|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 15 November 2005
doi: 10.1242/jcs.02655
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
1 Departments of Pathology and of Cell Biology and Physiology, University of Pittsburgh and Veteran's Affairs Medical Center, Pittsburgh, PA 15243, USA
2 Mount Sinai Bone Program, Department of Medicine, Mount Sinai School of Medicine, New York, NY 10029, USA
* Author for correspondence (e-mail: hcblair{at}imap.pitt.edu)
Accepted 22 August 2005
| Summary |
|---|
|
|
|---|
vß3 integrin ring. NO has been implicated in the regulation of bone turnover due to stretch or via estrogen signals, but a specific mechanism linking NO to osteoclastic activity has not been described. NO stimulates osteoclast motility, and at high concentrations NO causes detachment and terminates resorption. Here we demonstrate that NO regulates attachment through the cGMP-dependent protein kinase I (PKG I) via phosphorylation of the intermediate protein VASP. VASP colocalized with the
vß3 ring in stationary cells, but alternating bands of VASP and
vß3 occurred when motility was induced by NO donors or cGMP. Redistribution of VASP correlated with its phosphorylation. Dependency of NO-induced motility on PKG I and on VASP was shown by siRNA knockdown of each protein. VASP knockdown also altered distribution of
vß3 at the attachment site. We conclude that PKG I and VASP are essential for reorganization of attachment and cytoplasmic proteins in motility induced by NO or by cGMP.
Key words: Osteoclast, Nitric oxide, Cyclic GMP-dependent protein kinase I, Integrin, Vasodilator-stimulated phosphoprotein, Migfilin
| Introduction |
|---|
|
|
|---|
NO is a membrane-permeant gas that acts by stimulating kinase activity or ionic (often Ca2+) channels. The primary receptor is typically a guanylyl cyclase that converts GTP into cGMP. The cyclase is a heterodimer of
70 kDa subunits and includes an NO-reactive heme group (Lincoln and Cornwell, 1993
; Hofmann et al., 2000
). If it does not react with a specific target such as the heme group of guanylyl cyclase, NO decays in milliseconds to produce the free radical NO* and peroxynitrite, which also produce physiological effects. In the osteoclast, whether free radical or cGMP-mediated pathways are predominant is controversial. A series of studies showed that peroxynitrite metabolites of NO inhibit bone resorption (MacIntyre et al., 1991
; Mancini et al., 1998
), although there are also data supporting a cGMP-related mechanism (Van Epps-Fung et al., 1994
; Mancini et al., 2000
; Yaroslavskiy et al., 2004
). Although it is not clear to what extent the free radical and cGMP pathways operate, the pathways are not mutually exclusive, and several studies have found biphasic responses. This suggests that NO may support cell activity at low concentrations but cause apoptosis at higher concentrations (van't Hof and Ralston, 1997
; Brandi et al., 1995
), where free radical reactions would be more likely.
Our purpose in this study is to determine mechanisms involved in the osteoclast activity cycle under conditions with continuing cellular activity, in particular to determine whether osteoclast motility and activity are regulated by cGMP-dependent protein kinase activity or by alternative mechanisms such as peroxynitrite reactions that are independent of cGMP. There are two cGMP-dependent protein kinases; they are both found in bone and these kinases are the predominant proteins activated by cGMP (Lincoln and Cornwell, 1993
). PKG I (78 kDa) is found in mature bone, and particularly in the osteoclast (Van Epps-Fung et al., 1994
); PKG II (86 kDa) is expressed in chondrocytes and is vital to skeletal development (Miyazawa et al., 2002
). PKG I has two isoforms, transcribed from the same gene, differing only in the first exon. It acts as a dimer (Lincoln et al., 1993
), activated by cGMP at 0.05-1.00 µM, but responding to cAMP at
20-fold higher concentrations. The cGMP-dependent protein kinases recognize R/K-R/K-X-S/T sites that overlap with cAMP-dependent protein kinase substrates, but many consensus sites are not phosphorylated and there are many atypical phosphorylation sites (Lincoln and Cornwell, 1993
).
Our work regarding the effects of NO on osteoclasts at concentrations permitting cell survival pointed to a probable primary effect on cell attachment (Yaroslavskiy et al., 2004
). This is in keeping with work in other organs showing that actin- and integrin-linked adhesion protein complexes respond to PKG I. Investigation of the role of focal adhesions in the regulation of platelets and endothelial cells led to the discovery of the vasodilator-stimulated phosphoprotein (VASP), a key element in complexes of intermediate proteins. VASP is phosphorylated by PKG I at Ser239 (Meinecke et al., 1994
; Butt et al., 1994
; Reinhard et al., 1995b
) and the phosphorylated protein can be identified with a monoclonal antibody (Smolenski et al., 1998
). Preliminary analysis of human osteoclasts suggested that VASP was abundantly expressed. Thus, we hypothesized that, in the osteoclast, NO-induced motility is initiated by cGMP activating PKG I and PKG I modifying the complex ring-like integrin attachment and attached cytoskeletal structure via VASP. This was studied by immunolocalization and immunoprecipitation of key proteins, by micro-cinematography of osteoclast motility, and by cellular response after siRNA suppression of key proteins in the putative pathway. The studies support a role for NO in initiating motility by a mechanism in which PKG I and VASP are essential, with VASP allowing the cell to organize cytoskeletal complexes that include or exclude
vß3 depending on the VASP phosphorylation state.
| Materials and Methods |
|---|
|
|
|---|
Osteoclasts
Human cells were from citrate-anticoagulated blood, obtained with approval of the institutional review board. Mononuclear cells were recovered on ficoll; CD14+ cells were enriched using anti-CD14-magnetic microbeads (Miltenyi Biotec, Auburn CA) (Blair et al., 2004
). The CD14+ cells were plated at 1x106/cm2 with human CSF-1, 25 ng/ml and human RANKL, 30 ng/ml, on tissue culture substrate (glass or plastic) or on dentine slices, for 16-21 days, to generate osteoclasts. Motility comparisons also used rat osteoclasts, produced by lavage of tibial bone as described (Zaidi et al., 1992
).
Antibodies and in situ labeling
Anti-
vß3 was monoclonal anti-human clone 23C6 from Santa Cruz (Santa Cruz, CA), used at 1:50 for in situ labeling; Anti-
v (Santa Cruz) was used for blots at 1:200. Anti-filamin monoclonal MAB1678 was from Chemicon (Temecula, CA), used at 1:3000. Anti-migfilin monoclonal, as described (Tu et al., 2003
), was used at 1:500. Anti-PKG rabbit anti-human PKG I (Stressgen; Victoria BC), was used at 1:1000 for western blots and 1:500 for in situ localization. Rabbit anti-human VASP (Calbiochem) was used at 1:500 for in situ labeling or blots, or 1:125 for immunoprecipitation. Anti-p-VASP Ser239 clone 16C2 (Upstate, Lake Placid, NY) was used at 2 µg/ml for blots or 20 µg/ml to label cells in situ. Anti-vinculin (Santa Cruz) was used at 1:200 for western blots. Anti-zyxin (BD Biosciences, San Jose, CA) was used at 1:250 for in situ labeling and 1:2500 for blots. Secondary antibodies were Al-488-conjugated goat anti-mouse (Molecular Probes) at 1:500, Cy-3-conjugated goat anti-mouse (Jackson Labs, West Grove, PA) at 1:500, or goat anti-mouse or rabbit-HRP (Bio-Rad, Hercules CA) at 1:10,000. In situ labeling was carried out as described (Yaroslavskiy et al., 2004
), with cells fixed in 1% paraformaldehyde on ice for 25 minutes. Permeabilization used 0.25% Triton X-100 and 40 µg/ml digitonin for 5 minutes. Wash solutions included 0.5% bovine serum albumin and 2% nonimmune serum to reduce nonspecific reactions. Primary antibody reactions and labeling reactions were each carried out for 1 hour at room temperature unless specified.
Western analysis and immunoprecipitation
Cells were lysed in 0.5% polyglycol ether (NP-40, Sigma) with phosphatase and proteinase inhibitors. Proteins were separated using Laemmli buffers using 9% polyacrylamide gels, and transferred to polyvinylidine membranes for immunolabeling (Yaroslavskiy et al., 2004
). For immunoprecipitation, lysates were centrifuged to remove debris and pre-cleared with protein A/G plus (Santa Cruz). Lysates were incubated overnight at 4°C with antibody, and bound proteins were recovered using protein A/G agarose (Miltenyi Biotech, Auburn, CA) by centrifugation after a 2 hour incubation. The precipitated beads were washed five times and eluted in lysis buffer for western blots. Where blots were reprobed, they were stripped of antibodies using Restore (Pierce, Rockford IL). Blots were developed using enhanced chemiluminescence ECL (Amersham, Piscataway, NJ).
siRNAs
Cells were transfected with siRNA targeting two PKG I sequences or four VASP sequences, using mock transfection with scrambled sequence (noncoding) siRNA in controls. siRNAs were labeled with Cy3 for demonstration of transfection efficiency. Target sequences were 21 bp stretches in early exons starting with AA, with G/C content less than 60%. These were screened to eliminate homology to other proteins using BLAST (www.ncbi.nlm.nih.gov/BLAST). For PKG I (GenBank accession number Z92867), target sequences were (+109 from the start codon) AAGAGGAAACTCCACAAATGC and (+124) AAATGCCAGCGGTGCTCCCAGT. For VASP (accession number Z46389) target sequences were (+121) AACCCCACGGCCAATTCCTTT; (+274) AACTTCGGCAGCAAGGAGGAT; (+700) AAACTCAGGAAAGTCAGCAAG; and (+847) AAAACCCCCAAGGATGAATCT. From these sequences, siRNA 29-mer oligonucleotides (sense and antisense) were manufactured (Integrated DNA Technologies, Coralville, IA) with the 8 bp leader sequence complementary to the T7 promoter primer. Templates were hybridized to T7 promoter primers and extended with Klenow DNA polymerase. The double-stranded template was transcribed by T7 RNA polymerase and the transcripts were hybridized to create dsRNA. RNA was digested to remove the single-strand leaders, resulting in ds-siRNA. Transfection used mixtures of siRNAs with 100 nM total siRNA (50 nM each of two siRNAs for PKG, 25 nM each of four for VASP). To determine transfection efficiency, Cy3 was covalently attached to the duplex siRNA (Silencer siRNA labeling kit, Ambion, Austin, TX). Cells were transfected with siRNA using siPORT Amine transfection reagent (Ambion), a blend of polyamines.
Image acquisition and motility
Images were obtained on a Nikon TE2000 inverted phase-fluorescence microscope equipped with a 37°C stage heater, using a 12-bit 1600x1200 pixel monochrome CCD camera (Spot, Diagnostic Instruments, Sterling Heights, MI); color where shown reflects filter color. Filters for green fluorescence were: excitation 450-490 nm, 510 nm dichroic mirror, 520 nm barrier filter; and for red fluorescence: excitation 536-556 nm, 580 nm dichroic mirror, 590 nm barrier filter. For phase-contrast photomicrographs of living cells a NA 0.95 long working distance 40x objective was used; fluorescence-labeled proteins were photographed using 1.3 NA 40x or 100x oil objectives. Cell movement was studied by time-lapse microcinematography with movement determined by difference in location between frames, as described (Yaroslavskiy et al., 2004
; Zaidi et al., 1992
; Bear et al., 2002
).
| Results |
|---|
|
|
|---|
|
1 hour (Fig. 1A, top panel). In contrast, in the presence of a cGMP donor, osteoclasts spent more time in a rounded morphology, and typically moved approximately one-half of the cell diameter in 30 minutes (Fig. 1A, bottom panel). This motion had no apparent direction, but included back and forth or circular motion with periods of 0.5-1 hour. This, and comparison of motion after cGMP agonist and an NO donor, which were essentially the same, are shown as Movie 1 in supplementary material. Response in the rate of change of osteoclast area was within 5 minutes (Fig. 1B). The mechanism modifying cell attachment was unknown, but we had established that NO-induced detachment correlated with integrin rearrangement (Yaroslavskiy et al., 2004
cGMP-induced motility separates VASP and
vß3
Non-amplified mRNA gene screening showed that the PKG-I-modified protein VASP was expressed in osteoclasts (not shown). In platelet or endothelial cell response to NO, VASP rearranges the integrin-associated cytoskeleton, which regulates endothelial cell retraction or platelet adhesion. As these NO responses are distinctly different from osteoclast motility, we queried whether osteoclast VASP plays a role in the integrin-cytoskeletal arrangement that may initiate motion. We examined VASP and
vß3 distribution in human osteoclasts. Osteoclast VASP overlapped on the integrin ring when PKG I was inactive (Fig. 2A,C). Activating cGMP analogs, which induce motility, led to a separation of the labels (red and green bands, Fig. 2A,D), whether cells were on (Fig. 2A,B) or off bone (Fig. 2C,D). In motile cells, separation of the integrin and VASP labels was consistent in images of numerous cells.
|
PKG I knockdown eliminates motility in response to cGMP
We studied dependency of the NO motility on the cGMP-dependent protein kinase I by siRNA knockdown. This is crucial to the PKG-I-VASP motility hypothesis versus possible free radical mechanisms, because free radical reactions are not mediated by cGMP (MacIntyre et al., 1991
). When PKG I was eliminated, effects of NO on motility were effectively eliminated (Fig. 3). Western blotting showed that control cells transfected with noncoding siRNA, but not cells transfected with siRNA targeting PKG I, expressed the enzyme. Motility after cGMP activation was monitored by time-lapse photography (as in Fig. 1) using cells 48 hours after transfection. Osteoclasts transfected with noncoding siRNA had good motility whereas <10% of cells transfected with siRNA targeting PKG I moved measurably. Non-motile PKG I knockdown cells did spread slightly (inset, Fig. 3B). The small number of motile cells was consistent with the number of nontransfected cells, determined by Cy3 labeling of siRNAs (not shown). In osteoclasts on bone slices transfected with siRNA PKG-Cy3, actin distribution resembled that in cells treated with cGMP blockers (Fig. 3C).
|
|
vß3 was precipitated mainly by nonphosphorylated VASP, in keeping with the immunolocalization results. Migfilin, which secondarily organizes proteins including adhesion-related kinases, was precipitated strongly when VASP was activated, but was barely detectible in precipitates with blocking cGMP analogs. Migfilin regulates cytoplasmic connections at cell-matrix adhesions for actin remodeling (Tu et al., 2003
|
VASP knockdown impairs organization of the attachment site and prevents motility
The results to this point were consistent with a role for VASP in mediating rearrangement of the osteoclast cytoskeleton during motility. However, there are many actin-organizing proteins and redundant mechanisms often regulate important processes such as motility. Thus, these data were not sufficient to demonstrate that VASP is necessary for detachment or motility in response to NO or cGMP. Therefore, we performed siRNA gene silencing targeting VASP. Reduction of VASP protein (Fig. 6A) allowed cells to attach but modified the appearance of the actin ring. There were complex changes in the appearance of the cell attachment and the cells no longer responded to cGMP stimulation (Fig. 6B, right panel). These changes suggest that VASP may function in attachment aside from the response to NO/cGMP. This is not unexpected, as VASP is an intermediate protein with multiple domains, but further investigation of VASP in osteoclast cytoskeletal organization is beyond the scope of this work. However, in keeping with a central role of VASP in the NO/cGMP response, motility in response to cGMP activation was effectively eliminated in VASP-knockdown cells (Fig. 6C).
|
| Discussion |
|---|
|
|
|---|
vß3 integrin heterodimer, which is directly linked to matrix degradation (Ross et al., 1993
vß3 and actin, which is tied directly to NO or cGMP-induced detachment (Yaroslavskiy et al., 2004
The vasodilator-stimulated phosphoprotein, VASP modifies actin organization and is a key PKG I target linked to integrin attachments; VASP was discovered in the circulatory system and has also been shown to regulate platelet aggregation (Meinecke et al., 1994
; Butt et al., 1994
; Reinhard et al., 1995b
; Smolenski et al., 1998
). VASP is widely distributed and involved in intracellular movement including macrophage phagocytosis (Coppolino et al., 2001
), but VASP in osteoclasts had not been studied. We found mRNA for VASP in osteoclasts on gene screens and verified its presence by immunolocalization, western blotting and immunoprecipitation. We showed by motility studies after siRNA knockdown of PKG I and VASP that a NO/cGMP/PKG I/VASP pathway exists in the osteoclast, and that this is required for NO or cGMP-dependent osteoclast motility.
VASP is a member of the Ena/VASP protein family, which regulates temporal and spatial control of actin-filament dynamics. These proteins localize to the sites of actin assembly, such as focal adhesion, membrane ruffles and neuronal growth cones. Ena/VASP protein structure is conserved with a proline-rich core flanked by EVH1 and EVH2 domains. The EVH1 domain is essential for targeting of Ena/VASP proteins to focal adhesions (Sanjay et al., 2001
; Niebuhr et al., 1997
). The proline-rich region contains sites that bind to profilin (Ball et al., 2000
). The EVH2 domain also contains binding sites for actin; in vitro it induces actin filament nucleation, promotes filament bundling and mediates oligomerization (Reinhard et al., 1995a
; Walders-Harbeck et al., 1995
; Bachmann et al., 1999
).
VASP contains several Thr/Ser phosphorylation sites that modify its function and make it particularly important in cells with high cAMP or cGMP-dependent protein kinase activity. Active sites include Ser157 in the proline-rich region and Ser239 and Thr278 in the EVH2 domain (Butt et al., 1994
). Ser157 is phosphorylated preferentially by the cAMP-dependent protein kinase, whereas Ser239 is preferred by the cGMP-dependent protein kinase. The Ser239 site is of particular importance in cytoskeletal rearrangements mediated by NO and cGMP in other cells, and a specific monoclonal antibody has been developed to characterize its phosphorylation state. We used this antibody to study cGMP-dependent VASP phosphorylation in human osteoclasts, with results showing that VASP phosphorylation at this site occurs in the osteoclast in response to NO donors or cGMP. Under basal conditions, VASP was partially phosphorylated (Fig. 4). Phosphorylation and motility were greatly increased by strong cGMP activation, exceeding by far the level of motility during normal osteoclast activity, where cells make approximately one resorption pit per day. Very strong cGMP activation is also associated with nuclear PKG I localization and apoptosis, in keeping with changes observed with NO or cGMP stimuli in other studies (Brandi et al., 1995
; van't Hof and Ralston, 1997
; Mancini et al., 2000
). However, our data are most consistent with NO and cGMP being major regulators of osteoclast attachment and motility, with apoptosis requiring long periods of high-level stimulation.
Our studies demonstrate a requirement for VASP in cGMP-dependent osteoclast motility and provide clues as to the mechanism, but associations between osteoclast integrin attachment and motility will require further characterization. These include determination of the meaning of the sequential arcs of VASP and
vß3 in motile osteoclasts. These may reflect sequential organization of membrane complexes during membrane spreading. Further study of the role of organizing protein migfilin will also be important. Migfilin is associated with VASP only when VASP is phosphorylated by PKG I (see Fig. 4). An additional caveat is that motility subsequent to VASP-mediated reorganization undoubtedly involves additional downstream steps. In particular, although VASP was essential for NO/cGMP induced motility, it remains uncertain how this mechanism is related to motility induced by other stimuli such as CSF-1 and integrin-associated kinases. Both CSF-1 and fms stimulate src and phosphoinositydyl-3-kinase (Insogna et al., 1997
; Pilkington et al., 1998
; Teti et al., 1998
; Grey et al., 2000
). The phosphoinositydyl-3-kinase is likely to be activated during NO-induced motility because integrin-related complexes are rearranged. The phosphoinositydyl-3-kinase mediates a calcium signal, so calcium signals are likely after VASP activation. Local increases in calcium were observed in NO- or cGMP-stimulated osteoclasts (data not shown). These could represent NO/cGMP effects via a calcium channel or secondary effects of integrin rearrangement. As integrin-related phosphoinositydyl-3-kinase-dependent calcium signals are established, an indirect downstream calcium signal is likely. On the other hand, although calcium causes retraction in human osteoclasts as in rat cells (Datta et al., 1989
), we have been unable to detach human osteoclasts with ionomycin or by increasing supernatant calcium to 20 mM (data not shown), suggesting that calcium cannot initiate detachment without a second signal, such as the NO/cGMP/PKG I/VASP pathway.
In conclusion, we demonstrate using time-lapse photography, immunolocalization, western analysis and siRNA gene knockdown that rapid motility in human osteoclasts induced by NO or cGMP depends on the cGMP-dependent protein kinase I and on the intermediate protein VASP. VASP is phosphorylated at Ser239 by the kinase in the osteoclasts just as it is modified by PKG I in endothelial cell relaxation. Downstream to VASP phosphorylation, the
vß3 integrin ring and other intermediate proteins, including migfilin, are redistributed. Redistribution of the attachment complex is highly likely to induce further attachment-related signals, which remain to be characterized.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Armour, K. E., Armour, K. J., Gallagher, M. E., Godecke, A., Helfrich, M. H., Reid, D. M. and Ralston, S. H. (2001). Defective bone formation and anabolic response to exogenous estrogen in mice with targeted disruption of endothelial nitric oxide synthase. Endocrinology 142, 760-766.
Bachmann, C., Fischer, L., Walter, U. and Reinhard, M. (1999). The EVH2 domain of the vasodilator-stimulated phosphoprotein mediates tetramerization, F-actin binding, and actin bundle formation. J. Biol. Chem. 274, 23549-23557.
Ball, L., Kuhne, J., R., Hoffmann, B., Hafner, A., Schmieder, P., Volkmer- Engert, R., Hof, M., Wahl, M., Schneider-Mergener, J., Walter, U., et al. (2000). Dual epitope recognition by the VASP EVH1 domain modulates polyproline ligand specificity and binding affinity. EMBO J. 19, 4903-4914.[CrossRef][Medline]
Bear, J. E., Svitkina, T. M., Krause, M., Schafer, D. A., Loureiro, J. J., Strasser, G. A., Maly, I., V, Chaga, O. Y., Cooper, J. A., Borisy, G. G., et al. (2002). Antagonism between Ena/VASP proteins and actin filament capping regulates fibroblast motility. Cell 109, 509-521.[CrossRef][Medline]
Blair, H. C., Zaidi, M. and Schlesinger, P. H. (2002). Mechanisms balancing skeletal matrix synthesis and degradation. Biochem. J. 364, 329-341.[CrossRef][Medline]
Blair, H. C., Borysenko, C. W., Villa, A., Schlesinger, P. H., Kalla, S. E., Yaroslavskiy, B. B., Garcia-Palacios, V., Oakley, J. I. and Orchard, P. J. (2004). In vitro differentiation of CD14 cells from osteopetrotic subjects: contrasting phenotypes with TCIRG1, CLCN7, and attachment defects. J. Bone Mineral Res. 19, 1329-1338.[CrossRef][Medline]
Brandi, M., Hukkanen, L. M., Umeda, T. N., Bianchi, S., Gross, S. S., Polak, J. M. and MacIntyre, I. (1995). Bidirectional regulation of osteoclast function by nitric oxide synthase isoforms. Proc. Natl. Acad. Sci. USA 92, 2954-2958.
Butt, E., Abel, K., Krieger, M., Palm, D., Hoppe, V., Hoppe, J. and Walter, U. (1994). cAMP- and cGMP-dependent protein kinase phosphorylation sites of the focal adhesion vasodilator-stimulated phosphoprotein (VASP) in vitro and in intact human platelets. J. Biol. Chem. 269, 14509-14517.
Coppolino, M., Krause, G. M., Hagendorff, P., Monner, D. A., Trimble, W., Grinstein, S., Wehland, J. and Sechi, A. S. (2001). Evidence for a molecular complex consisting of Fyb/SLAP, SLP-76, Nck, VASP and WASP that links the actin cytoskeleton to Fc
receptor signalling during phagocytosis. J. Cell Sci. 114, 4307-4318.
Datta, H. K., MacIntyre, I. and Zaidi, M. (1989). The effect of extracellular calcium elevation on morphology and function of isolated rat osteoclasts. Biosci. Rep. 9, 747-751.[CrossRef][Medline]
Dong, S.-S., Williams, J. P., Jordan, S. E., Cornwell, T. and Blair, H. C. (1999). Nitric oxide regulation of cGMP production in osteoclasts. J. Cell. Biochem. 73, 478-487.[CrossRef][Medline]
Grey, A., Chen, Y., Paliwal, I., Carlberg, K. and Insogna, K. (2000). Evidence for a functional association between phosphatidylinositol 3-kinase and c-src in the spreading response of osteoclasts to colony-stimulating factor-1. Endocrinology 141, 2129-2138.
Hofmann, F., Ammendola, A. and Schlossmann, J. (2000). Rising behind NO: cGMP-dependent protein kinases. J. Cell Sci. 113, 1671-1676.[Abstract]
Hukkanen, M., Platts, L. A., Lawes, T., Girgis, S. I., Konttinen, Y. T., Goodship, A. E., MacIntyre, I. and Polak, J. M. (2003). Effect of nitric oxide donor nitroglycerin on bone mineral density in a rat model of estrogen deficiency-induced osteopenia. Bone 32, 142-149.[Medline]
Insogna, K., Sahni, L. M., Grey, A. B., Tanaka, S., Horne, W. C., Neff, L., Mitnick, M., Levy, J. B. and Baron, R. (1997). Colony-stimulating factor-1 induces cytoskeletal reorganization and c-src-dependent tyrosine phosphorylation of selected cellular proteins in rodent osteoclasts. J. Clin. Invest. 100, 2476-2485.[Medline]
Jamal, S. A., Browner, W. S., Bauer, D. C. and Cummings, S. R. (1998). Intermittent use of nitrates increases bone mineral density: the study of osteoporotic fractures. J. Bone Mineral Res. 13, 1755-1759.[CrossRef][Medline]
Lincoln, T. M. and Cornwell, T. L. (1993). Intracellular cyclic GMP receptor proteins. FASEB J. 7, 328-338.[Abstract]
Lincoln, T. M., Pryzwansky, P., B, Cornwell, T. L., Wyatt, T. A. and MacMillan, L. A. (1993). cGMP-dependent protein kinase in smooth muscle and neutrophils. Adv. Second Messenger Phosphoprotein Res. 28, 121-132.[Medline]
MacIntyre, I., Zaidi, M., Alam, A. S., Datta, H. K., Moonga, B. S., Lidbury, P. S., Hecker, M. and Vane, J. R. (1991). Osteoclastic inhibition: an action of nitric oxide not mediated by cyclic GMP. Proc. Natl. Acad. Sci. USA 88, 2936-2940.
Mancini, L., Moradi-Bidhendi, N., Brandi, M. L. and MacIntyre, I. (1998). Nitric oxide superoxide and peroxynitrite modulate osteoclast activity. Biochem. Biophys. Res. Commun. 243, 785-790.[CrossRef][Medline]
Mancini, L., Moradi-Bidhendi, N., Becherini, L., Martineti, V. and MacIntyre, I. (2000). The biphasic effects of nitric oxide in primary rat osteoblasts are cGMP dependent. Biochem. Biophys. Res. Commun. 274, 477-481.[CrossRef][Medline]
Meinecke, M., Geiger, J., Butt, E., Sandberg, M., Jahnsen, T., Chakraborty, T., Walter, U., Jarchau, T. and Lohmann, S. M. (1994). Human cyclic GMP-dependent protein kinase I beta overexpression increases phosphorylation of an endogenous focal contact-associated vasodilator-stimulated phosphoprotein without altering the thrombin-evoked calcium response. Mol. Pharmacol. 46, 283-290.[Abstract]
Miyazawa, T., Ogawa, Y., Chusho, H., Yasoda, A., Tamura, N., Komatsu, Y., Pfeifer, A., Hofmann, F. and Nakao, K. (2002). Cyclic GMP-dependent protein kinase II plays a critical role in C-type natriuretic peptide-mediated endochondral ossification. Endocrinology 143, 3604-3610.
Niebuhr, K., Ebel, F., Frank, R., Reinhard, M., Domann, E., Carl, U. D., Walter, U., Gertler, F. B., Wehland, J. and Chakraborty, T. (1997). A novel proline-rich motif present in ActA of Listeria monocytogenes and cytoskeletal proteins is the ligand for the EVH1 domain, a protein module present in the Ena/VASP family. EMBO J. 16, 5433-5444.[CrossRef][Medline]
Nomura, S. and Takano-Yamamoto, T. (2000). Molecular events caused by mechanical stress in bone. Matrix Biol. 19, 91-96.[CrossRef][Medline]
Pilkington, M. F., Sims, S. M. and Dixon, S. J. (1998). Wortmannin inhibits spreading and chemotaxis of rat osteoclasts in vitro. J. Bone Mineral Res. 13, 688-694.[CrossRef][Medline]
Reinhard, M., Giehl, K., Abel, K., Haffner, C., Jarchau, T., Hoppe, V., Jockusch, B. M. and Walter, U. (1995a). The proline-rich focal adhesion and microfilament protein VASP is a ligand for profilins. EMBO J. 14, 1583-1589.[Medline]
Reinhard, M., Jouvenal, K., Tripier, D. and Walter, U. (1995b). Identification, purification, and characterization of a zyxin-related protein that binds the focal adhesion and microfilament protein VASP (vasodilator-stimulated phosphoprotein). Proc. Natl. Acad. Sci. USA 92, 7956-7960.
Ross, F. P., Chappel, J., Alvarez, J. I., Sander, D., Butler, W. T., Farach- Carson, M. C., Mintz, K. A., Robey, P. G., Teitelbaum, S. L. and Cheresh, D. A. (1993). Interactions between the bone matrix proteins osteopontin and bone sialoprotein and the osteoclast integrin
vß3 potentiate bone resorption. J. Biol. Chem. 268, 9901-9907.
Sanjay, A., Houghton, A., Neff, L., DiDomenico, E., Bardelay, C., Antoine, E., Levy, J., Gailit, J., Bowtell, D., Horne, W. C. et al. (2001). Cbl associates with Pyk2 and Src to regulate Src kinase activity,
vß3 integrin-mediated signaling, cell adhesion, and osteoclast motility. J. Cell Biol. 152, 181-195.
Smolenski, A., Bachmann, C., Reinhard, K., Honig-Liedl, P., Jarchau, T., Hoschuetzky, H. and Walter, U. (1998). Analysis and regulation of vasodilator-stimulated phosphoprotein serine 239 phosphorylation in vitro and in intact cells using a phosphospecific monoclonal antibody. J. Biol. Chem. 273, 20029-20035.
Teti, A., Taranta, A., Migliaccio, S., Degiorgi, A., Santandrea, E., Villanova, I., Faraggiana, T., Chellaiah, M. and Hruska, K. A. (1998). Colony stimulating factor-1-induced osteoclast spreading depends on substrate and requires the vitronectin receptor and the c-src proto-oncogene. J. Bone Mineral Res. 13, 50-58.[CrossRef][Medline]
Tu, Y., Wu, S., Shi, X., Chen, K. and Wu, C. (2003). Migfilin and Mig-2 link focal adhesions to filamin and the actin cytoskeleton and function in cell shape modulation. Cell 113, 37-47.[CrossRef][Medline]
Van Epps-Fung, C., Williams, J., Cornwell, T., Lincoln, T., McDonald, J. M., Radding, W. and Blair, H. C. (1994). Regulation of osteoclastic acid secretion by cGMP-dependent protein kinase. Biochem. Biophys. Res. Comm. 204, 565-571.[CrossRef][Medline]
van't Hof, R. J. and Ralston, S. H. (1997). Cytokine-induced nitric oxide inhibits bone resorption by inducing apoptosis of osteoclast progenitors and suppressing osteoclast activity. J. Bone Mineral Res. 12, 1797-1804.[CrossRef][Medline]
van't Hof, R. J. and Ralston, S. H. (2001). Nitric oxide and bone. Immunology 103, 255-261.[CrossRef][Medline]
Walders-Harbeck, B., Khaitlina, S. Y., Hinssen, H., Jockusch, B. M. and Illenberger, S. (1995). The vasodilator-stimulated phosphoprotein promotes actin polymerisation through direct binding to monomeric actin. FEBS Lett. 529, 275-280.
Yaroslavskiy, B. B., Li, Y., Ferguson, D. J. P., Kalla, S. E., Oakley, J. I. and Blair, H. C. (2004). Autocrine and Paracrine Nitric Oxide Regulate Attachment of Human Osteoclasts. J. Cell. Biochem. 91, 962-972.[CrossRef][Medline]
Zaidi, M., Alam, A. S., Shankar, V. S., Bax, B. E, Moonga, B. S., Bevis, P. J., Pazianas. M. and Huang. C. L. (1992). A quantitative description of components of in vitro morphometric change in the rat osteoclast model: relationships with cellular function. Eur. Biophys. J. 21, 349-355.[Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
S. K. Gupta and N. E. Vlahakis Integrin {alpha}9{beta}1 mediates enhanced cell migration through nitric oxide synthase activity regulated by Src tyrosine kinase J. Cell Sci., June 15, 2009; 122(12): 2043 - 2054. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-C. Maa, M. Y. Chang, Y.-J. Chen, C.-H. Lin, C. J. Yu, Y. L. Yang, J. Li, P.-R. Chen, C.-H. Tang, H.-Y. Lei, et al. Requirement of Inducible Nitric-oxide Synthase in Lipopolysaccharide-mediated Src Induction and Macrophage Migration J. Biol. Chem., November 14, 2008; 283(46): 31408 - 31416. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Lindsay, S. Ramsey, M. Aitchison, T. Renne, and T. J. Evans Modulation of lamellipodial structure and dynamics by NO-dependent phosphorylation of VASP Ser239 J. Cell Sci., September 1, 2007; 120(17): 3011 - 3021. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. B. Yaroslavskiy, A. C. Sharrow, A. Wells, L. J. Robinson, and H. C. Blair Necessity of inositol (1,4,5)-trisphosphate receptor 1 and {micro}-calpain in NO-induced osteoclast motility J. Cell Sci., August 15, 2007; 120(16): 2884 - 2894. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Wojciak-Stothard, B. Torondel, L. Y. F. Tsang, I. Fleming, B. Fisslthaler, J. M. Leiper, and P. Vallance The ADMA/DDAH pathway is a critical regulator of endothelial cell motility J. Cell Sci., March 15, 2007; 120(6): 929 - 942. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Kragtorp and J. R. Miller Regulation of somitogenesis by Ena/VASP proteins and FAK during Xenopus development Development, February 15, 2006; 133(4): 685 - 695. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||