|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 21 September 2005
doi: 10.1242/jcs.02574
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
1 Mammary Biology and Tumorigenesis Laboratory, NCI/CCR, 37 Convent Drive, Building 37, Bethesda, MD 20892, USA
2 Cell Biology and Preclinical Models Unit, INT-Fondazione Pascale, 80131 Naples, Italy
3 Department of Biology, University of California at Santa Cruz, Santa Cruz, 1156 High Street, Santa Cruz, CA 95064, USA
* Author for correspondence (e-mail: salomond{at}mail.nih.gov)
Accepted 7 July 2005
| Summary |
|---|
|
|
|---|
Key words: Mammary cells, Netrin-1, Cripto-1, Invasion, Migration
| Introduction |
|---|
|
|
|---|
Cripto-1 is expressed in a variety of human cancers (Salomon et al., 2000
) including breast cancer (Qi et al., 1994
). Overexpression of CR-1 has been shown to induce proliferation, migration and invasion of human breast cancer cells (Brandt et al., 1994
; Normanno et al., 2004
) and of mouse mammary epithelial cells (Bianco et al., 2003
; Strizzi et al., 2004
; Wechselberger et al., 2001
). Furthermore, cells overexpressing CR-1 have been shown to acquire specific biochemical and morphological features suggesting that CR-1 may play a role in promoting epithelial mesenchymal transition (EMT).
Epithelial mesenchymal transition is a normal physiologic process important for embryogenesis, tissue growth, wound healing and tissue repair (Perez-Pomares and Munoz-Chapuli, 2002
). During EMT epithelial cells lose their adhesive properties owing to modification in the expression of cellular adhesion molecules like E-cadherin (Boyer et al., 2000
; Savagner, 2001
). In fact, the overexpression of the genes snail and slug has been shown to play an important role in inducing EMT by negatively affecting the expression of E-cadherin (Cano et al., 2000
). Epithelial cells undergoing EMT also show changes in the cytoskeleton. For example, vimentin is a cytoskeleton molecule normally expressed in mesenchymal cells and when expressed in epithelial cells may facilitate their acquisition of a more spindle-shaped morphology during EMT in both normal and disease states (Fuchs and Weber, 1994
; Gilles et al., 1996
; Lane et al., 1983
). Molecules that are involved in growth factor signaling such as Src and phosphoinositide 3-kinase (PI3K) are also activated during EMT (Thiery and Chopin, 1999
; Vincent-Salomon and Thiery, 2003
). Thus, cellular changes characteristic of EMT facilitate migration and invasion of epithelial tumor cells and have recently been suggested as an index of aggressiveness and increased metastatic potential in different types of malignant tumors (Birchmeier et al., 1996a
; Birchmeier et al., 1996b
; Gilchrist et al., 2002
). Specifically, reports have suggested that EMT may be relevant to the development of human breast cancer, as mutations in E-cadherin expression (Berx et al., 1998
; Cano et al., 2000
), overexpression of snail and slug (Cano et al., 2000
; Hajra et al., 2002
), overexpression of vimentin (Hanna et al., 2003
) and increased activity of signaling molecules involved in migration and invasion during EMT (Vincent-Salomon and Thiery, 2003
) have all been identified in human breast cancer both in vitro and in vivo. In addition, EMT has been suggested to play a role during metastasis and affecting prognosis in human breast cancer (Fuchs et al., 2002
; Xue et al., 2003
).
Overexpression of mouse Cripto-1 (Cr-1) increases proliferation of mouse mammary epithelial cells and causes them to assume a more mesenchyme-like phenotype. In addition, Cr-1 overexpression increases anchorage-independent growth of mammary epithelial cells in soft agar and migration when cells are grown on plastic or on porous filters coated with extracellular matrix, and during wound healing assays (Wechselberger et al., 2001
). Increased expression of Cr-1 also induces the formation of branch-like structures when mouse mammary epithelial cells are grown in a collagen type I matrix (Wechselberger et al., 2001
). Overall, these responses are reminiscent of EMT and suggest that Cr-1 overexpression induces this transition in mammary epithelial cells. However, whether Cripto-1-induced migration and proliferation can be influenced by extracellular directional cues is unclear.
Various studies have identified different chemotropic factors that regulate the direction of cell migration. Most of these have been identified during neuronal development and include proteins such as, Slits, Ephrins, Semaphorins (Kolodkin et al., 1993
), Sonic hedgehog (Charron et al., 2003
), bone morphogenic proteins (Butler and Dodd, 2003
), Wnts (Yoshikawa et al., 2003
) and Netrins (Serafini et al., 1996
; Serafini et al., 1994
). Sequence and functional analysis have shown that Netrins are a conserved family of secreted proteins that have regional homology to laminins and are capable of regulating axonal outgrowth (Kennedy et al., 1994
; Puschel, 1999
; Serafini et al., 1996
). The direction of Netrin-dependent neuronal outgrowth is determined by the cellular expression of receptors belonging to either the DCC (deleted in colon cancer) or UNC5 families of Netrin-1 receptors (Keino-Masu et al., 1996
; Leonardo et al., 1997
). These single-pass transmembrane receptors contain immunoglobulin domains with DCC containing fibronectin type-3 domains and with UNC5 containing a thrombospondin type-I domain (Chisholm and Tessier-Lavigne, 1999
). The DCC receptors, which include the structurally similar Neogenin receptor, mediate attraction, whereas repulsion is mediated by a complex of DCC and UNC5 receptor families (Hinck, 2004
; Hong et al., 1999
). The highly conserved family of UNC receptors possess a high level of structural and sequence homology in the ligand binding extracellular domain (Engelkamp, 2002
). In humans, UNC5 receptors are composed of UNC5HA, UNC5HB and UNC5HC and correspond to the rodent orthologues UNC5H1, UNC5H2 and UNC5H3, respectively (Arakawa, 2004
).
Recent studies have found functioning Netrin molecules outside the nervous system, in the pancreas, intestine (Jiang et al., 2003
; Yebra et al., 2003
), lung (Liu et al., 2004
) kidney, heart and vasculature (Koch et al., 2000
; Lu et al., 2004
; Park et al., 2004
) where they presumably play a role in the development of these organs by regulating the migration of different types of cells. Regulation of the expression of Netrin-1 and its receptors may play a role in tumorigenesis. In fact, Netrin-1 was shown to be reduced in tumors of the prostate and of the nervous system (Latil et al., 2003
; Meyerhardt et al., 1999
). Low levels of somatic mutations of DCC have been identified in cancers of the brain, stomach, pancreas, colorectum and testicle (Arakawa, 2004
) and in a series comparing human colorectal tumors with corresponding normal tissues, of the different UNC5 receptors studied, UNC5A, the orthologue of rodent UNC5H1, showed the highest percentage of altered expression (Thiebault et al., 2003
).
Netrin-1 and Neogenin have been shown to be involved in maintaining adhesion between cap cells and luminal cells in the mammary gland terminal end buds (Srinivasan et al., 2003
). As Cr-1 is also expressed in the terminal end buds of developing mammary glands (Kenney et al., 1995
) and is capable of inducing migration by deregulating cell adhesion and promoting EMT in mammary epithelial cells, we investigated the expression and function of Netrin-1 and its receptors in invasion, migration and colony formation of mouse mammary epithelial cells that overexpress Cripto-1.
| Materials and Methods |
|---|
|
|
|---|
Western blotting, transfection with siRNA and treatment with synthetic inhibitors
Lysates were obtained from the mouse mammary epithelial cells and western blotting was performed as previously described (Bianco et al., 2002
). A 1:1000 dilution was used for all primary antibodies unless otherwise stated. HC-11/Cr-1 cells were transfected with either an anti-Cr-1 small interfering RNA (siRNA) or irrelevant scrambled siRNA, used as a control, both custom made by Qiagen (Valencia, CA). The anti-Cr-1 siRNA sequence is designed to target the Cr-1 mRNA sequence at AAACAGCTAAATTATCTTTAA (GenBank accession number NM_011562). The transfection experiments with siRNA were performed using Qiagen transfection reagents for siRNAs and following the manufacturer's instructions for transfection of cells with siRNAs. Western blotting for analysis of Cr-1 expression was performed on lysates collected from the transfected cells after 72 hours. Reverse transcriptase-PCR for analysis of Cr-1 expression in cells treated with the anti-Cr-1 siRNA was performed as previously described (Kenney et al., 1995
).
For treatment with synthetic inhibitors, approximately 2x105 EpH4 or EpH4/Cr-1 cells were seeded and grown until 70-80% confluent. The cells were then serum starved for 24 hours and subsequently treated for 8 hours with 10 µM PP2 or LY, or 20 µM PD before being harvested for western blotting. To quantify the expression of the different proteins analyzed, western blots were scanned by densitometric analysis, which was performed using the public domain NIH Image analyzer developed at the US National Institutes of Health (http://rsb.info.nih.gov/nih-image/). Final densitometric readings were normalized against actin for equal loading and expressed as optical densitometric (OD) units.
Immunofluorescence and immunohistochemistry
For immunofluorescence, approximately 1x105 cells were cultured overnight in Lab-Tek dual chamber slides (Nalge Nunc, Naperville, IL). Culture medium was removed and cells were washed twice with PBS, fixed with ice-cold 100% methanol for 10 minutes and air-dried. Slides were then washed three times with PBS, blocked for 30 minutes with 5% normal goat serum and incubated for 1 hour with primary rabbit antibodies against Netrin-1, Neogenin or UNC5H1 (1:100). Cells were again washed three times with PBS and incubated for 30 minutes with goat anti-rabbit Alexa Fluor-conjugated secondary antibody (1:600) (Molecular Probes, Eugene, OR). Slides were finally mounted with Vectashield (Vector Labs, Burlington, CA), a mounting medium containing DAPI for identification of cell nuclei.
For immunohistochemistry, 5-µm-thick sections of paraffin-embedded, formalin-fixed mammary tumors from MMTV-CR-1 transgenic mice (Wechselberger et al., 2005
) were deparaffinized in xylene, rehydrated in a series of graded ethanols, and predigested with ready-to-use pepsin solution (Digest-All3; Zymed, San Francisco, CA) for 6 minutes at 37°C. Endogenous peroxidase activity was blocked for 10 minutes with 0.3% H2O2 in methanol. The sections were then incubated for 30 minutes at room temperature with anti-Netrin-1 or anti-Neogenin primary antibodies (1:100). Immunostaining was carried out using the Vectastain ABC kit (Vector, Burlingame, CA) and following the manufacturer's instructions. Color was developed with DAB peroxidase substrate (Vector) and sections counterstained with haematoxylin. When appropriate, immunostaining intensity was quantified by using the public domain NIH digital image analyzer described.
Cell invasion and migration assay
Cell invasion and migration across a basement membrane matrix was evaluated using a commercially available 12- or 24-well plate cell invasion/migration assay kit (Chemicon, Temecula, CA) and following the manufacturer's instructions. Briefly,
3.5x105 cells were seeded into individual invasion chambers, which in turn were placed in 12-well plates containing low serum (2% FBS) culture medium with or without 25 or 50 ng/ml rmNetrin-1 in the lower chamber and incubated for 36 hours. Non-invading cells were carefully wiped off the upper surface of the invasion filters with a swab. Cells that invaded and migrated through the matrix-containing membrane and reached the lower surface of the invasion chamber were stained with crystal violet and counted in at least four different high power fields (hpf) using a light microscope. In parallel experiments
3.5x105 EpH4/Cr-1 or HC-11/Cr-1 cells were seeded in normal 12-well plates, grown until
70-80% confluent and then treated with 50 ng/ml rmNetrin-1. After 48 hours, lysates were collected from these cells and western blotting performed for analysis of the expressions of Neogenin and UNC5H1.
To determine whether blocking of Netrin-1 receptors would affect invasion and migration, Cr-1-overexpressing cells were pre-incubated with 10 µg/ml of either anti-UNC5C or anti-Neogenin blocking antibody for 30 minutes prior to seeding in the invasion chambers that contained 50 ng/ml rmNetrin-1. Approximately 2x105 cells were seeded in invasion chambers that were contained in the 24-well plate cell invasion kit and incubated as described above. For the quantification of invading cells in these sets of experiments, direct cell counts were not obtained in order to reduce possible underestimation artifact owing to selection of non-representative areas on the invasion membrane as a consequence of the relatively low number of cells seeded. Instead, stain from the invading cells that reached the lower surface of the invasion membrane was extracted with 10% acetic acid and optical density quantified at 560 nm.
Colony formation in 3D matrices
For colony formation, a 2 ml layer of ready-to-use Matrigel solution (Collaborative Biomedical Products, Bedford, MA) was pipetted in six-well cell culture plates. Sterile disks of blot paper preabsorbed with PBS or with PBS containing approximately 100, 200 or 400 ng/ml of rmNetrin-1 were placed in the center of the Matrigel and covered with a second layer (2 ml) of Matrigel. Approximately 5x105 Eph4/CR-1 cells in complete culture media were seeded in each well. Formation of spherical colonies was evaluated after 48 hours. To determine the number of colonies, an automated colony counter (Artek Systems Corp, Farmingdale, NY) was adjusted to count colonies having a diameter greater than 500 µm. The colonies were counted in three evenly spaced circumferences defined as proximal (P), medial (M) or distal (D) to the disks of preabsorbed blot paper that served as the source of Netrin-1.
In vivo study of mammary morphogenesis
Five-week-old FVB/N or MMTV-CR-1 female mice were implanted with cholesterol pellets. Different cholesterol pellets were formulated to continuously release various doses (25 or 50 ng/day) of rmNetrin-1 for 2 weeks and were prepared as previously described (Vonderhaar, 1987
). The pellets were then surgically implanted into the right inguinal mammary gland at approximately the same distance from the mammary lymph node for each animal. A total of 14 FVB/N mice were used. Four FVB/N mice were implanted with cholesterol-only pellets, five were implanted with pellets releasing 25 ng/d of rmNetrin-1 and five with pellets releasing 50 ng/day of rmNetrin-1. A total of 14 MMTV-CR-1 transgenic mice were also used and distributed in each experimental group as described above for the FVB/N mice. Two weeks after implantation, mammary glands were surgically removed and analyzed by whole mount morphology at 10x magnification. For whole mount preparation, mammary glands were spread and fixed on glass slides with Carnoy's solution (glacial acetic acid:ethanol; 1:3) for 60 minutes at room temperature. The glands were rehydrated and stained overnight in aluminum carmine solution. The glands were subsequently dehydrated, cleared in xylene and mounted for microscopic observation. Digital microphotographs were taken using a Polaroid DMC-1 digital camera (Polaroid, Cambridge, MA) mounted on a Leica MZ125 microscope (Leica, Wetzlar, Germany). For each mammary gland, ductal elongation was represented as the distance measured on the microphotographs in millimeters from the center of the mammary gland lymph node to the tip of the farthest growing duct in direction of the inserted pellet. Mammary gland tissue from the MMTV-CR-1 transgenic mice treated with control or Netrin-1-releasing pellets were also processed for immunohistochemistry as described above and analyzed for expression of UNC5H1, E-cadherin, vimentin and P-Akt. Care and use of the experimental animals for this study was in compliance with the relevant animal welfare laws, guidelines and policies at NIH.
|
| Results |
|---|
|
|
|---|
Reducing Cripto-1 expression or inhibiting Cripto-1 signaling rescues Netrin-1 expression in mammary epithelial cells overexpressing Cripto-1
Transfection of HC-11/Cr-1 cells with an anti-Cr-1 siRNA, capable of reducing Cr-1 mRNA and protein expression in these cells (Fig. 2A), caused Netrin-1 and Neogenin expression to return to levels that were comparable to those detected in wild-type HC-11 cells by western blotting (Fig. 2B). EpH4/Cr-1 cells do not express endogenous Nodal (Bianco et al., 2002
). When Nodal-independent signaling in EpH4/Cr-1 cells was blocked with the synthetic c-Src inhibitor PP2 (Bianco et al., 2003
), there was an increase in Netrin-1 expression and a decrease in Neogenin expression compared to that in untreated cells (Fig. 2C). Treatment of EpH4/Cr-1 cells with the PI-3K inhibitor LY was also associated with an increase in Netrin-1 expression and a decrease in Neogenin expression (Fig. 2C,D). No significant effect on the expression of Netrin-1 or Neogenin was detected when EpH4/Cr-1 cells were treated with the MAPK inhibitor, PD (Fig. 2C,D). These results suggest that blocking Cripto-1 signaling through a Nodal-independent pathway, which is dependent on c-Src and PI-3K, rescues Cripto-1-dependent loss of Netrin-1 expression.
|
Exogenous Netrin-1 reverses the characteristics of epithelial-to-mesenchymal transition in mammary epithelial cells overexpressing Cripto-1
Cripto-1 overexpression in mouse mammary cells is associated with reduced expression of the intracellular adhesion molecule E-cadherin and increased expression of vimentin, which are characteristic of cells undergoing EMT (Strizzi et al., 2004
). Akt activation has also been shown to occur during Cr-1-dependent migration of mouse mammary epithelial cells and in human breast cancer cells overexpressing Cr-1 (Bianco et al., 2003
; Normanno et al., 2004
). EpH4/Cr-1 cells grown in medium containing exogenous rmNetrin-1 (50 ng/ml) showed an increase in the expression of E-cadherin and a decrease in the expression of vimentin (Fig. 3A). In addition, reduced phosphorylation of Akt was observed in Netrin-1-treated EpH4/Cr-1 cells compared to levels in EpH4/Cr-1 cells grown in culture medium without exogenous rmNetrin-1 (Fig. 3A).
|
Mouse mammary epithelial cells overexpressing Cripto-1 form fewer colonies in 3D extracellular matrix in proximity to a Netrin-1 source
The increased ability of Eph4/Cr-1 cells compared to the wild type, to form colonies in 3D extracellular matrix has been previously determined (Wechselberger et al., 2001
). To determine whether exogenous Netrin-1 was capable of affecting colony formation by EpH4/Cr-1 cells, these cells were seeded in 3D Matrigel containing disks of filter paper that had been preabsorbed with different concentrations of Netrin-1. Spherical colonies having diameters
500 µm were scored after 48 hours in equally divided areas situated proximal, medial or distal to the disks of blot paper preabsorbed with either PBS or rmNetrin-1. EpH4/Cr-1 colonies were more homogenously distributed throughout the Matrigel containing the PBS source whereas there were significantly fewer colonies formed in the areas proximal to the Netrin-1 source (Fig. 4A). In some of the 3D cultures, EpH4/Cr-1 cells actually formed a noticeable ring of growth inhibition around the source of Netrin-1 (Fig. 4B). This effect was more evident with blot paper preabsorbed with 100 or 200 ng/ml of rmNetrin-1. Blot paper pre-absorbed with 400 ng/ml rmNetrin-1 did not inhibit colony formation of EpH4/Cr-1 cells (data not shown). Quantification of the colonies formed in Matrigel with diameters greater than 500 µm revealed a significant reduction in the number of colonies formed by Eph4/Cr-1 in proximity to the blot paper preabsorbed with rmNetrin-1 compared to blot papers preabsorbed with PBS (Fig. 4C).
|
Effect of exogenous Netrin-1 on mammary ductal morphogenesis in vivo
When control pellets containing cholesterol were introduced into the virgin mammary gland of 5-week-old FVB/N or MMTV/CR-1 mice, normal ductal elongation was observed in whole mounts of mammary gland from these mice after 2 weeks (Fig. 4D). Ductal elongation in FVB/N mammary glands containing pellets releasing 25 ng/day was similar to that observed in control FVB/N mammary glands (Fig. 4D). However, there was a significant reduction in ductal elongation in the mammary glands of MMTV-CR-1 mice containing pellets releasing 25 ng/day of Netrin-1 (Fig. 4D,E). The inhibitory effect of Netrin-1 on mammary gland ductal elongation was not observed in mice containing pellets releasing greater amounts (50 ng/day) of rmNetrin-1 (data not shown).
Immunohistochemical analysis of the terminal end buds in the mammary glands treated with the Netrin-1 pellets showed an overall increase in expression of UNC5H1 throughout the terminal end bud structures compared to MMTV-CR-1 transgenic mammary glands treated with control pellets where UNC5H1 appeared to stain only the peripheral area of these structures (Fig. 5). Increased staining for E-cadherin was also observed in the terminal end buds of MMTV-CR-1 mammary glands containing the Netrin-1 pellet compared to that in the control (Fig. 5). Finally, positive staining for P-Akt was more intense in the epithelial and stromal cells in mammary glands from MMTV-CR-1 mice containing control pellets compared to mammary glands from MMTV-CR-1 transgenic mice implanted with the Netrin-1-releasing pellets. Moreover, the average intensity of staining for P-Akt in the terminal end buds as evaluated by digital image analysis was significantly reduced by almost one-third (32%) (Range 24-42% reduction; n=5; P=0.008) in MMTV-CR-1 mammary glands containing Netrin-1 pellets compared to terminal end buds in MMTV-CR-1 glands containing control pellets (Fig. 5). Vimentin stained poorly in MMTV-CR-1 mammary glands containing either control or Netrin-1 pellets and showed no difference in the levels of expression between the two different mammary glands (data not shown).
|
| Discussion |
|---|
|
|
|---|
Cripto-1 is expressed in a greater number of infiltrating ductal carcinomas or intralobular carcinomas than in ductal carcinomas in situ (Panico et al., 1996
). In addition, expression of CR-1 is higher in colon tumors than in the adjacent noninvolved colon epithelium and correlates with tumor stage, increased regional lymph node metastases and a higher rate of colorectal cancer recurrence (Gagliardi, 1994; Kuniyasu et al., 1991
). In gastric carcinoma, the incidence of CR-1-positive cases was more frequent in late stage, locally invasive tumors than in early stage, noninvasive cancers (Kuniyasu, 1994). From these studies, the association between CR-1 expression and characteristics of tumors undergoing EMT such as local tissue invasion, lymph node metastasis and cancer recurrence (Gotzmann et al., 2004
; Thiery, 2003b
; Thiery and Chopin, 1999
; Vincent-Salomon and Thiery, 2003
), suggest that CR-1 may be capable of promoting a more aggressive phenotype in human tumor cells by inducing EMT.
The overexpression of CR-1 in mammary glands of aged multiparous mice leads to the formation of mammary papillary adenocarcinomas (Wechselberger et al., 2005
). These tumors show evidence of EMT such as reduced expression of E-cadherin and increased expression of vimentin and snail, especially in areas containing anaplastic, mesenchyme-like tumor cells (Strizzi et al., 2004
). In the present study, Netrin-1 expression was reduced relative to Neogenin in these same regions. Moreover, immunostaining for CR-1 was increased in areas of the tumors exhibiting characteristics of EMT compared to the areas of the CR-1 transgenic mouse mammary tumors that possess a more differentiated papillary phenotype (Strizzi et al., 2004
). In this regard, the reduction of Netrin-1 expression observed in mouse mammary epithelial cells overexpressing Cr-1 is similar to the reduced expression of Netrin-1 observed in the mesenchyme-like tumor cells in the mammary tumors from the CR-1 transgenic mice. Therefore, the loss of an epithelial phenotype, which is induced by Cripto-1 overexpression in mammary epithelial cells, is associated with a reduction in Netrin-1 expression as mammary epithelial cells exhibit a more motile and mesenchyme-like phenotype.
Targeted inhibition of Cr-1 expression with a specific siRNA resulted in the reversion of Netrin-1 and Neogenin expression to levels that were detected in wild-type mammary epithelial cells, suggesting that Cr-1 may play a role in regulating Netrin-1 and Neogenin expression. As EpH4 cells do not express Nodal (Bianco et al., 2002
), and as treatment of EpH4/Cr-1 cells with PP2 or LY was followed by an increase in Netrin-1 expression and a decrease in Neogenin expression, this indicates that Cripto-1 may be affecting Netrin-1 and Neogenin expression by signaling through a pathway that involves Nodal-independent activation of c-Src and/or PI-3K/Akt in EpH4/Cr-1 cells. The addition of exogenous rmNetrin-1 to the culture medium of mouse mammary epithelial cells overexpressing Cr-1 resulted in a reduction in the expression of Neogenin. This suggests that exogenous Netrin-1 is capable of either reverting effects of Cr-1 on Neogenin expression or that there may be a potential negative feedback mechanism by which Netrin-1 regulates the expression of Neogenin. The latter possibility has been described in other systems whereby cells compensate for high concentrations of ligand expression by adjusting the expression of cell surface receptors (Frank et al., 1996
).
Local release of Netrin-1 from pellets implanted in vivo in the mammary glands of virgin MMTV-CR-1 transgenic mice but not in control mammary glands of virgin FVB/N mice resulted in an inhibition in the elongation of the developing mammary ducts through the fat pad. This is interesting, as CR-1 overexpression in the mammary gland of virgin MMTV-CR-1 transgenic mice is associated with enhanced ductal side branching and elongation (Wechselberger et al., 2005
). The family of UNC5 receptors can mediate, alone or as a coreceptor with Neogenin, the repulsive effects of Netrin-1 (Dickson and Keleman, 2002
; Hinck, 2004
; Hong et al., 1999
). Netrin-1 in the presence of an UNC5 receptor is capable of reducing migration and filipodial extension of endothelial cells in vitro and in vivo (Lu et al., 2004
). Likewise, Netrin-1 can cause epithelial cells of the developing lung to migrate away from a Netrin-1 source (Liu et al., 2004
). Our in vitro data suggest that UNC5 may be involved in mediating the negative effects of Netrin-1 on ductal elongation. Although overexpression of Cripto-1 in the mouse mammary epithelial cells did not affect the expression of UNC5H1, when Cr-1 overexpressing cells are cultured in the presence of exogenous rmNetrin-1, these cells are found to overexpress UNC5H1 receptors. Immunohistochemical analysis of the mammary terminal end buds of MMTV/CR-1 transgenic mice treated with Netrin-1 pellets showed increased expression of UNC5H1 throughout the terminal end bud compared to mammary terminal end buds in MMTV/CR-1 transgenic mice treated with control pellets, which showed reduced UNC5H1 staining limited to the periphery of the terminal end bud. Thus the UNC5 receptors may also be involved in mediating the reduction in the number of colonies formed in Matrigel and in impairing the migration and invasion of EpH4/Cr-1 cells across matrix-coated membranes in response to exogenous rmNetrin-1. Interestingly, the inhibitory effects of Netrin-1 on colony formation by Eph4/Cr-1 cells and on ductal elongation in the mammary glands of MMTV-CR-1 transgenic mice were not observed at higher doses (data not shown). A similar dose-response effect for Netrin-1 activity on axon outgrowth was also observed and has been attributed to the requirement for Netrin-1 to induce receptor clustering that is impaired at higher concentrations of Netrin-1 (Serafini et al., 1994
).
The anti-invasive effects of Netrin-1 on EpH4/Cr-1 cells was significantly attenuated when these cells were preincubated with blocking antibodies against UNC5C, which is highly homologous in the extracellular domain to mouse UNC5H1 (Engelkamp, 2002
). However, preincubation of EpH4/Cr-1 cells with an anti-Neogenin blocking antibody did not have the same effect but actually further inhibited the invasion of Eph4/Cr-1 cells across the matrix-coated membranes. This effect may possibly be due to a decrease in attractive cues that the Neogenin receptors may have been capable of inducing in EpH4/Cr-1 cells in response to Netrin-1. This result also suggests that it is unlikely that Neogenin is acting alone (Rajagopalan et al., 2004
) or as a coreceptor with UNC5 (Hong et al., 1999
) in mediating repulsion in EpH4/Cr-1 cells. However, it cannot be excluded that, alternatively or in combination with the UNC5 receptor, Netrin-1 may have affected Cr-1-dependent invasion and colony formation of mammary epithelial cells and ductal elongation in mammary glands by blocking Cripto-1 signaling. In fact, Akt activity was reduced in EpH4/Cr-1 cells when cultured in the presence of exogenous Netrin-1. The reduction in P-Akt expression was also detected by immunohistochemistry in epithelial cells of the terminal end buds and surrounding stromal cells of MMTV/CR-1 mammary glands containing Netrin-1 pellets compared to MMTV/CR-1 mammary glands containing control pellets.
Mechanisms that regulate cell adhesion and migration play a fundamental role not only during normal tissue development and differentiation but also in the survival and spread of tumor cells (Cavallaro and Christofori, 2004
; Lee and Juliano, 2004
; Thiery, 2003a
; Van Roy and Mareel, 1992
). In this respect, factors that may affect Netrin-1-dependent adhesion in mammary epithelial cells should provide some insight into the mechanisms involved in the spread of potential tumor cells. The association between overexpression of Cripto-1 and induction of biochemical changes important for EMT, such as reduction of E-cadherin levels and increased expression of vimentin both in vitro and in vivo, has been previously described (Ebert et al., 2000
; Strizzi et al., 2004
). Furthermore, Cripto-1 induces morphologic changes and activation of signaling molecules known to enhance cell migration and invasion (Bianco et al., 2003
; Normanno et al., 2004
; Wechselberger et al., 2001
). These findings support a potential role for Cripto-1 during tumorigenesis.
From our data it appears that a possible mechanism by which Cripto-1 may induce a more aggressive phenotype in mammary epithelial cells is by reducing Netrin-1 expression and affecting the profile of Netrin-1 receptor expression. Exogenous Netrin-1 was capable of increasing E-cadherin and decreasing vimentin expression in EpH4/Cr-1 thus reversing Cr-1-dependent biochemical changes in vitro, which are important for EMT. Immunohistochemical analysis of the mammary terminal end buds from MMTV/CR-1 transgenic mice treated with Netrin-1 pellets also showed an increase in E-cadherin expression compared to mammary terminal end buds from MMTV/CR-1 mammary glands treated with control pellets. However, immunohistochemical analysis showed poor expression for vimentin in the mammary glands analyzed from both the Netrin-1-treated and control MMTV/CR-1 transgenic mice. This latter observation may be due to the fact that hyperplastic lesions and mammary tumors in which EMT markers, including vimentin, are overexpressed were identified in aged, multiparous mice (Strizzi et al., 2004
). In the present study, the Netrin-1 pellets were implanted in virgin 5-week-old MMTV/CR-1 mice and mammary glands were harvested shortly after, suggesting that prolonged exposure of mammary epithelial cells to CR-1 effect is probably needed in order to induce changes in vimentin expression. The increased invasion and migration in epithelial cells is also a major characteristic of Cripto-1-induced EMT. Netrin-1 was capable of reducing Cr-1-dependent invasion and migration of mammary epithelial cells both in vitro and in vivo. As increased expression of Cripto-1 has been detected in a number of human cancers, including breast cancer, it will be informative to investigate the exact relationship between Netrin-1 and Cripto-1 expression in these tumors.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Arakawa, H. (2004). Netrin-1 and its receptors in tumorigenesis. Nat. Rev. Cancer 4, 978-987.[CrossRef][Medline]
Berx, G., Becker, K. F., Hofler, H. and van Roy, F. (1998). Mutations of the human E-cadherin (CDH1) gene. Hum. Mutat. 12, 226-237.[CrossRef][Medline]
Bianco, C., Adkins, H. B., Wechselberger, C., Seno, M., Normanno, N., De Luca, A., Sun, Y., Khan, N., Kenney, N., Ebert, A. et al. (2002). Cripto-1 activates nodal- and ALK4-dependent and -independent signaling pathways in mammary epithelial cells. Mol. Cell. Biol. 22, 2586-2597.
Bianco, C., Strizzi, L., Rehman, A., Normanno, N., Wechselberger, C., Sun, Y., Khan, N., Hirota, M., Adkins, H., Williams, K. et al. (2003). A Nodal- and ALK4-independent signaling pathway activated by Cripto-1 through Glypican-1 and c-Src. Cancer Res. 63, 1192-1197.
Birchmeier, C., Birchmeier, W. and Brand-Saberi, B. (1996a). Epithelial-mesenchymal transitions in cancer progression. Acta Anat (Basel) 156, 217-226.[Medline]
Birchmeier, W., Behrens, J., Weidner, K. M., Hulsken, J. and Birchmeier, C. (1996b). Epithelial differentiation and the control of metastasis in carcinomas. Curr. Top. Microbiol. Immunol. 213, 117-135.[Medline]
Boyer, B., Valles, A. M. and Edme, N. (2000). Induction and regulation of epithelial-mesenchymal transitions. Biochem. Pharmacol. 60, 1091-1099.[CrossRef][Medline]
Brandt, R., Normanno, N., Gullick, W. J., Lin, J. H., Harkins, R., Schneider, D., Jones, B. W., Ciardiello, F., Persico, M. G., Armenante, F. et al. (1994). Identification and biological characterization of an epidermal growth factor-related protein: cripto-1. J. Biol. Chem. 269, 17320-17328.
Butler, S. J. and Dodd, J. (2003). A role for BMP heterodimers in roof plate-mediated repulsion of commissural axons. Neuron 38, 389-401.[CrossRef][Medline]
Cano, A., Perez-Moreno, M. A., Rodrigo, I., Locascio, A., Blanco, M. J., del Barrio, M. G., Portillo, F. and Nieto, M. A. (2000). The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat. Cell. Biol. 2, 76-83.[CrossRef][Medline]
Cavallaro, U. and Christofori, G. (2004). Multitasking in tumor progression: signaling functions of cell adhesion molecules. Ann. New York Acad. Sci. 1014, 58-66.[CrossRef][Medline]
Charron, F., Stein, E., Jeong, J., McMahon, A. P. and Tessier-Lavigne, M. (2003). The morphogen sonic hedgehog is an axonal chemoattractant that collaborates with netrin-1 in midline axon guidance. Cell 113, 11-23.[CrossRef][Medline]
Chisholm, A. and Tessier-Lavigne, M. (1999). Conservation and divergence of axon guidance mechanisms. Curr. Opin. Neurobiol. 9, 603-615.[CrossRef][Medline]
Ciccodicola, A., Dono, R., Obici, S., Simeone, A., Zollo, M. and Persico, M. G. (1989). Molecular characterization of a gene of the `EGF family' expressed in undifferentiated human NTERA2 teratocarcinoma cells. EMBO J. 8, 1987-1991.[Medline]
De Santis, M. L., Kannan, S., Smith, G. H., Seno, M., Bianco, C., Kim, N., Martinez-Lacaci, I., Wallace-Jones, B. and Salomon, D. S. (1997). Cripto-1 inhibits beta-casein expression in mammary epithelial cells through a p21ras-and phosphatidylinositol 3'-kinase-dependent pathway. Cell Growth Differ. 8, 1257-1266.[Abstract]
Dickson, B. J. and Keleman, K. (2002). Netrins. Curr. Biol. 12, R154-R155.[CrossRef][Medline]
Ebert, A. D., Wechselberger, C., Frank, S., Wallace-Jones, B., Seno, M., Martinez-Lacaci, I., Bianco, C., De Santis, M., Weitzel, H. K. and Salomon, D. S. (1999). Cripto-1 induces phosphatidylinositol 3'-kinase-dependent phosphorylation of AKT and glycogen synthase kinase 3beta in human cervical carcinoma cells. Cancer Res. 59, 4502-4505.
Ebert, A. D., Wechselberger, C., Nees, M., Clair, T., Schaller, G., Martinez-Lacaci, I., Wallace-Jones, B., Bianco, C., Weitzel, H. K. and Salomon, D. S. (2000). Cripto-1-induced increase in vimentin expression is associated with enhanced migration of human Caski cervical carcinoma cells. Exp. Cell Res. 257, 223-229.[CrossRef][Medline]
Engelkamp, D. (2002). Cloning of three mouse Unc5 genes and their expression patterns at mid-gestation. Mech. Dev. 118, 191-197.[CrossRef][Medline]
Frank, R., Adelmann-Grill, B. C., Herrmann, K., Haustein, U. F., Petri, J. B. and Heckmann, M. (1996). Transforming growth factor-beta controls cell-matrix interaction of microvascular dermal endothelial cells by downregulation of integrin expression. J. Invest. Dermatol. 106, 36-41.[CrossRef][Medline]
Fuchs, E. and Weber, K. (1994). Intermediate filaments: structure, dynamics, function, and disease. Annu. Rev. Biochem. 63, 345-382.[Medline]
Fuchs, I. B., Lichtenegger, W., Buehler, H., Henrich, W., Stein, H., Kleine-Tebbe, A. and Schaller, G. (2002). The prognostic significance of epithelial-mesenchymal transition in breast cancer. Anticancer Res. 22, 3415-3419.[Medline]
Gagliardi, G., Talbot, I. C., Northover, J. M. A., Warre, A., Stamp, G. W. H., Lalani, E.-N., Gullick, W. J. and Pignatelli, M. (1994). Immunolocalisation of cripto andamphiregulin in rectal cancer: correlation with prognosis. Int. J. Oncol. 4, 865-871.
Gilchrist, A. J., Meuser, R., Turchinsky, J., Shaw, A. R., Pasdar, M. and Dixon, W. T. (2002). Cell adhesion-mediated transformation of a human SCLC cell line is associated with the development of a normal phenotype. Exp. Cell Res. 276, 63-78.[CrossRef][Medline]
Gilles, C., Polette, M., Piette, J., Delvigne, A. C., Thompson, E. W., Foidart, J. M. and Birembaut, P. (1996). Vimentin expression in cervical carcinomas: association with invasive and migratory potential. J. Pathol. 180, 175-180.[CrossRef][Medline]
Gotzmann, J., Mikula, M., Eger, A., Schulte-Hermann, R., Foisner, R., Beug, H. and Mikulits, W. (2004). Molecular aspects of epithelial cell plasticity: implications for local tumor invasion and metastasis. Mutat. Res. 566, 9-20.[CrossRef][Medline]
Hajra, K. M., Chen, D. Y. and Fearon, E. R. (2002). The SLUG zinc-finger protein represses E-cadherin in breast cancer. Cancer Res. 62, 1613-1618.
Hanna, W., Alowami, S. and Malik, A. (2003). The role of HER-2/neu oncogene and vimentin filaments in the production of the Paget's phenotype. Breast J. 9, 485-490.[CrossRef][Medline]
Hinck, L. (2004). The versatile roles of "axon guidance" cues in tissue morphogenesis. Dev. Cell 7, 783-793.[CrossRef][Medline]
Hong, K., Hinck, L., Nishiyama, M., Poo, M. M., Tessier-Lavigne, M. and Stein, E. (1999). A ligand-gated association between cytoplasmic domains of UNC5 and DCC family receptors converts netrin-induced growth cone attraction to repulsion. Cell 97, 927-941.[CrossRef][Medline]
Jiang, Y., Liu, M. T. and Gershon, M. D. (2003). Netrins and DCC in the guidance of migrating neural crest-derived cells in the developing bowel and pancreas. Dev. Biol. 258, 364-384.[CrossRef][Medline]
Keino-Masu, K., Masu, M., Hinck, L., Leonardo, E. D., Chan, S. S., Culotti, J. G. and Tessier-Lavigne, M. (1996). Deleted in Colorectal Cancer (DCC) encodes a netrin receptor. Cell 87, 175-185.[CrossRef][Medline]
Kennedy, T. E., Serafini, T., de la Torre, J. R. and Tessier-Lavigne, M. (1994). Netrins are diffusible chemotropic factors for commissural axons in the embryonic spinal cord. Cell 78, 425-435.[CrossRef][Medline]
Kenney, N. J., Huang, R. P., Johnson, G. R., Wu, J. X., Okamura, D., Matheny, W., Kordon, E., Gullick, W. J., Plowman, G., Smith, G. H. et al. (1995). Detection and location of amphiregulin and Cripto-1 expression in the developing postnatal mouse mammary gland. Mol. Reprod. Dev. 41, 277-286.[CrossRef][Medline]
Koch, M., Murrell, J. R., Hunter, D. D., Olson, P. F., Jin, W., Keene, D. R., Brunken, W. J. and Burgeson, R. E. (2000). A novel member of the netrin family, beta-netrin, shares homology with the beta chain of laminin: identification, expression, and functional characterization. J. Cell Biol. 151, 221-234.
Kolodkin, A. L., Matthes, D. J. and Goodman, C. S. (1993). The semaphorin genes encode a family of transmembrane and secreted growth cone guidance molecules. Cell 75, 1389-1399.[CrossRef][Medline]
Kuniyasu, H., Yoshida, K., Yokozaki, H., Yasui, W., Ito, H., Toge, T., Ciardiello, F., Persico, M. G., Saeki, T., Salomon, D. S. et al. (1991). Expression of cripto, a novel gene of the epidermal growth factor family, in human gastrointestinal carcinomas. Jpn. J. Cancer Res. 82, 969-973.
Kuniyasu, H., Yasui, W., Akama, Y., Akagi, M., Tohdo, H., Ji, Z. Q., Kitadai, Y., Yokozaki, H. and Tahara, E. (1994). Expression of cripto in human gastric carcinomas: an association with tumor stage and prognosis. J. Exp. Clin. Canc. Res. 13, 151-157.
Lane, E. B., Hogan, B. L., Kurkinen, M. and Garrels, J. I. (1983). Co-expression of vimentin and cytokeratins in parietal endoderm cells of early mouse embryo. Nature 303, 701-704.[CrossRef][Medline]
Latil, A., Chene, L., Cochant-Priollet, B., Mangin, P., Fournier, G., Berthon, P. and Cussenot, O. (2003). Quantification of expression of netrins, slits and their receptors in human prostate tumors. Int. J. Cancer 103, 306-315.[CrossRef][Medline]
Lee, J. W. and Juliano, R. (2004). Mitogenic signal transduction by integrin- and growth factor receptor-mediated pathways. Mol. Cell. 17, 188-202.
Leonardo, E. D., Hinck, L., Masu, M., Keino-Masu, K., Ackerman, S. L. and Tessier-Lavigne, M. (1997). Vertebrate homologues of C. elegans UNC-5 are candidate netrin receptors. Nature 386, 833-838.[CrossRef][Medline]
Liu, Y., Stein, E., Oliver, T., Li, Y., Brunken, W. J., Koch, M., Tessier-Lavigne, M. and Hogan, B. L. (2004). Novel role for Netrins in regulating epithelial behavior during lung branching morphogenesis. Curr. Biol. 14, 897-905.[CrossRef][Medline]
Lu, X., Le Noble, F., Yuan, L., Jiang, Q., De Lafarge, B., Sugiyama, D., Breant, C., Claes, F., De Smet, F., Thomas, J. L. et al. (2004). The netrin receptor UNC5B mediates guidance events controlling morphogenesis of the vascular system. Nature 432, 179-186.[CrossRef][Medline]
Meyerhardt, J. A., Caca, K., Eckstrand, B. C., Hu, G., Lengauer, C., Banavali, S., Look, A. T. and Fearon, E. R. (1999). Netrin-1: interaction with deleted in colorectal cancer (DCC) and alterations in brain tumors and neuroblastomas. Cell Growth Differ. 10, 35-42.
Minchiotti, G., Parisi, S., Liguori, G., Signore, M., Lania, G., Adamson, E. D., Lago, C. T. and Persico, M. G. (2000). Membrane-anchorage of Cripto protein by glycosylphosphatidylinositol and its distribution during early mouse development. Mech. Dev. 90, 133-142.[CrossRef][Medline]
Normanno, N., De Luca, A., Bianco, C., Maiello, M. R., Carriero, M. V., Rehman, A., Wechselberger, C., Arra, C., Strizzi, L., Sanicola, M. et al. (2004). Cripto-1 overexpression leads to enhanced invasiveness and resistance to anoikis in human MCF-7 breast cancer cells. J. Cell Physiol. 198, 31-39.[CrossRef][Medline]
Panico, L., D'Antonio, A., Salvatore, G., Mezza, E., Tortora, G., De Laurentiis, M., De Placido, S., Giordano, T., Merino, M., Salomon, D. S. et al. (1996). Differential immunohistochemical detection of transforming growth factor alpha, amphiregulin and CRIPTO in human normal and malignant breast tissues. Int. J. Cancer 65, 51-56.[CrossRef][Medline]
Park, K. W., Crouse, D., Lee, M., Karnik, S. K., Sorensen, L. K., Murphy, K. J., Kuo, C. J. and Li, D. Y. (2004). The axonal attractant Netrin-1 is an angiogenic factor. Proc. Natl. Acad. Sci. USA 101, 16210-16215.
Perez-Pomares, J. M. and Munoz-Chapuli, R. (2002). Epithelial-mesenchymal transitions: a mesodermal cell strategy for evolutive innovation in Metazoans. Anat. Rec. 268, 343-351.[CrossRef][Medline]
Puschel, A. W. (1999). Semaphorins: repulsive guidance molecules show their attractive side. Nat. Neurosci. 2, 777-778.[CrossRef][Medline]
Qi, C. F., Liscia, D. S., Normanno, N., Merlo, G., Johnson, G. R., Gullick, W. J., Ciardiello, F., Saeki, T., Brandt, R., Kim, N. et al. (1994). Expression of transforming growth factor alpha, amphiregulin and cripto-1 in human breast carcinomas. Br. J. Cancer 69, 903-910.[Medline]
Rajagopalan, S., Deitinghoff, L., Davis, D., Conrad, S., Skutella, T., Chedotal, A., Mueller, B. K. and Strittmatter, S. M. (2004). Neogenin mediates the action of repulsive guidance molecule. Nat. Cell Biol. 6, 756-762.[CrossRef][Medline]
Salomon, D. S., Bianco, C., Ebert, A. D., Khan, N. I., De Santis, M., Normanno, N., Wechselberger, C., Seno, M., Williams, K., Sanicola, M. et al. (2000). The EGF-CFC family: novel epidermal growth factor-related proteins in development and cancer. Endocr. Relat. Cancer 7, 199-226.[Abstract]
Savagner, P. (2001). Leaving the neighborhood: molecular mechanisms involved during epithelial-mesenchymal transition. BioEssays 23, 912-923.[CrossRef][Medline]
Serafini, T., Kennedy, T. E., Galko, M. J., Mirzayan, C., Jessell, T. M. and Tessier-Lavigne, M. (1994). The netrins define a family of axon outgrowth-promoting proteins homologous to C. elegans UNC-6. Cell 78, 409-424.[CrossRef][Medline]
Serafini, T., Colamarino, S. A., Leonardo, E. D., Wang, H., Beddington, R., Skarnes, W. C. and Tessier-Lavigne, M. (1996). Netrin-1 is required for commissural axon guidance in the developing vertebrate nervous system. Cell 87, 1001-1014.[CrossRef][Medline]
Srinivasan, K., Strickland, P., Valdes, A., Shin, G. C. and Hinck, L. (2003). Netrin-1/neogenin interaction stabilizes multipotent progenitor cap cells during mammary gland morphogenesis. Dev. Cell 4, 371-382.[CrossRef][Medline]
Strizzi, L., Bianco, C., Normanno, N., Seno, M., Wechselberger, C., Wallace-Jones, B., Khan, N. I., Hirota, M., Sun, Y., Sanicola, M. et al. (2004). Epithelial mesenchymal transition is a characteristic of hyperplasias and tumors in mammary gland from MMTV-Cripto-1 transgenic mice. J. Cell Physiol. 201, 266-276.[CrossRef][Medline]
Thiebault, K., Mazelin, L., Pays, L., Llambi, F., Joly, M. O., Scoazec, J. Y., Saurin, J. C., Romeo, G. and Mehlen, P. (2003). The netrin-1 receptors UNC5H are putative tumor suppressors controlling cell death commitment. Proc. Natl. Acad. Sci. USA 100, 4173-4178.
Thiery, J. P. (2003a). Cell adhesion in development: a complex signaling network. Curr. Opin. Genet. Dev. 13, 365-371.[CrossRef][Medline]
Thiery, J. P. (2003b). Epithelial-mesenchymal transitions in development and pathologies. Curr. Opin. Cell Biol. 15, 740-746.[CrossRef][Medline]
Thiery, J. P. and Chopin, D. (1999). Epithelial cell plasticity in development and tumor progression. Cancer Metastasis Rev. 18, 31-42.[CrossRef][Medline]
Van Roy, F. and Mareel, M. (1992). Tumour invasion: effects of cell adhesion and motility. Trends Cell Biol. 2, 163-169.[CrossRef][Medline]
Vincent-Salomon, A. and Thiery, J. P. (2003). Host microenvironment in breast cancer development: epithelial-mesenchymal transition in breast cancer development. Breast Cancer Res. 5, 101-106.[CrossRef][Medline]
Vonderhaar, B. K. (1987). Local effects of EGF, alpha-TGF, and EGF-like growth factors on lobuloalveolar development of the mouse mammary gland in vivo. J. Cell Physiol. 132, 581-584.[CrossRef][Medline]
Wechselberger, C., Ebert, A. D., Bianco, C., Khan, N. I., Sun, Y., Wallace-Jones, B., Montesano, R. and Salomon, D. S. (2001). Cripto-1 enhances migration and branching morphogenesis of mouse mammary epithelial cells. Exp. Cell Res. 266, 95-105.[CrossRef][Medline]
Wechselberger, C., Strizzi, L., Kenney, N., Hirota, M., Sun, Y., Ebert, A., Orozco, O., Bianco, C., Khan, N., Wallace-Jones, B. et al. (2005). Human Cripto-1 overexpression in the mouse mammary gland results in the development of hyperplasia and adenocarcinoma. Oncogene 24, 4094-4105.[Medline]
Williams, M. E., Wu, S. C., McKenna, W. L. and Hinck, L. (2003). Surface expression of the netrin receptor UNC5H1 is regulated through a protein kinase C-interacting protein/protein kinase-dependent mechanism. J. Neurosci. 23, 11279-11288.
Xue, C., Plieth, D., Venkov, C., Xu, C. and Neilson, E. G. (2003). The gatekeeper effect of epithelial-mesenchymal transition regulates the frequency of breast cancer metastasis. Cancer Res. 63, 3386-3394.
Yebra, M., Montgomery, A. M., Diaferia, G. R., Kaido, T., Silletti, S., Perez, B., Just, M. L., Hildbrand, S., Hurford, R., Florkiewicz, E. et al. (2003). Recognition of the neural chemoattractant Netrin-1 by integrins alpha6beta4 and alpha3beta1 regulates epithelial cell adhesion and migration. Dev. Cell 5, 695-707.[CrossRef][Medline]
Yeo, C. and Whitman, M. (2001). Nodal signals to Smads through Cripto-dependent and Cripto-independent mechanisms. Mol. Cell 7, 949-957.[CrossRef][Medline]
Yoshikawa, S., McKinnon, R. D., Kokel, M. and Thomas, J. B. (2003). Wnt-mediated axon guidance via the Drosophila Derailed receptor. Nature 422, 583-588.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
M. Dakouane-Giudicelli, C. Duboucher, J. Fortemps, H. Missey-Kolb, D. Brule, Y. Giudicelli, and P. de Mazancourt Characterization and Expression of Netrin-1 and Its Receptors UNC5B and DCC in Human Placenta J. Histochem. Cytochem., January 1, 2010; 58(1): 73 - 82. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mancino, C. Esposito, K. Watanabe, T. Nagaoka, M. Gonzales, C. Bianco, N. Normanno, D. S. Salomon, and L. Strizzi Neuronal Guidance Protein Netrin-1 Induces Differentiation in Human Embryonal Carcinoma Cells Cancer Res., March 1, 2009; 69(5): 1717 - 1721. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||