spacer gif spacer gif spacer gif spacer gif Propose a workshop for 2011 spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 9 August 2005
doi: 10.1242/jcs.02513


Journal of Cell Science 118, 3905-3915 (2005)
Published by The Company of Biologists 2005
This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jcs.02513v1
118/17/3905    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in JCS
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, H.
Right arrow Articles by Wollheim, C. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, H.
Right arrow Articles by Wollheim, C. B.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Research Article

ER stress and SREBP-1 activation are implicated in ß-cell glucolipotoxicity

Haiyan Wang*, Georgia Kouri and Claes B. Wollheim

Department of Cell Physiology and Metabolism, University Medical Center, Geneva, CH-1211, Switzerland

* Author for correspondence (e-mail: Haiyan.Wang{at}medecine.unige.ch)

Accepted 25 May 2005


    Summary
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The reduction in insulin secretory capacity and ß-cell mass observed in type 2 diabetes is thought to be caused by glucolipotoxicity secondary to hyperglycemia and hyperlipidemia. Our aim in this study was to elucidate the underlying molecular mechanisms. We found a strong correlation between chronic high-glucose treatment and SREBP-1c activation in INS-1 cells and rat islets. Both high-glucose treatment and SREBP-1c activation in INS-1 cells resulted in lipid accumulation, impaired glucose-stimulated insulin secretion, apoptosis, and strikingly similar gene expression patterns, including upregulation of lipogenic and pro-apoptotic genes and downregulation of IRS2, Bclxl and Pdx1. These lipotoxic effects of high glucose were largely prevented by induction of a dominant-negative mutant of SREBP-1c, suggesting SREBP-1c is a major factor responsible for ß cell glucolipotoxicity. Moreover, overexpression of another lipogenic transcription factor, ChREBP, in INS-1 cells did not cause lipotoxicity. Intriguingly, chronic high glucose treatment in INS-1 cells led to pronounced induction of the ER stress marker genes, BIP and Chop10. Treatment of rat islets with both chronic high glucose and two ER stress inducers, thapsigargin and tunicamycin, enhanced SREBP-1 binding to the human IRS2 promoter. These results suggest that SREBP-1 activation caused by ER stress is implicated in ß-cell glucolipotoxicity.

Key words: ER stress, SREBP-1c, Glucolipotoxicity, ß cell


    Introduction
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The reduction in insulin secretary capacity and ß-cell mass observed in type 2 diabetes is thought to be caused at least in part by hyperglycemia and hyperlipidemia (Butler et al., 2003Go; Unger, 2002Go; Unger and Zhou, 2001Go; Unger et al., 1999Go; Weir et al., 2001Go). Hyperglycemia is proposed as the prerequisite for hyperlipidemia-induced ß-cell lipotoxicity (Bonner-Weir et al., 1983Go; Harmon et al., 2001Go; Poitout and Robertson, 2002Go; Roche et al., 1998Go; Weir, 1982Go; Weir et al., 2001Go). Over accumulation of lipids in non-adipose tissues such as the pancreatic islets, liver and heart is often associated with type 2 diabetes and its complications (Unger, 2002Go; Unger and Zhou, 2001Go; Unger et al., 1999Go). However, the molecular mechanism underlying the pathogenesis of lipotoxicity in pancreatic ß cells and other non-adipose tissues remain undefined. Lipogenic gene expression in adipocytes and liver are known to be regulated by several transcription factors including sterol regulatory element binding proteins (SREBPs), carbohydrate-response element binding protein (ChREBP), CCAAT-enhancer binding proteins (C/EBP), and peroxisome proliferator-activated receptors (PPAR) (Dentin et al., 2004Go; Iizuka et al., 2004Go; Ishii et al., 2004Go; Loftus and Lane, 1997Go). SREBP are transmembrane proteins of the endoplasmic reticulum (ER). In response to low sterol and other unidentified factors, SREBP cleavage-activating protein (SCAP) escorts SREBPs from the ER to the Golgi, where SREBPs are sequentially cleaved by site-1 protease (S1P) and site-2 protease (S2P). The processed mature SREBPs enter the nucleus and transactivate target genes (Brown and Goldstein, 1997Go). Three SREBP isoforms have been identified: SREBP-1a and -1c (alternatively known as adipocyte determination and differentiation factor-1; ADD-1) (Tontonoz et al., 1993Go) that are derived from the same gene through alternative splicing, and SREBP-2 that is encoded by a distinct gene (Brown and Goldstein, 1997Go). SREBPs are expressed ubiquitously, play an essential role in regulation of lipid homeostasis in animals and have been shown to directly activate the expression of more than 30 genes dedicated to the biosynthesis of cholesterol, fatty acids, triglycerides and phospholipids (Horton et al., 2002Go).

Elevated expression of SREBP-1c has been demonstrated in islets and liver of many animal models of diabetes (Kakuma et al., 2000Go; Lin et al., 2000Go; Matsuzaka et al., 2004Go; Riddle et al., 2001Go; Shimomura et al., 1999aGo; Shimomura et al., 1999bGo; Shimomura et al., 1999cGo; Shimomura et al., 2000Go; Sun et al., 2002Go; Takaishi et al., 2004Go; Tobe et al., 2001Go; Ueki et al., 2004Go; Unger and Zhou, 2001Go; Unger et al., 1999Go; Werstuck et al., 2001Go; Xu et al., 2004Go; Yahagi et al., 2002Go; You et al., 2002Go) and patients with severe lipodystrophy (Bastard et al., 2002Go; Petersen et al., 2002Go). Lipid accumulation, impaired glucose-stimulated insulin secretion, defective ß-cell gene expression (insulin, Pdx1, glucokinase and Glut2), disorganized mitochondrial ultrastructure and `lipoapoptosis' have been reported in the ß cells of diabetic animals (Unger and Zhou, 2001Go; Unger et al., 1999Go). Moreover, preventing SREBP-1c overexpression and activation is common to leptin, metformin, adiponectin and PPAR{gamma} agonists. Thus there is a good correlation between suppression of SREBP-1c function and antidiabetic effects of these agents (Kakuma et al., 2000Go; Lin et al., 2000Go; Petersen et al., 2002Go; Shimomura et al., 1999aGo; Shimomura et al., 1999bGo; Shimomura et al., 1999cGo; Tobe et al., 2001Go; Unger and Zhou, 2001Go; Unger et al., 1999Go; Wang, M. Y. et al., 1998Go; Xu et al., 2004Go; Zhou et al., 2001Go). We and others have demonstrated that overexpression of a nuclear active form of SREBP-1c (naSREBP-1c) in insulinoma (INS-1 and MIN6) cells and isolated rat islets results in ß-cell lipotoxicity (Andreolas et al., 2002Go; Diraison et al., 2004Go; Wang et al., 2003Go; Yamashita et al., 2004Go). We have previously shown that long-term exposure of INS-1 cells to 30 mM glucose generated the mature nuclear form of SREBP-1c (Wang et al., 2003Go). Glucose also raises SREBP-1c mRNA levels in rat ß cells (Flamez et al., 2002Go). It is well known that chronic high glucose treatment causes glucolipotoxicity in both insulinoma cells and rat islets (Efanova et al., 1998Go; Roche et al., 1998Go). We hypothesise that SREBP-1c activation could play an essential role in development of ß-cell glucolipotoxicity. To further substantiate this notion we established an INS-1 stable cell line that allowed suppression of SREBP-1c function through induction of a dominant-negative mutant of SREBP-1c (DN-SREBP-1c) (Kim and Spiegelman, 1996Go). Strong experimental evidence demonstrated that dominant-negative suppression of SREBP-1c activity markedly prevented ß-cell glucolipotoxicity. In addition, we found that ER-stress-generated SREBP-1c processing and activation could be the underlying mechanism in ß-cell glucolipotoxicity.


    Materials and Methods
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture
The standard rat insulinoma INS-1E cells and two previously established INS-1-derived stable cell lines, ChREBP*16 (Wang and Wollheim, 2002Go) and naSREBP-1c*233 (Wang et al., 2003Go), allowing inducible expression, respectively, of ChREBP and a nuclear active form of SREBP-1c, were cultured in RPMI1640 containing 11.2 mM glucose (Asfari et al., 1992Go), unless otherwise indicated.

Establishment of INS-1 cells permitting inducible expression of DN-SREBP-1c
The first step stable INS-rß (also refer to as r9) cell line, which carries the reverse tetracycline/doxycycline-dependent transactivator (Gossen et al., 1995Go), was described previously (Wang and Iynedjian, 1997Go; Wang et al., 2001Go). The plasmid used in the secondary stable transfection was constructed by subcloning the cDNA encoding the dominant-negative form of SREBP-1c (DN-SREBP-1c/ADD1 1-403(Y320A) [(Kim and Spiegelman, 1996Go) kindly supplied by B.M. Spiegelman] into the expression vector PUHD10-3 [(Gossen et al., 1995Go) a generous gift from H. Bujard]. The procedures for stable transfection, clone selection and screening were described previously (Wang and Iynedjian, 1997Go).

Immunofluorescence
Cells grown on polyornithine-treated glass coverslips were treated for 24 hours with or without 500 ng/ml doxycycline. Cells were then washed, fixed in 4% paraformaldehyde, permeabilized with 0.1% Triton X-100 in phosphate-buffered saline containing 1% BSA (PBS-BSA). The preparation was then blocked with PBS-BSA before incubating with the first antibody, anti-SREBP-1 (Santa Cruz, Basel, Switzerland; 1:100 dilution), followed by the second antibody labelling.

Nuclear protein extraction and electrophoretic mobility-shift assay (EMSA)
Nuclear extracts from INS-1 cells were prepared according to the method of Schreiber et al. (Schreiber et al., 1988Go). Rat islets were isolated by collagenase digestion as described previously (Rubi et al., 2001Go) and their nuclear proteins were extracted as previously reported (Schreiber et al., 1988Go). The double-stranded oligonucleotides corresponding to the sterol regulatory element (SRE) in the human insulin receptor substrate 2 (IRS2) promoter (Ide et al., 2004Go), 5'cctgcgtaacgccgagtcacatgttgtt3', was used as a probe. EMSA procedures, including conditions for probe labelling and binding reactions were performed as in Wang et al. (Wang, H. et al., 1998Go). Mouse monoclonal antibodies against SREBP-1 (NeoMarkers, Fremont CA, USA) and SREBP-2 (purified from the supernatant of the hybridoma cell line CRL2121, American Tissue Culture Collection, Rockville, MD, USA) were used for supershift experiments.

Staining of lipid accumulation by Oil Red O
Cells were cultured in standard (11.2 mM) or 30 mM glucose medium in the presence or absence of 500 ng/ml doxycycline for 48 hours. Cells were fixed and stained as previously reported (Kim and Spiegelman, 1996Go). Lipid droplets were visualized using phase-contrast microscopy (Nikon Diaphot).

Measurements of insulin secretion and cellular insulin content
Insulin secretion in INS-1E or DN-SREBP-1c#23 cells was measured in 24-well plates over a period of 30 minutes, in Krebs-Ringer-bicarbonate-Hepes buffer (KRBH, 140 mM NaCl, 3.6 mM KCl, 0.5 mM NaH2PO4, 0.5 mM MgSO4, 1.5 mM CaCl2, 2 mM NaHCO3, 10 mM Hepes, 0.1% BSA) containing the indicated concentrations of glucose. Cellular insulin content was determined after extraction with acid ethanol following the procedures of Wang et al. (Wang, H. et al., 1998Go). Insulin was detected by radio-immunoassay using rat insulin as a standard (Wang, H. et al., 1998Go).

Total RNA isolation and northern blotting
Total RNA was extracted and blotted to nylon membranes as described previously (Wang and Iynedjian, 1997Go). The membrane was prehybridized and then hybridized to 32P-labelled random primer cDNA probes according to the method of Wang and Iynedijian (Wang and Iynedjian, 1997Go). To ensure equal RNA loading and even transfer, all membranes were stripped and re-hybridized with a `house-keeping gene' probe, cyclophilin. cDNA fragments used as probes for SREBP-1c, ChREBP, glucokinase, GLUT2, L-pyruvate kinase, insulin, BIP, CHOP10 and PDX1 mRNA detection were digested from the corresponding plasmids. cDNA probes for rat mitochondrial uncoupling protein 2 (UCP2), aldolase B, fatty acid synthase, acetyl-CoA carboxylase, glycerol-phosphate acyltransferase, HMG-CoA reductase, P21WAF1/CIP1, BAD, APO1, BclXL, IRS2 and low density lipoprotein receptor (LDLR), were prepared by RT-PCR and confirmed by sequencing.

Cell proliferation/viability and apoptosis
Quantification of cell proliferation/viability was measured using a Quick Cell Proliferation Assay Kit (LabForce/MBL, Nunningen, Switzerland) according to manufacturer's protocol. This assay is based on the cleavage of a tetrazolium salt WST-1 to formazan by mitochondrial dehydrogenases. Expansion in the number of viable cells results in an increase in the overall activity of the mitochondrial dehydrogenases and subsequently an augmentation in the amount of formazan dye formed. The formazan dye produced by viable cells was quantified with a multiwell spectrophotometer by measuring the absorbance at 440 nm. Experiments for DNA fragmentation were performed using a Quick Apoptosis DNA Ladder Detection Kit (LabForce/MBL, Nunningen, Switzerland) following the manufacturer's protocol.

Statistics
Results are expressed as mean ± s.e.m. and statistical analyses were performed using Student's t-test.


    Results
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Effects of chronic high-glucose treatment on insulin secretion and ß-cell gene expression in INS-1E cells
As shown in Fig. 1A, 30 mM glucose treatment of INS-1E cells for 48 hours resulted in reduced glucose- and leucine-stimulated insulin secretion. In contrast, KCl-depolarization-elicited insulin release was unaffected, suggesting that Ca2+-stimulated exocytosis was unaffected. We could also confirm, as previously reported (Roche et al., 1998Go), that chronic high glucose treatment led to lipid accumulation and INS-1 cell apoptosis (see below). To explore the underlying mechanism, quantitative northern blotting was performed to investigate the gene expression patterns in INS-1E cells treated for 48 hours with 30 mM glucose. The mRNA levels of essential ß-cell genes such as insulin, Pdx1, Glut2, glucokinase and IRS2 were drastically suppressed by high-glucose treatment (Fig. 1B). In addition, pro-apoptotic genes, P21, Bad and APO-1 were upregulated, whereas the anti-apoptotic gene Bclxl was downregulated (Fig. 1B). Furthermore, lipogenic genes, fatty acid synthase, acetyl-CoA carboxylase, glycerol-phosphate acyltransferase, HMG-CoA reductase and LDL receptor were all markedly induced by high glucose treatment (Fig. 1C). Similar alterations in all genes mentioned above have been reported in an INS-1 stable cell line expressing naSREBP-1c (Wang et al., 2003Go). This strikingly similar gene expression profile suggested that chronic high glucose could cause ß-cell glucolipotoxicity through activation of SREBP-1c.



View larger version (60K):
[in this window]
[in a new window]
 
Fig. 1. Effects of chronic high glucose treatment on insulin secretion and gene expression in INS-1E cell. (A) INS-1E cells in 24-well dishes were cultured in either standard (11.2 mM) or 30 mM glucose medium for 48 hours. After 5 hours equilibration in 2.5 mM glucose medium, cells were washed twice with KRBH. Insulin release from INS-1E cells stimulated with 20 mM glucose, 20 mM leucine and 20 mM KCl in KRBH buffer containing 2.5 mM (referred to Basal) was determined by radio-immunoassay and expressed as a percentage of cellular insulin content. The equilibration period is necessary to see the glucose-responsiveness of insulin release in INS-1 cells. Cellular insulin content was decreased by 32.4±6.7% after 48 hours treatment with 30 mM glucose. Data represent mean ± s.e.m. of six independent experiments. **P<0.001. (B,C) The gene expression patterns in INS-1E cells cultured in either standard (11.2 mM) or 30 mM glucose medium for 48 hours were quantified by northern blotting. Total RNA samples (20 µg/lane) were analysed by hybridizing with the indicated cDNA probes. Four independent experiments are shown side by side to demonstrate the consistency of the results.

 
However, we have also reported that the transcription, nuclear translocation and DNA-binding activity of ChREBP are regulated by glucose in INS-1 cells (Wang and Wollheim, 2002Go). As demonstrated in Fig. 1C, mRNA levels of ChREBP, L-PK and aldolase B were markedly increased by high glucose. ChREBP is known to regulate lipogenic gene expression in the liver (Dentin et al., 2004; Iizuka et al., 2004; Ishii et al., 2004Go), we therefore examined whether it is also involved in ß-cell glucolipotoxicity.

SREBP-1c rather than ChREBP is implicated in glucolipotoxicity in INS-1 cells
Differential gene expression patterns in INS-1 cells induced by ChREBP and naSREBP-1c are illustrated in Fig. 2A,B. Quantitative northern blotting was performed in two stable INS-1 cell lines previously established to express, respectively, ChREBP (Wang and Wollheim, 2002Go) and naSREBP-1c (Wang et al., 2003Go) in a doxycycline-dependent manner. The results displayed in Fig. 2A indicate that ChREBP predominantly targeted L-PK and aldolase B, although induction of ChREBP also slightly enhanced the expression of fatty acid synthase and acetyl-CoA carboxylase. In contrast, induction of SREBP-1c drastically increased the lipogenic gene expression for proteins such as, fatty acid synthase, acetyl-CoA carboxylase, HMG-CoA reductase and LDL receptor, whereas it did not affect the mRNA levels of L-PK and aldolase B (Fig. 2B). It is noteworthy that the function of SREBP-1c may also overlap with the function of SREBP-2 on target gene expression in INS-1 cells since HMG-CoA reductase is regulated by naSREBP-1c. In addition, the expression of IRS2 was suppressed by naSREBP-1c but unaffected by ChREBP. It has been reported recently that SREBP-1c binds to the human IRS2 promoter and suppresses its activity in rat and mouse hepatocytes (Ide et al., 2004Go).



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 2. Comparison of gene expression patterns in INS-1 cells allowing inducible expression, respectively, of ChREBP and the nuclear active form (na) of SREBP-1c. (A) ChREBP*16 cells were cultured in standard medium (11.2 mM glucose) with 0, 75, 150 or 500 ng/ml doxycycline for 24 hours. The culture was continued in 2.5 mmol/l glucose medium with the indicated concentrations of doxycycline for 16 hours, followed by an additional 8 hours in culture medium with 2.5, 6, 12 and 24 mM glucose and with or without doxycycline. The equilibration period is necessary to see the glucose-responsiveness of gene expression. (B) SREBP-1c*233 cells were cultured in 2.5 mM glucose medium with the indicated concentrations of doxycycline for 16 hours, followed by an additional 8 hours in culture medium with 2.5, 6, 12 and 24 mM glucose and with or without doxycycline. SREBP-1c was induced for a total of 24 hours to avoid its apoptotic effects. Gene expression patterns in these cells were evaluated by quantitative northern blotting. 20 µg total RNA samples were analysed by hybridising with indicated cDNA probes. WT, the endogenous wild-type SREBP-1c; NA, the induced nuclear active form of SRENP-1c. The experiments were repeated two times with similar results.

 

Induction of ChREBP in INS-1 cells did not affect glucose-stimulated insulin secretion or cell growth. In contrast to the effect of naSREBP-1c, induction of ChREBP with 500 ng/ml doxycycline for 48 hours did not alter glucose-stimulated insulin secretion or cellular insulin content. To assess the impact of ChREBP on INS-1 cell growth and viability, we performed the WST-1 assay (Fig. 3B). This assay is based on the cleavage of a tetrazolium salt WST-1 to formazan by mitochondrial dehydrogenases. Expansion in the number of viable cells results in an increase in the overall activity of the mitochondrial dehydrogenases and subsequently an augmentation in the amount of formazan dye formed. Unlike overexpression of naSREBP-1c (Wang et al., 2003Go), maximum induction of ChREBP for 48 hours did not cause INS-1 cell growth arrest (Fig. 3B) or apoptosis as assessed by DNA fragmentation experiments (data not shown). We have previously shown that similar induction of SREBP-1c caused apoptosis in INS-1 cells (Wang et al., 2003Go).



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 3. Overexpression of ChREBP did not affect glucose-stimulated insulin secretion or cell growth. (A) ChREBP*16 cells were cultured with (+Dox) or without (-Dox) 500 ng/ml doxycycline in standard medium (11.2 mM glucose) for 24 hours and then equilibrated in 2.5 mM glucose medium for a further 24 hours. Insulin release from ChREBP*16 cells in KRBH buffer containing the indicated concentrations of glucose was determined by radio-immunoassay and expressed as a percentage of cellular insulin content. Data represent six independent experiments. (B) A WST-1 assay, presented as optical density at 440 nm, showed that ChREBP*16 cell growth/survival was not affected by 48 hours treatment with 500 ng/ml doxycycline.

 
Establishment of INS-1 stable cell line permitting inducible expression of DN-SREBP-1c
To further substantiate the implication of SREBP-1c in chronic high-glucose-induced glucolipotoxicity, we generated an INS-1 stable cell line expressing DN-SREBP-1c, called DN-SREBP-1c*23 cells. This mutant protein contains an intact dimerization domain but lacks DNA-binding activity (Kim and Spiegelman, 1996Go). DN-SREBP-1c therefore exerts its dominant-negative function by forming non-functional heterodimers with endogenous SREBPs (Kim and Spiegelman, 1996Go). Immunofluorescence staining with an antibody against the N terminus of SREBP-1c demonstrated that DN-SREBP-1c protein was induced by doxycycline in an all-or-none manner (Fig. 4A).



View larger version (63K):
[in this window]
[in a new window]
 
Fig. 4. Characteristics of the INS-1 stable cell line expressing DN-SREBP-1c. (A) Phase-contrast images (top) and immunofluorescence staining (bottom) with a rabbit polyclonal antibody against SREBP-1 showed that DN-SREBP-1c protein was induced by doxycycline in an all-or-none manner. DN-SREBP-1c*23 cells were cultured with (+Dox) or without (-Dox) 500 ng/ml doxycycline for 48 hours. (B) Gel-shift assay of nuclear extracts from DN-SREBP-1c*23 cells using the SRE sequence of the IRS2 promoter. DN-SREBP-1c*23 cells were cultured in either standard (11.2 mM) or 30 mM glucose medium for 48 hours, in the presence (+Dox) or absence (-Dox) of 500 ng/ml doxycycline. Monoclonal SREBP-1-specific antibody was used for the supershift experiment. Experiments were repeated two to three times with similar results. (C) EMSA of nuclear extracts from non-induced DN-SREBP-1c*23 cells using the SRE sequence of the IRS2 promoter. DN-SREBP-1c*23 cells were cultured in either standard (11.2 mM) or 30 mM glucose medium for 48 hours. Monoclonal SREBP-2-specific antibody was used for the supershift experiment. Experiments were repeated twice with similar results.

 
Effects of DN-SREBP-1c on chronic high-glucose-induced glucolipotoxicity in INS-1 cells
Induction of DN-SREBP-1c abolished chronic high-glucose-induced SREBP-1 binding to the IRS2 promoter. DN-SREBP-1c*23 cells were cultured in either standard (11.2 mM) or 30 mM glucose medium for 48 hours, in the presence (+Dox) or absence (-Dox) of 500 ng/ml doxycycline. EMSA with the SRE element of the human IRS2 promoter (Ide et al., 2004Go) showed that SREBP protein binding was increased 10-fold by 48 hours treatment with 30 mM glucose, which was diminished by 80% after induction of DN-SREBP-1c (Fig. 4B). The specificity of SREBP-1 binding complexes was confirmed by the observed supershift with a monoclonal anti-SREBP-1 antibody (Fig. 4B). However, we could not exclude binding activity of SREBP-2 to the IRS2-SRE-element, since it would also be inhibited by DN-SREBP-1c (Rishi et al., 2004Go). Indeed, monoclonal anti-SREBP-2 antibody also caused a supershift of the retarded complex but to a much lesser extent than the SREBP-1-specific antibody (Fig. 4C). These results suggest that SREBP-1 accounts for the majority of the glucose-induced binding activity to the IRS2 promoter.

Induction of DN-SREBP-1c diminished chronic high-glucose-induced lipid accumulation, apoptosis and impaired insulin secretion in INS-1 cells. As shown by Oil-Red-O staining (Fig. 5A), 30 mM glucose treatment of DN-SREBP-1c*23 cells for 48 hours resulted in massive lipid accumulation, which was largely prevented by induction of DN-SREBP-1c. Similarly, treatment of DN-SREBP-1c*23 cells for 48 and 72 hours with 30 mM glucose caused typical DNA fragmentation (Fig. 5B), a characteristic hallmark of cells undergoing apoptosis. DN-SREBP-1c largely protected INS-1 cells from apoptosis (Fig. 5B).



View larger version (48K):
[in this window]
[in a new window]
 
Fig. 5. Induction of DN-SREBP-1c largely prevented chronic high-glucose-induced glucolipotoxicity in INS-1 cells. (A) DN-SREBP-1c diminished lipid droplets accumulation, as seen by staining with Oil Red-O. DN-SREBP-1c*23 cells were cultured in either standard (11.2 mM; Control) or 30 mM glucose (High glucose) medium for 48 hours, in the presence (+Dox) or absence (-Dox) of 500 ng/ml doxycycline. (B) DN-SREBP-1c prevented apoptosis. DNA fragmentation was assessed in DN-SREBP-1c*23 cells cultured in 30 mM glucose medium for 0, 24, 48, and 72 hours, in the presence (+Dox) or absence (-Dox) of 500 ng/ml doxycycline. (C) DN-SREBP-1c partially restored glucose-stimulated insulin secretion. DN-SREBP-1c*23 cells in 24-well dishes were cultured in either standard (11.2 mM; Control) or 30 mM glucose (High Glucose) medium for 48 hours. After 5 hours equilibration in 2.5 mM glucose medium, cells were washed twice with KRBH. Insulin release from DN-SREBP-1c*23 cells stimulated with either 2.5 (Basal) or 20 mM glucose was determined by radio-immunoassay and expressed as a percentage of cellular insulin content. Data represent mean ± s.e.m. of six independent experiments. *P<0.01; **P<0.001.

 
In agreement with the results obtained in INS-1E (Fig. 1A), treatment of DN-SREBP-1c*23 cells with 30 mM glucose for 48 hours also led to reduced glucose-stimulated insulin secretion (Fig. 5C). The glucose-stimulated insulin secretion was partially restored by expression of DN-SREBP-1c (Fig. 5C). Unexpectedly, induction of DN-SREBP-1c slightly increased basal (2.5 mM) insulin release in control cells (Fig. 5C).

DN-SREBP-1c corrected defective gene expression in INS-1 cells treated with chronic high glucose
As demonstrated in Fig. 6, treatment of DN-SREBP-1c*23 cells with 30 mM glucose for 48 hours increased the mRNA levels of L-PK, aldolase B and ChREBP, which were not affected by induction of DN-SREBP-1c. These results suggest that high glucose may promote the expression of L-PK and aldolase B through a SREBP-1c-independent but ChREBP-dependent pathway. In contrast, the protective effects of DNSREBP-1c in high-glucose-treated DN-SREBP-1c*23 cells revealed the SREBP-1c-dependent gene expression patterns, including upregulation of fatty acid synthase, HMG-CoA reductase, LDLR and P21, as well as downregulation of GLUT2, glucokinase, PDX1, IRS2 and BCLXL (Fig. 6). These data further substantiate the notion that SREBP-1c-target genes are implicated in chronic high-glucose-mediated ß-cell glucolipotoxicity. Ucp2 is also a downstream target gene of SREBP-1c in INS-1 cells (Wang et al., 2003Go; Yamashita et al., 2004Go). Interestingly, induction of DN-SREBP-1c suppressed UCP2, which may account for the increased basal insulin secretion observed (Fig. 5C).



View larger version (66K):
[in this window]
[in a new window]
 
Fig. 6. Effects of DN-SREBP-1c on gene expression patterns induced by chronic high-glucose in INS-1 cells. DN-SREBP-1c*23 cells were cultured in either standard (11.2 mM; -) or 30 mM (+) glucose medium for 48 hours, in the presence (+Dox) or absence (-Dox) of 500 ng/ml doxycycline. The gene expression pattern in these cells was quantitatively evaluated by northern blotting. 20 µg total RNA samples were analysed by hybridising with the indicated cDNA probes. The experiments were repeated twice with similar results.

 
ER-stress and SREBP-1 activation could be the molecular mechanisms underlying ß-cell glucolipotoxicity
Increased expression of GADD153/CHOP10 and BIP are characteristics of ER stress response in many cell types. We found that treatment of INS-1E cells for 48 hours with 30 mM glucose markedly induced these ER stress marker genes (Fig. 7A). Therefore, chronic high-glucose-induced ER stress could be the underlying mechanism involved in SREBP-1 activation and subsequently INS-1 cell glucolipotoxicity, since it has been well documented that ER stress causes SREBP processing through S1P and S2P (Werstuck et al., 2001Go; Ye et al., 2000Go).



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 7. ER stress and SREBP-1 activation are implicated in ß-cell glucolipotoxicity. (A) The gene expression patterns in INS-1E cells cultured in either standard (11.2 mM; -) or 30 mM (+) glucose medium for 48 hours were quantified by northern blotting. Total RNA samples (20 µg/lane) were analysed by hybridizing with the indicated cDNA probes. Four independent experiments are shown side by side to demonstrate the consistency of the results. (B) Gel-shift assay of nuclear extracts from isolated rat islets using the SRE sequence of the IRS2 promoter. SREBP-1 protein binding activity was assessed in rat islets treated with 30 mM glucose for 0 (freshly isolated), 1, 2, 3, 4, and 5 days or alternatively with two ER stress inducers, thapsigargin (1 µM) and tunicamycin (10 µg/ml) for 1 day. The mouse monoconal antibody against SREBP-1 was used for supershift experiments.

 
A similar mechanism may also apply to islet ß cells. The EMSA shown in Fig. 7B indicates that treatment of isolated rat islets with either chronic high glucose or two ER stress inducers, thapsigargin and tunicamycin, drastically enhanced SREBP-1 binding to the SRE sequence of the IRS2 promoter. The specificity of retarded SREBP-1 complexes was confirmed by the supershift in the presence of the monoclonal antibody against SREBP-1 (Fig. 7B).


    Discussion
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
It is well known that chronic high-glucose treatment in vitro causes ß-cell glucolipotoxicity, including lipid accumulation, impaired glucose-stimulated insulin secretion and apoptosis (Efanova et al., 1998Go; Roche et al., 1998Go). These characteristics resemble the description of ß-cell lipotoxicity in ob/ob mice and Zucker Diabetic Fatty (ZDF) rats (Unger, 2002Go; Unger and Zhou, 2001Go). Overexpression or overactivation of SREBP-1c in the islets of these animals has been proposed as the causal factor (Unger, 2002Go; Unger and Zhou, 2001Go). Consistently, overexpression of a nuclear active form of SREBP-1c in insulinoma cells (INS-1 and MIN6) and isolated rat islets results in typical characteristics of ß-cell glucolipotoxicity (Andreolas et al., 2002Go; Diraison et al., 2004Go; Wang et al., 2003Go; Yamashita et al., 2004Go). Some investigators refer to lipotoxicity as the consequence of increased circulating free fatty acids and cellular lipid accumulation (Unger, 2002Go; Unger and Zhou, 2001Go; Unger et al., 1999Go), whereas others suggest that glucotoxicity is the prerequisite for lipotoxicity, at least in ß cells (Bonner-Weir et al., 1983Go; Harmon et al., 2001Go; Poitout and Robertson, 2002Go; Roche et al., 1998Go; Weir, 1982Go; Weir et al., 2001Go). Therefore, glucolipotoxicity is a more proper term to describe ß cell dysfunction in type 2 diabetes.

To elucidate the molecular mechanisms underlying ß-cell glucolipotoxicity, we first investigated the quantitative gene expression patterns in INS-1 cells treated chronically with high-glucose. The drastically reduced expression of essential ß-cell genes such as IRS2, insulin, Pdx1, Glut2, glucokinase and Bclxl, and markedly increased mRNA levels of lipogenic and proapoptotic genes should contribute to the glucolipotoxicity. Interestingly, this gene expression profile is strikingly similar to what we have reported in the INS-1 cell line expressing naSREBP-1c (Wang et al., 2003Go). In contrast, the characteristics of these gene expression patterns as well as typical glucolipotoxicity were not observed in the INS-1 cell line overexpressing another lipogenic transcription factor ChREBP. Similar negative results were obtained in INS-1 cells expressing, PPAR{gamma} or C/EBPß (H.W. and C.B.W., unpublished data), suggesting that SREBP-1c is the predominant transcription factor responsible for ß-cell glucolipotoxicity.

To further substantiate this hypothesis, we established an INS-1 stable cell line with inducible expression of DN-SREBP-1c. Induction of DN-SREBP-1c diminished the chronic high-glucose-induced SREBP-1 binding to the SRE fragment of the IRS2 promoter. Consequently, the inhibitory effects of chronic high glucose on IRS2 expression were largely attenuated by DN-SREBP-1c. It has been reported that SREBP-1c binds to the IRS2 promoter and suppresses IRS2 expression in rodent hepatocytes (Ide et al., 2004Go). Our results suggest a similar mechanism in pancreatic ß cells. Deletion of IRS2 in mouse hypothalamus and ß cells has recently been shown to cause a type 2 diabetes-like syndrome (Kubota et al., 2004Go; Lin et al., 2004Go). IRS2 is also known to promote ß cell growth/survival (Withers et al., 1998Go). We therefore propose that suppression of IRS2 expression by SREBP-1c should contribute, at least in part, to ß-cell glucolipotoxicity.

We also demonstrated that dominant-negative suppression of SREBP-1c activation largely prevented glucolipotoxicity in INS-1 cells, including lipid accumulation, impaired glucose-stimulated insulin secretion and apoptosis. The protective effects of DN-SREBP-1c could be explained by nomalized expression of fatty acid synthase, HMG-CoA reductase, LDLR, P21, GLUT2, glucokinase, PDX1, IRS2 and BCLXL. In addition, DN-SREBP-1c also suppressed the expression of UCP2. In contrast, DN-SREBP-1c did not affect the expression of L-PK and aldolase B, which were targeted by ChREBP. Glucokinase is the rate-limiting enzyme for glycolysis and serves as the ß-cell glucose sensor (Wang and Iynedjian, 1997Go). PDX1 is required for maintaining ß-cell-specific gene expression and the ß-cell phenotype (Ahlgren et al., 1998Go; Wang et al., 2001Go). Mouse islets deficient in LDLR have been shown to be resistant to LDL-induced apoptosis (Roehrich et al., 2003Go). Deletion of Ucp2 restores ß-cell function in ob/ob mice and in animals fed a high-fat diet (Chan et al., 2004Go; Joseph et al., 2002Go; Zhang et al., 2001Go). In addition, mouse islets deficient in UCP2 are protected from fatty acid-induced lipotoxicity (Joseph et al., 2004Go), whereas its overexpression leads to impaired glucose-stimulated insulin secretion (Lameloise et al., 2001Go; Yamashita et al., 2004Go). Therefore, chronic high glucose may act through SREBP-1 to target multiple genes, causing ß-cell glucolipotoxicity.

Most intriguingly, we found that chronic high glucose treatment caused ER stress response in INS-1 cells, evidenced by elevated expression of two characteristic genes, CHOP and BIP. It has been reported that glucose stimulates protein synthesis in pancreatic ß cells through dephosphorylation of the eukaryotic elongation factor (eEF2) (Yan et al., 2003Go) and initiation factor (eIF2{alpha}) (Gomez et al., 2004Go) and activation of the guanine nucleotide exchange factor eIF2B (Gilligan et al., 1996Go). We, therefore, postulate that chronic high glucose could induce ER stress through overloading protein synthesis. Our data suggest that chronic high-glucose-induced ER stress could be the underlying mechanism in SREBP-1 processing/activation. Indeed, we found that treatment of isolated rat islets with chronic high glucose and two ER stress inducers, thapsigargin and tunicamycin, markedly increased the SREBP-1 binding activity to the IRS2 promoter. It has been well established that ER stress causes SREBP processing through S1P and S2P (Werstuck et al., 2001Go; Ye et al., 2000Go). SREBP-1c activation induced by ER stress has also been implicated in hyperhomocysteinemia-induced liver steatosis (Werstuck et al., 2001Go). Increased ER stress has been incriminated in ob/ob mice and in mice fed on a high-fat diet and proposed as the cause of insulin resistance (Ozcan et al., 2004Go). Likewise, response to ER stress has been reported in rat ß cells treated with fatty acids (Kharroubi et al., 2004Go). Therefore, prolonged ER stress and SREBP-1c activation could be a common mechanism underlying both ß-cell dysfunction and insulin resistance in type 2 diabetes.

It is noteworthy that the genetic studies have associated SREBP-1c polymorphisms with obesity, insulin resistance and type 2 diabetes (Eberle et al., 2004Go; Laudes et al., 2004Go). SREBP-1c is the upstream suppressor of IRS2 (Ide et al., 2004Go), and the transactivator of Ucp2, Ldlr, stearoyl-CoA desaturase 1 and many lipogenic genes (Bene et al., 2001Go; Horton et al., 2003Go; Medvedev et al., 2002Go; Wang et al., 2003Go; Yahagi et al., 1999Go). In addition to the aforementioned genes (IRS2, Ucp2 and Ldlr), stearoyl-CoA desaturase 1 (SCD1) deficiency has been shown to increase insulin sensitivity, fatty acid oxidation and energy expenditure, as well as promoting resistance to diet-induced obesity (Dobrzyn et al., 2004Go). We, therefore, propose that SREBP-1c is one of the causative genes for development of both ß-cell dysfunction and insulin resistance in type 2 diabetes. In fact, SREBP-1c over-activation has been associated with liver steatosis, lipodystrophy, diabetic renal disease and/or ß-cell lipotoxicity in many animal models of type 2 diabetes, such as ob/ob, db/db, IRS2-/- and ap2-nSREBP-1c mice, streptozotocin-induced diabetic rats, Zucker diabetic fatty rats, and mice with liver overexpression of Socs-1/-3 (Kakuma et al., 2000Go; Lin et al., 2000Go; Matsuzaka et al., 2004Go; Riddle et al., 2001Go; Shimomura et al., 1999aGo; Shimomura et al., 1999bGo; Shimomura et al., 1999cGo; Shimomura et al., 2000Go; Sun et al., 2002Go; Takaishi et al., 2004Go; Tobe et al., 2001Go; Ueki et al., 2004Go; Unger and Zhou, 2001Go; Unger et al., 1999Go; Werstuck et al., 2001Go; Xu et al., 2004Go; Yahagi et al., 2002Go; You et al., 2002Go), as well as in patients with severe lipodystrophy (Bastard et al., 2002Go; Petersen et al., 2002Go). Treatment with some antidiabetic drugs or hormones including metformin, troglitazone, leptin and adiponectin could prevent the diabetes-associated lipotoxicity in these animals and patients through inhibition of SREBP-1c activation (Lin et al., 2000Go; Petersen et al., 2002Go; Shimomura et al., 1999cGo; Xu et al., 2004Go). Genetic manipulations to suppress SREBP-1c function are shown to be equally effective (Engelking et al., 2004Go; Takaishi et al., 2004Go; Ueki et al., 2004Go).

In summary, we found that chronic high glucose treatment alone could cause typical glucolipotoxicity and a gene expression profile resembling that caused by naSREBP-1c expression in INS-1 cells (Wang et al., 2003Go). This gene expression profile (Wang et al., 2003Go) has also been most recently confirmed in mice with ß-cell-specific overexpression of SREBP-1c (Takahashi et al., 2005Go), suggesting that the results in our INS-1 cell model correlate well with native ß cells in vivo. However, it remains to be determined whether naSREBP-1c-induced apoptosis and impaired glucose-stimulated insulin secretion occurs via lipid accumulation or through an independent mechanism. Most importantly, we found that dominant-negative suppression of SREBP-1c function could prevent glucolipotoxicity in INS-1 cells. We have further implicated ERnstress in the activation of SREBP-1c, leading to ß-cell glucolipotoxicity. Therefore, the present study should help to clarify the molecular mechanisms underlying development of ß-cell glucolipotoxicity, a process thought to cause the loss of both ß-cell mass and insulin secretory response to glucose in type 2 diabetes. Prevention of excessive ER stress and SREBP-1c action should be considered for therapy aimed at protection of ß-cell function in type 2 diabetes.


    Acknowledgments
 
We are grateful to D. Cornut-Harry, D. Nappey, Y. Dupré and V. Calvo for expert technical assistance. We are indebted to B. M. Spiegelman (for the naSREBP-1c and DN-SREBP-1c cDNAs), D. Ron (for the CHOP cDNA), R. Prywes (for the BIP cDNA), H. Bujard (for the PUHD 10-3 vector), and N. Quintrell (for the pTKhygro plasmid). This work was supported by the Swiss National Science Foundation (grant no. 32-66907.01 to C.B.W.) and Olga Mayenfisch Stiftung.

The authors declare no conflict of interest.


    References
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

Ahlgren, U., Johnson, J., Johnson, L., Simu, K. and Edlund, H. (1998). Beta-cell-specific inactivation of the mouse Ipf1/Pdx1 gene results in loss of the beta-cell phenotype and maturity onset diabetes. Genes Dev. 12, 1763-1768.[Abstract/Free Full Text]

Andreolas, C., da Silva Xavier, G., Diraison, F., Zhao, C., Varadi, A., Lopez-Casillas, F., Ferre, P., Foufelle, F. and Rutter, G. A. (2002). Stimulation of acetyl-CoA carboxylase gene expression by glucose requires insulin release and sterol regulatory element binding protein 1c in pancreatic MIN6 beta-cells. Diabetes 51, 2536-2545.[Abstract/Free Full Text]

Asfari, M., Janjic, D., Meda, P., Li, G., Halban, P. A. and Wollheim, C. B. (1992). Establishment of 2-mercaptoethanol-dependent differentiated insulin-secreting cell lines. Endocrinology 130, 167-178.[Abstract/Free Full Text]

Bastard, J. P., Caron, M., Vidal, H., Jan, V., Auclair, M., Vigouroux, C., Luboinski, J., Laville, M., Maachi, M., Girard, P. M. et al. (2002). Association between altered expression of adipogenic factor SREBP1 in lipoatrophic adipose tissue from HIV-1-infected patients and abnormal adipocyte differentiation and insulin resistance. Lancet 359, 1026-1031.[CrossRef][Medline]

Bene, H., Lasky, D. and Ntambi, J. M. (2001). Cloning and characterization of the human stearoyl-CoA desaturase gene promoter: transcriptional activation by sterol regulatory element binding protein and repression by polyunsaturated fatty acids and cholesterol. Biochem. Biophys. Res. Commun. 284, 1194-1198.[CrossRef][Medline]

Bonner-Weir, S., Trent, D. F. and Weir, G. C. (1983). Partial pancreatectomy in the rat and subsequent defect in glucose-induced insulin release. J. Clin. Invest. 71, 1544-1553.[Medline]

Brown, M. S. and Goldstein, J. L. (1997). The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell 89, 331-340.[CrossRef][Medline]

Butler, A. E., Janson, J., Bonner-Weir, S., Ritzel, R., Rizza, R. A. and Butler, P. C. (2003). Beta-cell deficit and increased beta-cell apoptosis in humans with type 2 diabetes. Diabetes 52, 102-110.[Abstract/Free Full Text]

Chan, C. B., Saleh, M. C., Koshkin, V. and Wheeler, M. B. (2004). Uncoupling protein 2 and islet function. Diabetes 53, S136-S142.[Abstract/Free Full Text]

Dentin, R., Pegorier, J. P., Benhamed, F., Foufelle, F., Ferre, P., Fauveau, V., Magnuson, M. A., Girard, J. and Postic, C. (2004). Hepatic glucokinase is required for the synergistic action of ChREBP and SREBP-1c on glycolytic and lipogenic gene expression. J. Biol. Chem. 279, 20314-20326.[Abstract/Free Full Text]

Diraison, F., Parton, L., Ferre, P., Foufelle, F., Briscoe, C. P., Leclerc, I. and Rutter, G. A. (2004). Over-expression of sterol-regulatory-element-binding protein-1c (SREBP1c) in rat pancreatic islets induces lipogenesis and decreases glucose-stimulated insulin release: modulation by 5-aminoimidazole-4-carboxamide ribonucleoside (AICAR). Biochem. J. 378, 769-778.[CrossRef][Medline]

Dobrzyn, P., Dobrzyn, A., Miyazaki, M., Cohen, P., Asilmaz, E., Hardie, D. G., Friedman, J. M. and Ntambi, J. M. (2004). Stearoyl-CoA desaturase 1 deficiency increases fatty acid oxidation by activating AMP-activated protein kinase in liver. Proc. Natl. Acad. Sci. USA 101, 6409-6414.[Abstract/Free Full Text]

Eberle, D., Clement, K., Meyre, D., Sahbatou, M., Vaxillaire, M., Le Gall, A., Ferre, P., Basdevant, A., Froguel, P. and Foufelle, F. (2004). SREBF-1 gene polymorphisms are associated with obesity and type 2 diabetes in French obese and diabetic cohorts. Diabetes 53, 2153-2157.[Abstract/Free Full Text]

Efanova, I. B., Zaitsev, S. V., Zhivotovsky, B., Kohler, M., Efendic, S., Orrenius, S. and Berggren, P. O. (1998). Glucose and tolbutamide induce apoptosis in pancreatic beta-cells. A process dependent on intracellular Ca2+ concentration. J. Biol. Chem. 273, 33501-33507.[Abstract/Free Full Text]

Engelking, L. J., Kuriyama, H., Hammer, R. E., Horton, J. D., Brown, M. S., Goldstein, J. L. and Liang, G. (2004). Overexpression of Insig-1 in the livers of transgenic mice inhibits SREBP processing and reduces insulin-stimulated lipogenesis. J. Clin. Invest. 113, 1168-1175.[CrossRef][Medline]

Flamez, D., Berger, V., Kruhoffer, M., Orntoft, T., Pipeleers, D. and Schuit, F. C. (2002). Critical role for cataplerosis via citrate in glucose-regulated insulin release. Diabetes 51, 2018-2024.[Abstract/Free Full Text]

Gilligan, M., Welsh, G. I., Flynn, A., Bujalska, I., Diggle, T. A., Denton, R. M., Proud, C. G. and Docherty, K. (1996). Glucose stimulates the activity of the guanine nucleotide-exchange factor eIF-2B in isolated rat islets of Langerhans. J. Biol. Chem. 271, 2121-2125.[Abstract/Free Full Text]

Gomez, E., Powell, M. L., Greenman, I. C. and Herbert, T. P. (2004). Glucose-stimulated protein synthesis in pancreatic beta-cells parallels an increase in the availability of the translational ternary complex (eIF2-GTP.Met-tRNAi) and the dephosphorylation of eIF2 alpha. J. Biol. Chem. 279, 53937-53946.[Abstract/Free Full Text]

Gossen, M., Freundlieb, S., Bender, G., Muller, G., Hillen, W. and Bujard, H. (1995). Transcriptional activation by tetracyclines in mammalian cells. Science 268, 1766-1769.[Abstract/Free Full Text]

Harmon, J. S., Gleason, C. E., Tanaka, Y., Poitout, V. and Robertson, R. P. (2001). Antecedent hyperglycemia, not hyperlipidemia, is associated with increased islet triacylglycerol content and decreased insulin gene mRNA level in Zucker diabetic fatty rats. Diabetes 50, 2481-2486.[Abstract/Free Full Text]

Horton, J. D., Goldstein, J. L. and Brown, M. S. (2002). SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J. Clin. Invest. 109, 1125-1131.[CrossRef][Medline]

Horton, J. D., Shah, N. A., Warrington, J. A., Anderson, N. N., Park, S. W., Brown, M. S. and Goldstein, J. L. (2003). Combined analysis of oligonucleotide microarray data from transgenic and knockout mice identifies direct SREBP target genes. Proc. Natl. Acad. Sci. USA 100, 12027-12032.[Abstract/Free Full Text]

Ide, T., Shimano, H., Yahagi, N., Matsuzaka, T., Nakakuki, M., Yamamoto, T., Nakagawa, Y., Takahashi, A., Suzuki, H., Sone, H. et al. (2004). SREBPs suppress IRS-2-mediated insulin signalling in the liver. Nat. Cell Biol. 6, 351-357.[CrossRef][Medline]

Iizuka, K., Bruick, R. K., Liang, G., Horton, J. D. and Uyeda, K. (2004). Deficiency of carbohydrate response element-binding protein (ChREBP) reduces lipogenesis as well as glycolysis. Proc. Natl. Acad. Sci. USA 101, 7281-7286.[Abstract/Free Full Text]

Ishii, S., Iizuka, K., Miller, B. C. and Uyeda, K. (2004). Carbohydrate response element binding protein directly promotes lipogenic enzyme gene transcription. Proc. Natl. Acad. Sci. USA 101, 15597-15602.[Abstract/Free Full Text]

Joseph, J. W., Koshkin, V., Zhang, C. Y., Wang, J., Lowell, B. B., Chan, C. B. and Wheeler, M. B. (2002). Uncoupling protein 2 knockout mice have enhanced insulin secretory capacity after a high-fat diet. Diabetes 51, 3211-3219.[Abstract/Free Full Text]

Joseph, J. W., Koshkin, V., Saleh, M. C., Sivitz, W. I., Zhang, C. Y., Lowell, B. B., Chan, C. B. and Wheeler, M. B. (2004). Free fatty acid-induced beta-cell defects are dependent on uncoupling protein 2 expression. J. Biol. Chem. 279, 51049-51056.[Abstract/Free Full Text]

Kakuma, T., Lee, Y., Higa, M., Wang, Z., Pan, W., Shimomura, I. and Unger, R. H. (2000). Leptin, troglitazone, and the expression of sterol regulatory element binding proteins in liver and pancreatic islets. Proc. Natl. Acad. Sci. USA 97, 8536-8541.[Abstract/Free Full Text]

Kharroubi, I., Ladriere, L., Cardozo, A. K., Dogusan, Z., Cnop, M. and Eizirik, D. L. (2004). Free fatty acids and cytokines induce pancreatic beta-cell apoptosis by different mechanisms: role of nuclear factor-kappaB and endoplasmic reticulum stress. Endocrinology 145, 5087-5096.[Abstract/Free Full Text]

Kim, J. B. and Spiegelman, B. M. (1996). ADD1/SREBP1 promotes adipocyte differentiation and gene expression linked to fatty acid metabolism. Genes Dev. 10, 1096-1107.[Abstract/Free Full Text]

Kubota, N., Terauchi, Y., Tobe, K., Yano, W., Suzuki, R., Ueki, K., Takamoto, I., Satoh, H., Maki, T., Kubota, T. et al. (2004). Insulin receptor substrate 2 plays a crucial role in beta cells and the hypothalamus. J. Clin. Invest. 114, 917-927.[CrossRef][Medline]

Lameloise, N., Muzzin, P., Prentki, M. and Assimacopoulos-Jeannet, F. (2001). Uncoupling protein 2, a possible link between fatty acid excess and impaired glucose-induced insulin secretion? Diabetes 50, 803-809.[Abstract/Free Full Text]

Laudes, M., Barroso, I., Luan, J., Soos, M. A., Yeo, G., Meirhaeghe, A., Logie, L., Vidal-Puig, A., Schafer, A. J., Wareham, N. J. et al. (2004). Genetic variants in human sterol regulatory element binding protein-1c in syndromes of severe insulin resistance and type 2 diabetes. Diabetes 53, 842-846.[Abstract/Free Full Text]

Lin, H. Z., Yang, S. Q., Chuckaree, C., Kuhajda, F., Ronnet, G. and Diehl, A. M. (2000). Metformin reverses fatty liver disease in obese, leptin-deficient mice. Nat. Med. 6, 998-1003.[CrossRef][Medline]

Lin, X., Taguchi, A., Park, S., Kushner, J. A., Li, F., Li, Y. and White, M. F. (2004). Dysregulation of insulin receptor substrate 2 in beta cells and brain causes obesity and diabetes. J. Clin. Invest. 114, 908-916.[CrossRef][Medline]

Loftus, T. M. and Lane, M. D. (1997). Modulating the transcriptional control of adipogenesis. Curr. Opin. Genet. Dev. 7, 603-608.[CrossRef][Medline]

Matsuzaka, T., Shimano, H., Yahagi, N., Amemiya-Kudo, M., Okazaki, H., Tamura, Y., Iizuka, Y., Ohashi, K., Tomita, S., Sekiya, M. et al. (2004). Insulin-independent induction of sterol regulatory element-binding protein-1c expression in the livers of streptozotocin-treated mice. Diabetes 53, 560-569.[Abstract/Free Full Text]

Medvedev, A. V., Robidoux, J., Bai, X., Cao, W., Floering, L. M., Daniel, K. W. and Collins, S. (2002). Regulation of the uncoupling protein-2 gene in INS-1 beta-cells by oleic acid. J. Biol. Chem. 277, 42639-42644.[Abstract/Free Full Text]

Ozcan, U., Cao, Q., Yilmaz, E., Lee, A. H., Iwakoshi, N. N., Ozdelen, E., Tuncman, G., Gorgun, C., Glimcher, L. H. and Hotamisligil, G. S. (2004). Endoplasmic reticulum stress links obesity, insulin action, and type 2 diabetes. Science 306, 457-461.[Abstract/Free Full Text]

Petersen, K. F., Oral, E. A., Dufour, S., Befroy, D., Ariyan, C., Yu, C., Cline, G. W., DePaoli, A. M., Taylor, S. I., Gorden, P. et al. (2002). Leptin reverses insulin resistance and hepatic steatosis in patients with severe lipodystrophy. J. Clin. Invest. 109, 1345-1350.[CrossRef][Medline]

Poitout, V. and Robertson, R. P. (2002). Minireview: Secondary beta-cell failure in type 2 diabetes - a convergence of glucotoxicity and lipotoxicity. Endocrinology 143, 339-342.[Abstract/Free Full Text]

Riddle, T. M., Kuhel, D. G., Woollett, L. A., Fichtenbaum, C. J. and Hui, D. Y. (2001). HIV protease inhibitor induces fatty acid and sterol biosynthesis in liver and adipose tissues due to the accumulation of activated sterol regulatory element-binding proteins in the nucleus. J. Biol. Chem. 276, 37514-37519.[Abstract/Free Full Text]

Rishi, V., Gal, J., Krylov, D., Fridriksson, J., Boysen, M. S., Mandrup, S. and Vinson, C. (2004). SREBP-1 dimerization specificity maps to both the helix-loop-helix and leucine zipper domains: use of a dominant negative. J. Biol. Chem. 279, 11863-11874.[Abstract/Free Full Text]

Roche, E., Farfari, S., Witters, L. A., Assimacopoulos-Jeannet, F., Thumelin, S., Brun, T., Corkey, B. E., Saha, A. K. and Prentki, M. (1998). Long-term exposure of beta-INS cells to high glucose concentrations increases anaplerosis, lipogenesis, and lipogenic gene expression. Diabetes 47, 1086-1094.[Abstract]

Roehrich, M. E., Mooser, V., Lenain, V., Herz, J., Nimpf, J., Azhar, S., Bideau, M., Capponi, A., Nicod, P., Haefliger, J. A. et al. (2003). Insulin-secreting beta-cell dysfunction induced by human lipoproteins. J. Biol. Chem. 278, 18368-18375.[Abstract/Free Full Text]

Rubi, B., Ishihara, H., Hegardt, F. G., Wollheim, C. B. and Maechler, P. (2001). GAD65-mediated glutamate decarboxylation reduces glucose-stimulated insulin secretion in pancreatic beta cells. J. Biol. Chem. 276, 36391-36396.[Abstract/Free Full Text]

Schreiber, E., Matthias, P., Muller, M. M. and Schaffner, W. (1988). Identification of a novel lymphoid specific octamer binding protein (OTF-2B) by proteolytic clipping bandshift assay (PCBA). EMBO J. 7, 4221-4229.[Medline]

Shimomura, I., Bashmakov, Y. and Horton, J. D. (1999a). Increased levels of nuclear SREBP-1c associated with fatty livers in two mouse models of diabetes mellitus. J. Biol. Chem. 274, 30028-30032.[Abstract/Free Full Text]

Shimomura, I., Bashmakov, Y., Ikemoto, S., Horton, J. D., Brown, M. S. and Goldstein, J. L. (1999b). Insulin selectively increases SREBP-1c mRNA in the livers of rats with streptozotocin-induced diabetes. Proc. Natl. Acad. Sci. USA 96, 13656-13661.[Abstract/Free Full Text]

Shimomura, I., Hammer, R. E., Ikemoto, S., Brown, M. S. and Goldstein, J. L. (1999c). Leptin reverses insulin resistance and diabetes mellitus in mice with congenital lipodystrophy. Nature 401, 73-76.[CrossRef][Medline]

Shimomura, I., Matsuda, M., Hammer, R. E., Bashmakov, Y., Brown, M. S. and Goldstein, J. L. (2000). Decreased IRS-2 and increased SREBP-1c lead to mixed insulin resistance and sensitivity in livers of lipodystrophic and ob/ob mice. Mol. Cell 6, 77-86.[CrossRef][Medline]

Sun, L., Halaihel, N., Zhang, W., Rogers, T. and Levi, M. (2002). Role of sterol regulatory element-binding protein 1 in regulation of renal lipid metabolism and glomerulosclerosis in diabetes mellitus. J. Biol. Chem. 277, 18919-18927.[Abstract/Free Full Text]

Takahashi, A., Motomura, K., Kato, T., Yoshikawa, T., Nakagawa, Y., Yahagi, N., Sone, H., Suzuki, H., Toyoshima, H., Yamada, N. et al. (2005). Transgenic mice overexpressing nuclear SREBP-1c in pancreatic {beta}-cells. Diabetes 54, 492-499.[Abstract/Free Full Text]

Takaishi, K., Duplomb, L., Wang, M. Y., Li, J. and Unger, R. H. (2004). Hepatic insig-1 or -2 overexpression reduces lipogenesis in obese Zucker diabetic fatty rats and in fasted/refed normal rats. Proc. Natl. Acad. Sci. USA 101, 7106-7111.[Abstract/Free Full Text]

Tobe, K., Suzuki, R., Aoyama, M., Yamauchi, T., Kamon, J., Kubota, N., Terauchi, Y., Matsui, J., Akanuma, Y., Kimura, S. et al. (2001). Increased expression of the sterol regulatory element-binding protein-1 gene in insulin receptor substrate-2(-/-) mouse liver. J. Biol. Chem. 276, 38337-38340.[Abstract/Free Full Text]

Tontonoz, P., Kim, J. B., Graves, R. A. and Spiegelman, B. M. (1993). ADD1: a novel helix-loop-helix transcription factor associated with adipocyte determination and differentiation. Mol. Cell. Biol. 13, 4753-4759.[Abstract/Free Full Text]

Ueki, K., Kondo, T., Tseng, Y. H. and Kahn, C. R. (2004). Central role of suppressors of cytokine signaling proteins in hepatic steatosis, insulin resistance, and the metabolic syndrome in the mouse. Proc. Natl. Acad. Sci. USA 101, 10422-10427.[Abstract/Free Full Text]

Unger, R. H. (2002). Lipotoxic diseases. Annu. Rev. Med. 53, 319-336.[CrossRef][Medline]

Unger, R. H. and Zhou, Y. T. (2001). Lipotoxicity of beta-cells in obesity and in other causes of fatty acid spillover. Diabetes 50, S118-S121.[Free Full Text]

Unger, R. H., Zhou, Y. T. and Orci, L. (1999). Regulation of fatty acid homeostasis in cells: novel role of leptin. Proc. Natl. Acad. Sci. USA 96, 2327-2332.[Abstract/Free Full Text]

Wang, H. and Iynedjian, P. B. (1997). Modulation of glucose responsiveness of insulinoma beta-cells by graded overexpression of glucokinase. Proc. Natl. Acad. Sci. USA 94, 4372-4377.[Abstract/Free Full Text]

Wang, H. and Wollheim, C. B. (2002). ChREBP Rather than USF2 regulates glucose stimulation of endogenous L-pyruvate kinase expression in insulin-secreting cells. J. Biol. Chem. 277, 32746-32752.[Abstract/Free Full Text]

Wang, H., Maechler, P., Hagenfeldt, K. A. and Wollheim, C. B. (1998). Dominant-negative suppression of HNF-1alpha function results in defective insulin gene transcription and impaired metabolism-secretion coupling in a pancreatic beta-cell line. EMBO J. 17, 6701-6713.[CrossRef][Medline]

Wang, H., Maechler, P., Ritz-Laser, B., Hagenfeldt, K. A., Ishihara, H., Philippe, J. and Wollheim, C. B. (2001). Pdx1 level defines pancreatic gene expression pattern and cell lineage differentiation. J. Biol. Chem. 276, 25279-25286.[Abstract/Free Full Text]

Wang, H., Maechler, P., Antinozzi, P. A., Herrero, L., Hagenfeldt-Johansson, K. A., Bjorklund, A. and Wollheim, C. B. (2003). The transcription factor SREBP-1c is instrumental in the development of beta-cell dysfunction. J. Biol. Chem. 278, 16622-16629.[Abstract/Free Full Text]

Wang, M. Y., Koyama, K., Shimabukuro, M., Mangelsdorf, D., Newgard, C. B. and Unger, R. H. (1998). Overexpression of leptin receptors in pancreatic islets of Zucker diabetic fatty rats restores GLUT-2, glucokinase, and glucose-stimulated insulin secretion. Proc. Natl. Acad. Sci. USA 95, 11921-11926.[Abstract/Free Full Text]

Weir, G. C. (1982). Non-insulin-dependent diabetes mellitus: interplay between B-cell inadequacy and insulin resistance. Am. J. Med. 73, 461-464.[CrossRef][Medline]

Weir, G. C., Laybutt, D. R., Kaneto, H., Bonner-Weir, S. and Sharma, A. (2001). Beta-cell adaptation and decompensation during the progression of diabetes. Diabetes 50, S154-S159.[Free Full Text]

Werstuck, G. H., Lentz, S. R., Dayal, S., Hossain, G. S., Sood, S. K., Shi, Y. Y., Zhou, J., Maeda, N., Krisans, S. K., Malinow, M. R. et al. (2001). Homocysteine-induced endoplasmic reticulum stress causes dysregulation of the cholesterol and triglyceride biosynthetic pathways. J. Clin. Invest. 107, 1263-1273.[Medline]

Withers, D. J., Gutierrez, J. S., Towery, H., Burks, D. J., Ren, J. M., Previs, S., Zhang, Y., Bernal, D., Pons, S., Shulman, G. I. et al. (1998). Disruption of IRS-2 causes type 2 diabetes in mice. Nature 391, 900-904.[CrossRef][Medline]

Xu, A., Yin, S., Wong, L., Chan, K. W. and Lam, K. S. (2004). Adiponectin ameliorates dyslipidemia induced by the human immunodeficiency virus protease inhibitor ritonavir in mice. Endocrinology 145, 487-494.[Abstract/Free Full Text]

Yahagi, N., Shimano, H., Hasty, A. H., Amemiya-Kudo, M., Okazaki, H., Tamura, Y., Iizuka, Y., Shionoiri, F., Ohashi, K., Osuga, J. et al. (1999). A crucial role of sterol regulatory element-binding protein-1 in the regulation of lipogenic gene expression by polyunsaturated fatty acids. J. Biol. Chem. 274, 35840-35844.[Abstract/Free Full Text]

Yahagi, N., Shimano, H., Hasty, A. H., Matsuzaka, T., Ide, T., Yoshikawa, T., Amemiya-Kudo, M., Tomita, S., Okazaki, H., Tamura, Y. et al. (2002). Absence of sterol regulatory element-binding protein-1 (SREBP-1) ameliorates fatty livers but not obesity or insulin resistance in Lep(ob)/Lep(ob) mice. J. Biol. Chem. 277, 19353-19357.[Abstract/Free Full Text]

Yamashita, T., Eto, K., Okazaki, Y., Yamashita, S., Yamauchi, T., Sekine, N., Nagai, R., Noda, M. and Kadowaki, T. (2004). Role of uncoupling protein-2 up-regulation and triglyceride accumulation in impaired glucose-stimulated insulin secretion in a beta-cell lipotoxicity model overexpressing sterol regulatory element-binding protein-1c. Endocrinology 145, 3566-3577.[Abstract/Free Full Text]

Yan, L., Nairn, A. C., Palfrey, H. C. and Brady, M. J. (2003). Glucose regulates EF-2 phosphorylation and protein translation by a protein phosphatase-2A-dependent mechanism in INS-1-derived 832/13 cells. J. Biol. Chem. 278, 18177-18183.[Abstract/Free Full Text]

Ye, J., Rawson, R. B., Komuro, R., Chen, X., Dave, U. P., Prywes, R., Brown, M. S. and Goldstein, J. L. (2000). ER stress induces cleavage of membrane-bound ATF6 by the same proteases that process SREBPs. Mol. Cell 6, 1355-1364.[CrossRef][Medline]

You, M., Fischer, M., Deeg, M. A. and Crabb, D. W. (2002). Ethanol induces fatty acid synthesis pathways by activation of sterol regulatory element-binding protein (SREBP). J. Biol. Chem. 277, 29342-29347.[Abstract/Free Full Text]

Zhang, C. Y., Baffy, G., Perret, P., Krauss, S., Peroni, O., Grujic, D., Hagen, T., Vidal-Puig, A. J., Boss, O., Kim, Y. B. et al. (2001). Uncoupling protein-2 negatively regulates insulin secretion and is a major link between obesity, beta cell dysfunction, and type 2 diabetes. Cell 105, 745-755.[CrossRef][Medline]

Zhou, G., Myers, R., Li, Y., Chen, Y., Shen, X., Fenyk-Melody, J., Wu, M., Ventre, J., Doebber, T., Fujii, N. et al. (2001). Role of AMP-activated protein kinase in mechanism of metformin action. J. Clin. Invest. 108, 1167-1174.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?

Related articles in JCS:

SREBP stressed out by glucose

JCS 2005 118: 1702. [Full Text]  



This article has been cited by other articles:


Home page
DMMHome page
G. Medina-Gomez, L. Yetukuri, V. Velagapudi, M. Campbell, M. Blount, M. Jimenez-Linan, M. Ros, M. Oresic, and A. Vidal-Puig
Adaptation and failure of pancreatic {beta} cells in murine models with different degrees of metabolic syndrome
Dis. Model. Mech., November 1, 2009; 2(11-12): 582 - 592.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
X. Shen, G. Xi, Y. Radhakrishnan, and D. R. Clemmons
Identification of Novel SHPS-1-associated Proteins and Their Roles in Regulation of Insulin-like Growth Factor-dependent Responses in Vascular Smooth Muscle Cells
Mol. Cell. Proteomics, July 1, 2009; 8(7): 1539 - 1551.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
S. Costes, B. Vandewalle, C. Tourrel-Cuzin, C. Broca, N. Linck, G. Bertrand, J. Kerr-Conte, B. Portha, F. Pattou, J. Bockaert, et al.
Degradation of cAMP-Responsive Element-Binding Protein by the Ubiquitin-Proteasome Pathway Contributes to Glucotoxicity in {beta}-Cells and Human Pancreatic Islets
Diabetes, May 1, 2009; 58(5): 1105 - 1115.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
A. Leturque, E. Brot-Laroche, and M. Le Gall
GLUT2 mutations, translocation, and receptor function in diet sugar managing
Am J Physiol Endocrinol Metab, May 1, 2009; 296(5): E985 - E992.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
G. Banhegyi, M. Csala, and A. Benedetti
Hexose-6-phosphate dehydrogenase: linking endocrinology and metabolism in the endoplasmic reticulum
J. Mol. Endocrinol., April 1, 2009; 42(4): 283 - 289.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Zhang, E. Lai, T. Teodoro, and A. Volchuk
GRP78, but Not Protein-disulfide Isomerase, Partially Reverses Hyperglycemia-induced Inhibition of Insulin Synthesis and Secretion in Pancreatic {beta}-Cells
J. Biol. Chem., February 20, 2009; 284(8): 5289 - 5298.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Besnard, S. E. Wert, M. T. Stahlman, A. D. Postle, Y. Xu, M. Ikegami, and J. A. Whitsett
Deletion of Scap in Alveolar Type II Cells Influences Lung Lipid Homeostasis and Identifies a Compensatory Role for Pulmonary Lipofibroblasts
J. Biol. Chem., February 6, 2009; 284(6): 4018 - 4030.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
M. S. Han, K. W. Chung, H. G. Cheon, S. D. Rhee, C.-H. Yoon, M.-K. Lee, K.-W. Kim, and M.-S. Lee
Imatinib Mesylate Reduces Endoplasmic Reticulum Stress and Induces Remission of Diabetes in db/db Mice
Diabetes, February 1, 2009; 58(2): 329 - 336.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
T. Hartley, J. Brumell, and A. Volchuk
Emerging roles for the ubiquitin-proteasome system and autophagy in pancreatic {beta}-cells
Am J Physiol Endocrinol Metab, January 1, 2009; 296(1): E1 - E10.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
B. Qian, H. Wang, X. Men, W. Zhang, H. Cai, S. Xu, Y. Xu, L. Ye, C. B Wollheim, and J. Lou
TRIB3 is implicated in glucotoxicity- and oestrogen receptor-stress-induced {beta}-cell apoptosis
J. Endocrinol., December 1, 2008; 199(3): 407 - 416.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
E. Sargsyan, H. Ortsater, K. Thorn, and P. Bergsten
Diazoxide-induced {beta}-cell rest reduces endoplasmic reticulum stress in lipotoxic {beta}-cells
J. Endocrinol., October 1, 2008; 199(1): 41 - 50.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
H. K Nyblom, E. Sargsyan, and P. Bergsten
AMP-activated protein kinase agonist dose dependently improves function and reduces apoptosis in glucotoxic {beta}-cells without changing triglyceride levels
J. Mol. Endocrinol., September 1, 2008; 41(3): 187 - 194.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
G. Boden, X. Duan, C. Homko, E. J. Molina, W. Song, O. Perez, P. Cheung, and S. Merali
Increase in Endoplasmic Reticulum Stress-Related Proteins and Genes in Adipose Tissue of Obese, Insulin-Resistant Individuals
Diabetes, September 1, 2008; 57(9): 2438 - 2444.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S. K. Das, W. S. Chu, A. K. Mondal, N. K. Sharma, P. A. Kern, N. Rasouli, and S. C. Elbein
Effect of pioglitazone treatment on endoplasmic reticulum stress response in human adipose and in palmitate-induced stress in human liver and adipose cell lines
Am J Physiol Endocrinol Metab, August 1, 2008; 295(2): E393 - E400.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. D. Jeffrey, E. U. Alejandro, D. S. Luciani, T. B. Kalynyak, X. Hu, H. Li, Y. Lin, R. R. Townsend, K. S. Polonsky, and J. D. Johnson
Carboxypeptidase E mediates palmitate-induced {beta}-cell ER stress and apoptosis
PNAS, June 17, 2008; 105(24): 8452 - 8457.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
K. Maedler, F. T. Schulthess, C. Bielman, T. Berney, C. Bonny, M. Prentki, M. Y. Donath, and R. Roduit
Glucose and leptin induce apoptosis in human {beta}-cells and impair glucose-stimulated insulin secretion through activation of c-Jun N-terminal kinases
FASEB J, June 1, 2008; 22(6): 1905 - 1913.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
F. Diraison, M. A. Ravier, S. K. Richards, R. M. Smith, H. Shimano, and G. A. Rutter
SREBP1 is required for the induction by glucose of pancreatic {beta}-cell genes involved in glucose sensing
J. Lipid Res., April 1, 2008; 49(4): 814 - 822.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
D. Li, X. Yin, E. J. Zmuda, C. C. Wolford, X. Dong, M. F. White, and T. Hai
The Repression of IRS2 Gene by ATF3, a Stress-Inducible Gene, Contributes to Pancreatic {beta}-Cell Apoptosis
Diabetes, March 1, 2008; 57(3): 635 - 644.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
D. L. Eizirik, A. K. Cardozo, and M. Cnop
The Role for Endoplasmic Reticulum Stress in Diabetes Mellitus
Endocr. Rev., February 1, 2008; 29(1): 42 - 61.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. Aguiari, S. Leo, B. Zavan, V. Vindigni, A. Rimessi, K. Bianchi, C. Franzin, R. Cortivo, M. Rossato, R. Vettor, et al.
High glucose induces adipogenic differentiation of muscle-derived stem cells
PNAS, January 29, 2008; 105(4): 1226 - 1231.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
T. Yano, Z. Liu, J. Donovan, M. K. Thomas, and J. F. Habener
Stromal Cell Derived Factor-1 (SDF-1)/CXCL12 Attenuates Diabetes in Mice and Promotes Pancreatic {beta}-Cell Survival by Activation of the Prosurvival Kinase Akt
Diabetes, December 1, 2007; 56(12): 2946 - 2957.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Yang, W. Yang, L. Wu, and R. Wang
H2S, Endoplasmic Reticulum Stress, and Apoptosis of Insulin-secreting Beta Cells
J. Biol. Chem., June 1, 2007; 282(22): 16567 - 16576.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
S. S. Choe, A H. Choi, J.-W. Lee, K. H. Kim, J.-J. Chung, J. Park, K.-M. Lee, K.-G. Park, I.-K. Lee, and J. B. Kim
Chronic Activation of Liver X Receptor Induces {beta}-Cell Apoptosis Through Hyperactivation of Lipogenesis: Liver X Receptor-Mediated Lipotoxicity in Pancreatic {beta}-Cells
Diabetes, June 1, 2007; 56(6): 1534 - 1543.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Mussmann, M. Geese, F. Harder, S. Kegel, U. Andag, A. Lomow, U. Burk, D. Onichtchouk, C. Dohrmann, and M. Austen
Inhibition of GSK3 Promotes Replication and Survival of Pancreatic Beta Cells
J. Biol. Chem., April 20, 2007; 282(16): 12030 - 12037.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
N. A. Kaniuk, M. Kiraly, H. Bates, M. Vranic, A. Volchuk, and J. H. Brumell
Ubiquitinated-Protein Aggregates Form in Pancreatic {beta}-Cells During Diabetes-Induced Oxidative Stress and Are Regulated by Autophagy
Diabetes, April 1, 2007; 56(4): 930 - 939.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Dubois, P. Vacher, B. Roger, D. Huyghe, B. Vandewalle, J. Kerr-Conte, F. Pattou, N. Moustaid-Moussa, and J. Lang
Glucotoxicity Inhibits Late Steps of Insulin Exocytosis
Endocrinology, April 1, 2007; 148(4): 1605 - 1614.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. P. R. Rao, R. Wassell, M. A. Shaw, and K. Sharma
Profiling of human mesangial cell subproteomes reveals a role for calmodulin in glucose uptake
Am J Physiol Renal Physiol, April 1, 2007; 292(4): F1182 - F1189.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Cnop, L. Ladriere, P. Hekerman, F. Ortis, A. K. Cardozo, Z. Dogusan, D. Flamez, M. Boyce, J. Yuan, and D. L. Eizirik
Selective Inhibition of Eukaryotic Translation Initiation Factor 2{alpha} Dephosphorylation Potentiates Fatty Acid-induced Endoplasmic Reticulum Stress and Causes Pancreatic beta-Cell Dysfunction and Apoptosis
J. Biol. Chem., February 9, 2007; 282(6): 3989 - 3997.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
E. Borter, M. Niessen, R. Zuellig, G. A. Spinas, P. Spielmann, G. Camenisch, and R. H. Wenger
Glucose-Stimulated Insulin Production in Mice Deficient for the PAS Kinase PASKIN
Diabetes, January 1, 2007; 56(1): 113 - 117.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
L. E. Parton, P. J. McMillen, Y. Shen, E. Docherty, E. Sharpe, F. Diraison, C. P. Briscoe, and G. A. Rutter
Limited role for SREBP-1c in defective glucose-induced insulin secretion from Zucker diabetic fatty rat islets: a functional and gene profiling analysis
Am J Physiol Endocrinol Metab, November 1, 2006; 291(5): E982 - E994.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jcs.02513v1
118/17/3905    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in JCS
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, H.
Right arrow Articles by Wollheim, C. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, H.
Right arrow Articles by Wollheim, C. B.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?