor cell invasion. Clin. Cancer Res. 5, 2251-2260.
Kassis, J., Lauffenburger, D. A., Turner, T. and Wells, A. (2001). Tumor invasion as dysregulated cell motility. Semin. Cancer Biol. 11, 105-117.[CrossRef][Medline]
Katan, M. (1998). Families of phosphoinositide-specific phospholipase C: structure and function. Biochem. Biophys. Acta 1436, 5-17.[Medline]
Klinghoffer, R. A., Sachsenmaier, C., Cooper, J. A. and Soriano, P. (1999). Src family kinases are required for integrin but not PDGFR signal transduction. EMBO J. 18, 2459-2471.[CrossRef][Medline]
Kundra, V., Escobedo, J. A., Kazlauskas, A., Kim, H. K., Rhee, S. G., Williams, L. T. and Zetter, B. R. (1994). Regulation of chemotaxis by the platelet-derived growth factor receptor-beta. Nature 367, 474-476.[CrossRef][Medline]
Langholz, O., Roeckel, D., Petersohn, D., Broermann, E., Eckes, B. and Krieg, T. (1997). Cell-matrix interactions induce tyrosine phosphorylation of MAP kinases ERK1 and ERK2 and PLCgamma-1 in two-dimensional and three-dimensional cultures of human fibroblasts. Exp. Cell. Res. 235, 22-27.[CrossRef][Medline]
Lauffenburger, D. A. and Horwitz, A. F. (1996). Cell migration: a physically integrated molecular process. Cell 84, 359-369.[CrossRef][Medline]
Liao, F., Shin, H. S. and Rhee, S. G. (1993). In vitro tyrosine phosphorylation of PLC-gamma 1 and PLC-gamma 2 by src-family protein tyrosine kinases. Biochem. Biophys. Res. Commun. 191, 1028-1033.[CrossRef][Medline]
Liao, H. J., Kume, T., McKay, C., Xu, M. J., Ihle, J. N. and Carpenter, G. (2002). Absence of erythrogenesis and vasculogenesis in Plcg1-deficient mice. J. Biol. Chem. 277, 9335-9341.
Manabe, R. R., Kovalenko, M., Webb, D. J. and Horwitz, A. R. (2002). GIT1 functions in a motile, multi-molecular signaling complex that regulates protrusive activity and cell migration. J. Cell Sci. 115, 1497-1510.
Mangin, P., Yuan, Y., Goncalves, I., Eckly, A., Freund, M., Cazenave, J. P., Gachet, C., Jackson, S. P. and Lanza, F. (2003). Signaling role for phospholipase C gamma 2 in platelet glycoprotein Ib alpha calcium flux and cytoskeletal reorganization. Involvement of a pathway distinct from FcR gamma chain and Fc gamma RIIA. J. Biol. Chem. 278, 32880-32891.
Miranti, C. K. and Brugge, J. S. (2002). Sensing the environment: a historical perspective on integrin signal transduction. Nat. Cell. Biol. 4, E83-E90.[CrossRef][Medline]
Mullinax, T. R., Henrich, G., Kasila, P., Ahern, D. G., Wenke, E. A., Hou, C., Argentieri, D. and Bembenek, M. E. (1999). Monitoring inositol-specific phospholipase C activity using a phospholipid FlashPlate. J. Biomol. Screening 4, 151-155.
Nakamura, I., Lipfert, L., Rodan, G. A. and Duong, L. T. (2001). Convergence of alpha(v)beta(3) integrin- and macrophage colony stimulating factor-mediated signals on phospholipase Cgamma in prefusion osteoclasts. J. Cell Biol. 152, 361-373.
Nehls, V., Herrmann, R. and Huhnken, M. (1998). Guided migration as a novel mechanism of capillary network remodeling is regulated by basic fibroblast growth factor. Histochem. Cell. Biol. 109, 319-329.[CrossRef][Medline]
Nogami, M., Yamazaki, M., Watanabe, H., Okabayashi, Y., Kido, Y., Kasuga, M., Sasaki, T., Maehama, T. and Kanaho, Y. (2003). Requirement of autophosphorylated tyrosine 992 of EGF receptor and its docking protein phospholipase C gamma 1 for membrane ruffle formation. FEBS Lett. 536, 71-76.[CrossRef][Medline]
Patterson, R. L., van Rossum, D. B., Ford, D. L., Hurt, K. J., Bae, S. S., Suh, P. G., Kurosaki, T., Snyder, S. H. and Gill, D. L. (2002). Phospholipase C-gamma is required for agonist-induced Ca2+ entry. Cell 111, 529-541.[CrossRef][Medline]
Price, J. T., Tiganis, T., Agarwal, A., Djakiew, D. and Thompson, E. W. (1999). Epidermal growth factor promotes MDA-MB-231 breast cancer cell migration through a phosphatidylinositol 3'-kinase and phospholipase C-dependent mechanism. Cancer Res. 59, 5475-5478.
Putney, J. W. (2002). PLC-gamma: an old player has a new role. Nat. Cell. Biol. 4, E280-E281.[CrossRef][Medline]
Raucher, D., Stauffer, T., Chen, W., Shen, K., Guo, S., York, J. D., Sheetz, M. P. and Meyer, T. (2000). Phosphatidylinositol 4,5-bisphosphate functions as a second messenger that regulates cytoskeleton-plasma membrane adhesion. Cell 100, 221-228.[CrossRef][Medline]
Rebecchi, M. J. and Pentyala, S. N. (2000). Structure, function, and control of phosphoinositide-specific phospholipase C. Physiolosical Reviews 80, 1291-1335.
Rhee, S.-G. (2001). Regulation of phophoinositide-specific phospholipase C. Annu. Rev. Biochem. 70, 281-312.[CrossRef][Medline]
Ridley, A. J., Schwartz, M. A., Burridge, K., Firtel, R. A., Ginsberg, M. H., Borisy, G., Parsons, J. T. and Horwitz, A. R. (2003). Cell migration: integrating signals from front to back. Science 302, 1704-1709.
Rodriguez, R., Matsuda, M., Perisic, O., Bravo, J., Paul, A., Jones, N. P., Light, Y., Swann, K., Williams, R. L. and Katan, M. (2001). Tyrosine residues in phospholipase Cgamma 2 essential for the enzyme function in B-cell signaling. J. Biol. Chem. 276, 47982-47992.
Ronnstrand, L., Siegbahn, A., Rorsman, C., Johnell, M., Hansen, K. and Heldin, C. H. (1999). Overactivation of phospholipase C-gamma1 renders platelet-derived growth factor beta-receptor-expressing cells independent of the phosphatidylinositol 3-kinase pathway for chemotaxis. J. Biol. Chem. 274, 22089-22094.
Sahai, E. and Marshall, C. J. (2003). Differing modes of tumour cell invasion have distinct requirements for Rho/ROCK signalling and extracellular proteolysis. Nat. Cell. Biol. 5, 711-719.[CrossRef][Medline]
Smith, M. R., Liu, Y. L., Matthews, N. T., Rhee, S. G., Sung, W. K. and Kung, H. F. (1994). Phospholipase C-gamma 1 can induce DNA synthesis by a mechanism independent of its lipase activity. Proc. Natl. Acad. Sci. USA 91, 6554-6558.
Thomas, S. M., Coppelli, F. M., Wells, A., Gooding, W. E., Song, J., Kassis, J., Drenning, S. D. and Grandis, J. R. (2003). Epidermal growth factor receptor-stimulated activation of phospholipase Cgamma-1 promotes invasion of head and neck squamous cell carcinoma. Cancer Res. 63, 5629-5635.
Turner, T., Epps-Fung, M. V., Kassis, J. and Wells, A. (1997). Molecular inhibition of phospholipase cgamma signaling abrogates DU-145 prostate tumor cell invasion. Clin. Cancer Res. 3, 2275-2282.
Wells, A. (2000). Tumor invasion: role of growth factor-induced cell motility. Adv. Cancer Res. 78, 31-101.[Medline]
Wolf, K., Mazo, I., Leung, H., Engelke, K., von Andrian, U. H., Deryugina, E. I., Strongin, A. Y., Brocker, E. B. and Friedl, P. (2003). Compensation mechanism in tumor cell migration: mesenchymal-amoeboid transition after blocking of pericellular proteolysis. J. Cell Biol. 160, 267-277.
Wonerow, P., Pearce, A. C., Vaux, D. J. and Watson, S. P. (2003). A critical role for phospholipase C
2 in
IIbß3-mediated platelet spreading. J. Biol. Chem. 278, 37520-37529.
Ye, K., Aghdasi, B., Luo, H. R., Moriarity, J. L., Wu, F. Y., Hong, J. J., Hurt, K. J. B. S., Suh, P. G. and Snyder, S. H. (2002). Phospholipase C gamma 1 is a physiological guanine nucleotide exchange factor for the nuclear GTPase PIKE. Nature 415, 541-544.[CrossRef][Medline]
Zachary, I. (2003). VEGF signalling: integration and multi-tasking in endothelial cell biology. Biochem. Soc. Trans. 31, 1171-1177.[Medline]
Zhang, X., Chattopadhyay, A., Ji, Q. S., Owen, J. D., Ruest, P. J., Carpenter, G. and Hanks, S. K. (1999). Focal adhesion kinase promotes phospholipase C-gamma1 activity. Proc. Natl. Acad. Sci. USA 96, 9021-9026.
Zhao, Z. S., Manser, E., Loo, T. H. and Lim, L. (2000). Coupling of PAK-interacting exchange factor PIX to GIT1 promotes focal complex disassembly. Mol. Cell. Biol. 20, 6354-6363.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
K. L. Everett, T. D. Bunney, Y. Yoon, F. Rodrigues-Lima, R. Harris, P. C. Driscoll, K. Abe, H. Fuchs, M. Hrabe de Angelis, P. Yu, et al. Characterization of Phospholipase C{gamma} Enzymes with Gain-of-Function Mutations J. Biol. Chem., August 21, 2009; 284(34): 23083 - 23093. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Beloueche-Babari, J. C. Peak, L. E. Jackson, M.-Y. Tiet, M. O. Leach, and S. A. Eccles Changes in choline metabolism as potential biomarkers of phospholipase C{gamma}1 inhibition in human prostate cancer cells Mol. Cancer Ther., May 1, 2009; 8(5): 1305 - 1311. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Bhattacharya, J. Kwon, X. Li, E. Wang, S. Patra, J. P. Bida, Z. Bajzer, L. Claesson-Welsh, and D. Mukhopadhyay Distinct role of PLC{beta}3 in VEGF-mediated directional migration and vascular sprouting J. Cell Sci., April 1, 2009; 122(7): 1025 - 1034. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Meira, R. Masson, I. Stagljar, S. Lienhard, F. Maurer, A. Boulay, and N. E. Hynes Memo is a cofilin-interacting protein that influences PLC{gamma}1 and cofilin activities, and is essential for maintaining directionality during ErbB2-induced tumor-cell migration J. Cell Sci., March 15, 2009; 122(6): 787 - 797. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wang, Y. Taba, J. Pang, G. Yin, C. Yan, and B. C. Berk GIT1 Mediates VEGF-Induced Podosome Formation in Endothelial Cells: Critical Role for PLC{gamma} Arterioscler Thromb Vasc Biol, February 1, 2009; 29(2): 202 - 208. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Sala, F. Dituri, C. Raimondi, S. Previdi, T. Maffucci, M. Mazzoletti, C. Rossi, M. Iezzi, R. Lattanzio, M. Piantelli, et al. Phospholipase C{gamma}1 Is Required for Metastasis Development and Progression Cancer Res., December 15, 2008; 68(24): 10187 - 10196. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. K. Y. Wong, J. C. Y. Lai, D. Birkenhead, A. S. Shaw, and P. Johnson CD45 Down-Regulates Lck-Mediated CD44 Signaling and Modulates Actin Rearrangement in T Cells J. Immunol., November 15, 2008; 181(10): 7033 - 7043. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Epple, V. Cremasco, K. Zhang, D. Mao, G. D. Longmore, and R. Faccio Phospholipase C{gamma}2 Modulates Integrin Signaling in the Osteoclast by Affecting the Localization and Activation of Src Kinase Mol. Cell. Biol., June 1, 2008; 28(11): 3610 - 3622. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Siegbahn, M. Johnell, A. Nordin, M. Aberg, and T. Velling TF/FVIIa Transactivate PDGFR to Regulate PDGF-BB Induced Chemotaxis in Different Cell Types: Involvement of Src And PLC Arterioscler Thromb Vasc Biol, January 1, 2008; 28(1): 135 - 141. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mimeault and S. K. Batra Interplay of distinct growth factors during epithelial mesenchymal transition of cancer progenitor cells and molecular targeting as novel cancer therapies Ann. Onc., October 1, 2007; 18(10): 1605 - 1619. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Luangdilok, C. Box, L. Patterson, W. Court, K. Harrington, L. Pitkin, P. Rhys-Evans, P. O-charoenrat, and S. Eccles Syk Tyrosine Kinase Is Linked to Cell Motility and Progression in Squamous Cell Carcinomas of the Head and Neck Cancer Res., August 15, 2007; 67(16): 7907 - 7916. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. P. Jones and M. Katan Role of Phospholipase C{gamma}1 in Cell Spreading Requires Association with a {beta}-Pix/GIT1-Containing Complex, Leading to Activation of Cdc42 and Rac1 Mol. Cell. Biol., August 15, 2007; 27(16): 5790 - 5805. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Bertagnolo, M. Benedusi, F. Brugnoli, P. Lanuti, M. Marchisio, P. Querzoli, and S. Capitani Phospholipase C-{beta}2 promotes mitosis and migration of human breast cancer-derived cells Carcinogenesis, August 1, 2007; 28(8): 1638 - 1645. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. E. Wilsher, W. J. Court, R. Ruddle, Y. M. Newbatt, W. Aherne, P. W. Sheldrake, N. P. Jones, M. Katan, S. A. Eccles, and F. I. Raynaud The Phosphoinositide-Specific Phospholipase C Inhibitor U73122 (1-(6-((17{beta}-3-Methoxyestra-1,3,5(10)-trien-17-yl)amino)hexyl)-1H-pyrrole-2,5-dione) Spontaneously Forms Conjugates with Common Components of Cell Culture Medium Drug Metab. Dispos., July 1, 2007; 35(7): 1017 - 1022. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Y. Sharp, K. Boxall, M. Rowlands, C. Prodromou, S. M. Roe, A. Maloney, M. Powers, P. A. Clarke, G. Box, S. Sanderson, et al. In vitro Biological Characterization of a Novel, Synthetic Diaryl Pyrazole Resorcinol Class of Heat Shock Protein 90 Inhibitors Cancer Res., March 1, 2007; 67(5): 2206 - 2216. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Ada-Nguema, H. Xenias, M. P. Sheetz, and P. J. Keely The small GTPase R-Ras regulates organization of actin and drives membrane protrusions through the activity of PLC{epsilon} J. Cell Sci., April 1, 2006; 119(7): 1307 - 1319. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Cheeseman, T. Ueyama, T. M. Michaud, K. Kashiwagi, D. Wang, L. A. Flax, Y. Shirai, D. J. Loegering, N. Saito, and M. R. Lennartz Targeting of Protein Kinase C-{epsilon} during Fc{gamma} Receptor-dependent Phagocytosis Requires the {epsilon}C1B Domain and Phospholipase C-{gamma}1 Mol. Biol. Cell, February 1, 2006; 17(2): 799 - 813. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||