spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online December 9, 2005
doi: 10.1242/10.1242/jcs.02701


Journal of Cell Science 118, 5797-5810 (2005)
Published by The Company of Biologists 2005
This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brachner, A.
Right arrow Articles by Gotzmann, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brachner, A.
Right arrow Articles by Gotzmann, J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Research Article

LEM2 is a novel MAN1-related inner nuclear membrane protein associated with A-type lamins

Andreas Brachner1, Siegfried Reipert2, Roland Foisner1,* and Josef Gotzmann1,*

1 Department of Medical Biochemistry, Max F. Perutz Laboratories, Vienna Biocenter, Medical University of Vienna, Dr Bohrgasse 9/3, A-1030 Vienna, Austria
2 Department of Molecular Cell Biology, University of Vienna, Max F. Perutz Laboratories, Vienna Biocenter, Dr Bohrgasse 9/3, A-1030 Vienna, Austria

* Authors for correspondence (e-mail: roland.foisner{at}meduniwien.ac.at; josef.gotzmann{at}meduniwien.ac.at)

Accepted 20 September 2005


    Summary
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The LEM (lamina-associated polypeptide–emerin–MAN1) domain is a motif shared by a group of lamin-interacting proteins in the inner nuclear membrane (INM) and in the nucleoplasm. The LEM domain mediates binding to a DNA-crosslinking protein, barrier-to-autointegration factor (BAF). We describe a novel, ubiquitously expressed LEM domain protein, LEM2, which is structurally related to MAN1. LEM2 contains an N-terminal LEM motif, two predicted transmembrane domains and a MAN1-Src1p C-terminal (MSC) domain highly homologous to MAN1, but lacks the MAN1-specific C-terminal RNA-recognition motif. Immunofluorescence microscopy of digitonin-treated cells and subcellular fractionation identified LEM2 as a lamina-associated protein residing in the INM. LEM2 binds to the lamin C tail in vitro. Targeting of LEM2 to the nuclear envelope requires A-type lamins and is mediated by the N-terminal and transmembrane domains. Highly overexpressed LEM2 accumulates in patches at the nuclear envelope and forms membrane bridges between nuclei of adjacent cells. LEM2 structures recruit A-type lamins, emerin, MAN1 and BAF, whereas lamin B and lamin B receptor are excluded. Our data identify LEM2 as a novel A-type-lamin-associated INM protein involved in nuclear structure organization.

Key words: Chromatin organization, Lamina-associated proteins, Lamins, LEM domain, Nuclear architecture, Nuclear envelope


    Introduction
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The nuclear envelope (NE) separates nuclear and cytoplasmic compartments. It is composed of an inner (INM) and an outer (ONM) nuclear membrane that are separated by a luminal space and are periodically connected at nuclear pore complexes, as well as a filamentous meshwork near the INM termed the nuclear lamina (Foisner, 2003Go; Gruenbaum et al., 2005Go). The nuclear lamina is found in multicellular animals. It is formed by type V intermediate filaments including B-type lamins, which are expressed in all cells and are essential for viability (Vergnes et al., 2004Go), and A-type lamins, the expression of which is limited to differentiated cells (Goldman et al., 2002Go). Several integral proteins of the INM bind to and are tightly integrated in the lamina scaffold (Burke and Stewart, 2002Go; Foisner, 2001Go; Gruenbaum et al., 2005Go). In particular, the lamin B receptor (LBR) and LAP2ß specifically bind to B-type lamins (Foisner and Gerace, 1993Go; Furukawa et al., 1998Go; Worman et al., 1988Go; Ye and Worman, 1994Go), whereas LAP1, emerin and nesprins have been shown to associate primarily with A-type lamins (reviewed by Zastrow et al., 2004Go).

A group of the lamin-binding proteins share a common structural motif of 40 amino acids (aa) at their N-termini, called the lamina-associated polypeptide–emerin–MAN1 (LEM) domain (Cai et al., 2001Go; Laguri et al., 2001Go; Lin et al., 2000Go), which mediates the interaction with a highly conserved DNA-crosslinking protein, barrier-to-autointegration factor (BAF) (Cai et al., 2001Go; Furukawa, 1999Go; Lee et al., 2001Go; Mansharamani and Wilson, 2005Go; Segura-Totten and Wilson, 2004Go; Shumaker et al., 2001Go). The founding members of the LEM-domain protein family include several alternatively spliced LAP2 isoforms (Berger et al., 1996Go; Dechat et al., 2000bGo; Furukawa et al., 1995Go; Harris et al., 1994Go), emerin, and MAN1 (Lin et al., 2000Go). The LAP2 isoforms contain an additional LEM-like motif at the extreme N-terminus, which interacts with DNA (Cai et al., 2001Go). Other members of the LEM-domain protein family include the Drosophila-specific proteins otefin (Ashery-Padan et al., 1997Go) and Bocksbeutel (Wagner et al., 2004Go), and the uncharacterized Caenorhabditis elegans LEM3 (Lee et al., 2000Go). A comprehensive database screen identified a mammalian orthologue of Ce-LEM3 and three novel LEM-domain proteins in higher eukaryotes, which were termed LEM2, LEM4 and LEM5 based on and extending the C. elegans nomenclature (Lee and Wilson, 2004Go; Mansharamani and Wilson, 2005Go).

On the basis of their interaction with BAF and DNA, the LEM-domain proteins have been implicated in chromatin organization (Dechat et al., 2004Go; Haraguchi et al., 2001Go; Liu et al., 2003Go; Segura-Totten et al., 2002Go; Segura-Totten and Wilson, 2004Go; Shimi et al., 2004Go). Emerin and LEM2 might have overlapping and redundant functions, as RNA interference-mediated knockdown of both proteins in C. elegans was embryonic lethal at the 100-cell stage, whereas single knockouts showed no or less-severe phenotypes (Liu et al., 2003Go). Furthermore, emerin and MAN1 were found to bind to each other in vitro (Mansharamani and Wilson, 2005Go). Numerous novel recently identified binding partners of LEM-domain proteins indicate many important functions of these proteins in diverse cellular processes (Bengtsson and Wilson, 2004Go; Gruenbaum et al., 2005Go). LAP2ß and emerin bind the transcriptional repressor germ-cell less (Holaska et al., 2003Go; Nili et al., 2001Go), and LAP2{alpha} interacts with the tumor suppressor retinoblastoma protein (Markiewicz et al., 2002Go), implicating functions in transcriptional regulation. Other potential functions of LEM-domain proteins can be envisaged based on the observation that emerin can act as a capping protein for nuclear actin (Holaska et al., 2004Go). Interestingly, XMAN1, the Xenopus orthologue of human MAN1, has been shown to serve as antagonist of the bone morphogenetic protein (BMP) signalling pathway by binding to downstream regulatory Smads 1, 5 and 8 (Osada et al., 2003Go). Similarly, human MAN1 can augment BMP signalling as well as signalling through transforming growth factor ß (TGF-ß) and activin by binding to Smads 1, 2 and 3, but not Smad 4 (Hellemans et al., 2004Go; Lin et al., 2005Go; Pan et al., 2005Go).

Mutations in genes encoding A-type lamins and some of their binding partners give rise to a diverse group of diseases termed `laminopathies' (Burke and Stewart, 2002Go; Gotzmann, 2004; Gruenbaum et al., 2005Go; Hutchison and Worman, 2004Go; Mounkes and Stewart, 2004Go). The disease phenotypes are diverse, affecting skeletal muscles, heart, adipose, bone, skin and neuronal tissues, and also include premature aging; the underlying molecular mechanisms for the laminopathies are still unclear. Apart from disease-causing mutations in the LMNA gene, mutations in genes encoding the LEM-domain proteins emerin (Bione et al., 1994Go; Emery, 1987Go; Emery and Dreifuss, 1966Go; Manilal et al., 1996Go) and MAN1 (Hellemans et al., 2004Go) give rise to muscular dystrophy and bone-related diseases, respectively. Since some disease-linked mutations in LMNA or lack of lamin A cause mislocalization of emerin to the endoplasmic reticulum (ER) (Holt et al., 2003Go; Muchir et al., 2004Go; Ostlund et al., 2001Go; Raharjo et al., 2001Go; Sullivan et al., 1999Go; Vaughan et al., 2001Go), it is likely that disruption of lamin A complexes caused by mutations in either lamin A/C or in associated proteins are the molecular cause of these diseases. Therefore, in order to gain more insights into the functions of lamin A/C complexes and their involvement in disease, it is extremely important to identify and characterize novel proteins of these complexes.

Here we describe and characterize a novel human MAN1-related LEM-domain protein, LEM2. Importantly, we demonstrate that LEM2 binds to lamin C and requires association with A-type lamins for proper NE localization. Furthermore, highly overexpressed LEM2 formed clusters and membranous invaginations at the NE as well as tubular structures interlinking nuclei of adjacent cells, to which it recruits lamin A/C and associated proteins emerin and BAF. This suggests a role of LEM2 in the organization of lamin A/C complexes.


    Materials and Methods
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture and transfection
The cell lines HeLa, COS, MDCK and C2C12, as well as mouse embryonic fibroblasts (MEFs) from wild-type or Lmna–/– mice [kindly supplied by C. Stewart, NCI-Frederick, USA (Sullivan et al., 1999Go)] were routinely cultivated in DMEM supplemented with 10% fetal calf serum (Invitrogen), penicillin/streptomycin and 2 mM L-Glutamine at 37°C in a humidified atmosphere containing 5% CO2. Transient transfections were performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. HeLa- (HeLa-LEM2), COS7- (COS-LEM2) and C2C12- (C2C12-LEM2) cells stably expressing hLEM2 were cloned by selecting for resistance to the antibiotic blasticidin (30 µg/ml; Invitrogen).

Antibodies
Mouse and rabbit anti-V5 antibodies were purchased from Invitrogen and Sigma, respectively. Rabbit anti-phospho-histone-H3 antibody was obtained from Upstate Biotechnologies; mouse anti-{alpha}-tubulin antibody and a polyclonal serum against actin were from Sigma; mouse monoclonal anti-lamin A (clone#133A2) was from Abcam; and mouse anti-NUP62 was from BD Pharmingen. The rabbit antiserum to LAP2{alpha} has been described previously (Vlcek et al., 2002Go). The antiserum to BAF was a generous gift of K. Furukawa [Niigata University, Japan (Furukawa, 1999Go)]. The antiserum to ER-marker {alpha}-calnexin was provided by E. Ivessa [Medical University Vienna, Austria (de Virgilio et al., 1998Go)]. The guinea pig anti-LBR antibody was provided by H. Hermann [DKFZ, Heidelberg, Germany (Dreger et al., 2002Go)]. The mouse anti-lamin B1 monoclonal antibody 8D1 was provided by D. Vaux [Sir William Dunn School of Pathology, Oxford, UK (Maske and Vaux, 2004Go)].

Plasmids and cloning strategy
A cDNA clone (#T5554) containing full-length human LEM2 was obtained from Genecopoeia (Germantown, USA) and used as template to amplify cDNA of full-length human LEM2 or the N-terminus (LEM2-NT) using the following primers: full-length, 5'-CACCATGGCCGGCCTGTCGGACCTGGAACTGCGGC-3' and 5'-GCATCGCTCTGAGTCAGAGAAGGAAGAGG-3'; LEM2-NT, 5'-CACCATGGCCGGCCTGTCGGACCTGGAACTGCGGC-3' and 5'-AAGCTTCGCGCCAGCAGGGCCCGCTCGAGT-3'. cDNAs were cloned into pENTR/D-TOPO (Invitrogen). For eukaryotic expression, hLEM2 and LEM2-NT were shuttled using the LR-recombination reaction (Invitrogen) into pTRACER-B, made Gateway®-compatible by insertion of the `conversion cassette' (Invitrogen) into the EcoRV site. Full-length human MAN1 was amplified by PCR (5'-CACCATGGCGGCGGCAGCAGCTTC-3'; 5'-GCAGGAACTTCCTTGAGAAT-3') and cloned into pTRACER-B as above. Vectors expressing deletion mutants of hLEM2 were constructed by restriction digest and re-ligation using pTRACER with full-length hLEM2. For LEM2{Delta}CT ({Delta}aa 378-486) we used MslI, for LEM2{Delta}NT ({Delta}aa 130-203) SfoI, for LEM2-LEM ({Delta}aa 74-503) BssHII, and for LEM2{Delta}LEM+NT ({Delta}aa 28-203) SmaI and SfoI. All expression constructs were tagged with a C-terminal V5 epitope. For the LEM2-GFP construct, a SpeI-XbaI fragment from the pTRACER vector expressing full-length LEM2 was subcloned into the NheI site of peGFP-C1 (Clontech). A construct expressing GFP-tagged pre-lamin A (Sullivan et al., 1999Go) was a generous gift of C. Stewart; the plasmid GFP-xLaminB1{Delta}2+ was kindly provided by C. Hutchison [University of Durham, UK (Izumi et al., 2000Go)].

Subcellular fractionation, gel electrophoresis and immunoblotting
Subcellular fractionation was done essentially as described (Dechat et al., 1998Go; Gotzmann et al., 2000Go). In brief, cells were broken in hypotonic buffer using a dounce homogenizer with a tight-fitting pestle. After addition of 8% sucrose, the soluble cytoplasmic and insoluble nuclear fractions were separated by centrifugation at 2000 g for 15 minutes at 4°C. The nuclei-containing pellet fractions were extracted in the same buffer supplemented with 1% Triton X-100, or 200 mM NaCl, or combinations of both, or 7 M urea followed by centrifugation at 15,000 g for 10 minutes; analyses of supernatant and pellet fractions were carried out by western blotting. SDS-PAGE and immunoblotting was performed essentially as described previously (Gotzmann et al., 2002Go; Gotzmann et al., 2000Go).

PCR analysis
Total RNA was purified by standard techniques from whole mouse embryos (dpc 12, 14, 16, 18) or purchased as total RNA collections of human and mouse tissues (Clontech). Poly(A)+ mRNA was extracted from total RNA with an mRNA Isolation Kit and reverse transcribed using the first-strand cDNA Synthesis Kit (both from Roche). Aliquots of the resulting products were employed as templates for specific PCR amplifications using Ready-To-Go PCR beads (Amersham Pharmacia Biotech). The conditions for the PCR reactions were optimized for each primer pair. All cDNAs were normalized according to actin expression levels. Real-time PCR analysis of LEM2 expression at developmental stages was performed using an iCycler real-time PCR detection system (Bio-Rad) and the DNA-binding dye SYBR Green I. The following pairs of forward and reverse primers (all in 5'-3' direction) were used for amplifications: human and mouse actin, ATCTGGCACCACACCTTCTAC and CAGCCAGGTCCAGACGCAGG; human LEM2, GCCGGCCTGTCGGACCTGGAACT and GGCGGCGCAGCTTGTTGCGGTAG; mouse LEM2, AAGCGAGTATGGGACCGTGCTGTG and AGGTGAGACCCGGCTGAAGAGTTG.

Blot overlay assay
Full-length hLEM2 and an N-terminal fragment (LEM2-NT; aa 46-195) of hLEM2 were subcloned into a pET102 vector backbone using TOPO technology (Invitrogen). Expression plasmids for lamin C fragments (head, aa 1-171; rod, aa 171-319; tail, aa 319-572) and full-length LAP2{alpha} are described elsewhere (Dechat et al., 2000aGo). Coupled transcription and translation in the presence of [35S]-methionine was performed using the TNT® Quick Coupled Transcription/Translation according to the manufacturer's instructions (Promega). Recombinant lamin C fragments and LAP2{alpha} were separated by SDS-PAGE and transferred onto nitrocellulose. Proteins were stained with PonceauS, and blots were incubated in overlay buffer (10 mM Hepes, pH 7.4, 50 mM NaCl, 5 mM MgCl2, 2 mM EGTA, 0.1% Triton X-100, 1 mM DTT) for 3 hours, blocked with 5% skim milk in overlay buffer, and probed with whole reticulocyte lysate containing 35S-labelled proteins diluted 1:50 in overlay buffer with 1% skim milk and 1 mM phenylmethylsulphonylfluoride (PMSF) overnight at 4°C. After extensive washing in phosphate-buffered saline/Tween (PBST), bound proteins were detected by autoradiography.

Immunofluorescence microscopy
Cells were grown on poly-L-lysine-coated glass coverslips, fixed in methanol at –20°C for 3 minutes, or fixed in 4% paraformaldehyde for 10 minutes and permeabilized with 0.5% Triton X-100 in PBS for 5 minutes. Digitonin extraction of fixed cells was done with 40 µg/ml digitonin (Calbiochem) in PBS for 3 minutes on ice. Cells were blocked in 0.5% gelatin in PBS for 15 minutes, incubated with primary antibodies for 45 minutes, washed and probed with the appropriate secondary antibodies conjugated to either Texas Red (Jackson Immuno Research) or Alexa Fluor 488 (Molecular Probes) for 45 minutes. DNA was stained with Hoechst for 5 minutes, and samples were mounted in Mowiol (Fluka). Confocal images of the samples were taken with a confocal laser scanning microscope (LSM510 and Axiovert 100; Zeiss). Digital images were analysed and adjusted for brightness and contrast using the software LSM-Image-Browser (Zeiss) and Adobe Photoshop.

Electron microscopy
Cells grown on glass coverslips were fixed in 3% glutaraldehyde in 0.15 M Sorensen's buffer, pH 7.4, for 1 hour, incubated in 1% OsO4 in Sorensen's for 1 hour and dehydrated with increasing concentrations of ethanol. Samples were subsequently `flat' embedded in epoxy resin (Agar 100). Thin sections of 60-80 nm were cut with a LEICA Ultracut S ultramicrotome, mounted on copper grids, contrasted with uranyl acetate and lead citrate, and examined in a JEOL JEM-1210 electron microscope at 60 kV. Images were acquired using a Mega View III digital camera and analySIS FIVE software (SIS, Praha, Czech Republic).

Computer-assisted analysis
Alignments of cDNA sequences, genomic contig sequence alignments and database searches were performed by NCBI-BLAST (http://www.ncbi.nlm.nih.gov/blast/) and ClustalW (http://www.ebi.ac.uk/clustalw/) (Thompson et al., 1994Go). Genomic analysis was done using the ENSEMBL Genome Browser (http://www.ensembl.org/; Sanger Institute). The sequence of the murine orthologue of hLEM2 was calculated using the GENSCAN gene-prediction software [http://genes.mit.edu/GENSCAN.html (Burge and Karlin, 1997Go)]. Protein motifs and pattern searches were performed using SMART [http://smart.embl-heidelberg.de/ (Letunic et al., 2004Go; Schultz et al., 1998Go)], CDD (http://www.ncbi.nlm.nih.gov/; NCBI) and PSORT II (http://psort.nibb.ac.jp/form2.html). Transmembrane domains were calculated using the membrane protein topology database [http://blanco.biomol.uci.edu/mptopo/ (Jayasinghe et al., 2001Go)], the TMHMM 2.0 prediction software [http://www.cbs.dtu.dk/services/TMHMM/ (Krogh et al., 2001Go)], the SOSUI system (http://sosui.proteome.bio.tuat.ac.jp/) and the DAS-TM filter algorithm (Cserzo et al., 2004Go). Phylogenetic tree predictions were done using eSHADOW [http://eshadow.dcode.org/ (Ovcharenko et al., 2004Go)] and visualized using the Phylodendron software (http://iubio.bio.indiana.edu/treeapp/).


    Results
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
LEM2 is a novel mammalian LEM-domain protein structurally related to MAN1
Database searches for novel mammalian LEM-domain proteins revealed human (Acc. No.: NP_851853) and mouse (Acc. No.: AAT71319) LEM2, which show 83% and 87% overall aa sequence identity and similarity, respectively (Fig. 1A). The LEM domain in LEM2 was located at the very N-terminus of the molecule (aa 1-42; Fig. 1A, red box) and showed 97% sequence identity between human and mouse. The LEM domain in human LEM2 (hLEM2) is more closely related to the LEM domains described originally in hMAN1, hLAP2 and hEmerin (Lin et al., 2000Go) than to the LEM-like motif present in LAP2 (Fig. 1C). However, five residues within the LEM and LEM-like domains in these proteins were strictly conserved (Fig. 1C, red), two of which (P and Y) have been shown to be essential for the interaction with BAF in LAP2 (Shumaker et al., 2001Go). The hLEM2 polypeptide encompasses 503 aa (predicted molecular mass 56 kDa) and is highly basic (pI=9.2) mostly owing to a highly basic N-terminus (aa 1-209, pI=11.3). hLEM2 contains two predicted transmembrane domains between aa 209-231 and aa 372-394 (Fig. 1A, blue) and a MAN1-Src1p C-terminal (MSC) domain (Mans et al., 2004Go) between aa 435-493 (green). The gene encoding hLEM2 was annotated to chromosome 6p21.31, including 9 exons and 8 introns spanning about 18 kb (data not shown). The Lem2 gene in mouse was allocated to synthenic regions of chromosome 17A3.3.



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 1. LEM2 is a novel ubiquitously expressed member of the MAN1 subfamily within the LEM-domain proteins. (A) Comparison of the domain organization of human LEM2 (hLEM2) with orthologues of mouse (mLEM2) and C. elegans (Ce-LEM2), as well as with MAN1 proteins from human (hMAN1), Xenopus laevis (XMAN1), Drosophila (dmCG3167) and Saccharomyces cerevisiae (scSRC1p). Percentage identity of aa residues relative to human LEM2 are indicated within defined domains (intersected by small black bars), including the N-terminus, the lumenal part and the C-terminus. The MAN1-specific region is additionally marked by a black line. LEM/SAP domains are shown in red, transmembrane domains in blue, the MSC domain in green and the MAN1-specific RRM domain in yellow. (B) Cladogram displaying predicted phylogenetic divergence between members of a proposed LEM2-MAN1 family. The domain organization of the proteins is schematically indicated by the coloured boxes, as in (A). (C) Multiple sequence alignment of the LEM domains of hLEM2, MAN1, LAP2ß, emerin and of the LEM-like motif in LAP2ß. Invariant residues are in red, highly conserved in blue. Numbers indicate respective aa positions in the full-length proteins. (D) LEM2 mRNA levels in human and mouse tissues determined by semiquantitative RT-PCR. Actin mRNA levels were used for normalization. Agarose gels of PCR fragments are shown; B. Marrow, bone marrow; Sk. Muscle, skeletal muscle.

 

We detected LEM2 orthologues in C. elegans (Fig. 1A), rat, chicken and dog (data not shown). The overall domain organization of hLEM2 is identical to that of hMAN1 and other MAN1 orthologues (e.g. Xenopus XMAN1), except that LEM2 lacked an RNA-recognition motif found in the C-termini of MAN1-type proteins (Fig. 1, RRM domain, yellow). Except for the LEM domain, hLEM2 and hMAN1 are less well conserved in their N-termini (upstream of the first predicted transmembrane domain) and in the region between the transmembrane domains (11 and 27% identity, respectively), whereas a high degree of identity (87%) was detected in the C-terminal MSC domains of these proteins (Fig. 1A). Thus, we suggest that MAN1 and LEM2 comprise a subfamily within the LEM-domain proteins characterized by the presence of the MSC domain. Interestingly, Ce-LEM2, which has originally been termed Ce-MAN1 (Lee et al., 2000Go), is more homologous in the N-terminus and in the region between the transmembrane domains to hLEM2 than to hMAN1, and also lacks the C-terminal RNA recognition motif of MAN1. Therefore, we concur that the protein encoded by Ce-LEM2 is orthologous to human LEM2 (Mansharamani and Wilson, 2005Go), not MAN1, as originally thought (Lee et al., 2000Go). By contrast, a highly related protein from Drosophila (dmCG3167, Fig. 1A) seems to be a MAN1 rather than a LEM2 orthologue.

Phylogenetic analysis led us to speculate that LEM2 and MAN1 have a common ancestor in evolution (Fig. 1B). Intriguingly, a domain organization related to that of the predicted ancestor was also detected in yeast Src1p-related proteins. Src1p contains an N-terminal SAP domain, which by structural criteria might be similar to the LEM domain, two transmembrane domains and the conserved C-terminal MSC domain (Fig. 1B) (Mans et al., 2004Go). Thus, the LEM motif might have been derived from the SAP motif, and proteins containing the SAP/LEM and MSC domains might represent an evolutionarily conserved LEM2 protein family. In addition, a group of MAN1-type proteins, characterized by the presence of an additional C-terminal RRM domain (yellow), might have evolved from LEM2 ancestors.



View larger version (62K):
[in this window]
[in a new window]
 
Fig. 2. Human LEM2 is a lamina protein of the INM. HeLa cells stably expressing V5-tagged hLEM2 were processed for immunofluorescence using anti-V5 (green) and anti-LAP2{alpha} (red) antibodies. DNA was stained with Hoechst (blue). Cells were either extracted with (A) Triton X-100 or (B) digitonin after fixation. Arrows point to mitotic cells, which serve as positive control for antibody reactivity. Bars, 10 µm. (C) Subcellular fractionation of lysates of stable HeLa clones expressing V5-tagged hLEM2. Nuclei were extracted with Triton X-100 and/or salt, or with 7M urea, and soluble supernatant and insoluble pellet fractions were subjected to western blot analysis using anti-V5 and anti-LAP2ß antibodies. Molecular weights in kDa are indicated on the left.

 
LEM2 is an ubiquitously expressed INM protein
Having identified LEM2 as a novel member of the LEM protein family we wished to analyse the expression pattern and biochemical properties of the protein. Semiquantitative RT-PCR analysis revealed that LEM2 is ubiquitously expressed at comparable levels in all human and mouse tissues tested (Fig. 1D). Furthermore, LEM2 transcripts were also detectable throughout later stages of mouse development (dpc 12, 14, 16, 18; data not shown). These data are consistent with the previously reported ubiquitous expression of Ce-LEM2 (Gruenbaum et al., 2002Go).

In order to determine the subcellular localization of LEM2 protein, we stably expressed V5-tagged hLEM2 in various cell types. Confocal immunofluorescence microscopy of stable HeLa clones showed that the expressed LEM2 localized exclusively to the NE, giving rise to a typical rim-like staining of the nuclear periphery (Fig. 2A). Identical data were obtained in COS7 and MDCK cells, and in human and mouse primary skin fibroblasts (data not shown). In order to distinguish localization of LEM2 in the INM versus ONM, we permeabilized cells with digitonin, which selectively disrupts the plasma membrane leaving the NE membranes intact (Adam et al., 1990Go). Antibodies to the C-terminal V5 tag of hLEM2 and to the nucleoplasmic protein LAP2{alpha} did not detect the proteins in digitonin-treated interphase cells in the nucleus; by contrast, in mitotic cells, in which the nuclear membrane was disassembled, LEM2-V5 and LAP2{alpha} were visible in the cytoplasm (arrows, Fig. 2B). A weak LEM2 staining in digitonin-treated interphase cells in the cytoplasm might represent a small fraction of LEM2-V5 in the ER. Since LEM2 in the NE was not accessible for antibodies in digitonin-treated interphase cells, we concluded that the LEM2 C-terminus is located in the nucleoplasm, implying that hLEM2 is a constituent of the INM.



View larger version (96K):
[in this window]
[in a new window]
 
Fig. 3. Dynamics of LEM2 during the cell cycle. (A) HeLa cells stably expressing hLEM2 were processed for indirect immunofluorescence using anti-phospho-histone-H3 antibody (pHistone3; red) and anti-V5 antibody (green). DNA was stained using Hoechst dye (blue). Representative images of defined cell-cycle stages are shown. (B) Cells at anaphase or different telophase stages, were stained for exogenous LEM2 with anti-V5 antibody (green) and for either LAP2{alpha}, LBR or LAP2ß (red). DNA was stained with Hoechst (blue). Bars, 10 µm in (A) and 5 µm in (B).

 
To test whether hLEM2 is indeed a transmembrane protein and a component of the nuclear lamina, isolated nuclei of stable HeLa clones were extracted in buffers containing urea or non-ionic detergent, and the distribution of hLEM2 and of the well-characterized INM protein LAP2ß (Foisner and Gerace, 1993Go) between soluble and insoluble fractions was analysed by immunoblotting (Fig. 2C). The observed Mr of LEM2-V5 of 60x103 was close to the calculated Mr (58x103). Similar to LAP2ß, LEM2 remained insoluble in buffers containing either 200 mM salt or Triton X-100 and low salt concentration (50 mM), or 8M urea. Only treatment with detergent and medium salt concentration buffer (1% Triton/200 mM NaCl) solubilized a significant portion of LEM2 (Fig. 2C). Thus, by these biochemical criteria, LEM2 is a transmembrane protein of the INM associated with the nucleoskeletal-lamina network, similar to LAP2ß. In support of this model, Schirmer and Gerace have detected rat LEM2 (NP_666187.1) in the nuclear membrane fraction by a subtractive proteomics approach (Schirmer et al., 2003Go).

During mitosis, when the nucleus is disintegrated and reassembled after sister chromatid separation, LEM2 behaved similarly to other LEM-domain-containing membrane proteins. From prophase to prometaphase, identified by the presence of phosphorylated histone H3 (Juan et al., 1998Go), the nuclear membrane was progressively disintegrated and LEM2 diffused into the cytoplasm, where it remained until telophase (Fig. 3A). Similar to emerin and LAP2ß (Dechat et al., 2004Go; Haraguchi et al., 2001Go), LEM2 re-localized to the NE only at later stages of assembly, clearly after LAP2{alpha} was accumulated in chromatin-associated core regions and after LBR was detectable at peripheral regions of decondensing chromosomes (Fig. 3B). Altogether, based on its subcellular localization in the interphase nucleus, its dynamic behaviour during mitosis and its biochemical properties, LEM2 is indistinguishable from other integral nuclear membrane proteins of the LEM-domain family.

NE localization of hLEM2 requires A-type lamins at the NE
Extraction studies indicated that hLEM2 is associated with the lamina-nucleoskeleton scaffold (see above). Furthermore, in C. elegans, Ce-LEM2 localized to the NE in a lamin-dependent manner (Liu et al., 2003Go), and in mammals the LEM-domain protein emerin requires A-type lamins for NE targeting (Sullivan et al., 1999Go; Vaughan et al., 2001Go). To explore whether NE localization of hLEM2 also depends on A-type lamins, we analysed the localization of hLEM2 in MEFs. In wild-type MEFs, LEM2-V5 preferentially localized to the NE (Fig. 4A); however, in Lmna–/– MEFs, LEM2-V5 was distributed throughout the ER (Fig. 4B). Expression of GFP-lamin A in Lmna–/– MEFs, which localized to the NE, restored the predominantly rim-like localization of hLEM2-V5 at the NE (Fig. 4C), suggesting that lamin A is required for retention of LEM2 at the INM. To test this model further, we disrupted the distribution of endogenous A-type lamins in LEM2-V5-expressing HeLa cells by introducing a headless Xenopus lamin mutant, GFP-xLaminB1{Delta}2+, which accumulated in nucleoplasmic aggregates and caused the redistribution of endogenous A-type lamins from the peripheral lamina to these aggregates (Dechat et al., 2000aGo; Izumi et al., 2000Go). In cells containing nuclear aggregates of mutated lamins, a significant fraction of hLEM2 localized to the presumed ER (Fig. 4D, arrows) whereas, in untransfected cells, hLEM2 was localized predominantly at the NE. As the mutated lamins clearly caused a mislocalization of endogenous lamin A/C in these cells (Fig. 4E), this finding is consistent with the hypothesis that loss of lamin A/C at the NE destabilizes the anchorage of LEM2 at the INM and causes its diffusion into the ER.



View larger version (65K):
[in this window]
[in a new window]
 
Fig. 4. Localization of LEM2 at the NE depends on the presence of A-type lamins. (A-C) Mouse embryonic fibroblasts (MEFs) from wild-type (A) or lamin A/C-knockout (B,C) mice were transfected with V5-tagged hLEM2 plasmids. In (C), cells expressing V5-tagged LEM2 were co-transfected with GFP-tagged pre-lamin A (GFP-LaminA) plasmid and were stained for LEM2 using anti-V5 antibody (A-D, red) and for DNA with Hoechst dye (C-E, blue). Ectopically expressed lamin A was detected by GFP fluorescence (C, green). (D,E) HeLa cells stably expressing V5-tagged hLEM2 were transfected with a construct encoding a GFP-tagged version of a dominant-negative Xenopus Lamin B1 (GFP-xLaminB1{Delta}2+; green) and stained either for LEM2 using anti-V5 antibody (D, red) or endogenous lamin A (E, red). Arrows depict mislocalization of LEM2 to the ER in cells expressing the dominant-negative lamin B mutant. Note, that V5-tagged LEM2 decorates only the nuclear rim in untransfected cells. Bars, 10 µm. (F) Recombinant GST alone (lanes 5), LAP2{alpha} (lanes 4) and GST-lamin C head domain (lanes 1), rod domain (lanes 2) and tail domain (lanes 3) were transblotted to nitrocellulose membranes. PonceauS staining detects recombinant proteins (asterisks). Membranes were probed with 35S-labelled full-length LEM2 (LEM2-FL), the N-terminus of LEM2 (LEM2-NT) and LAP2{alpha}, and bound proteins were detected by autoradiography.

 

To test whether hLEM2 associates with A-type lamins, we performed blot overlay assays. 35S-labelled full-length hLEM2 (FL) or an N-terminal hLEM2 fragment (NT) or LAP2{alpha} were overlaid onto immobilized GST-tagged lamin C fragments comprising the lamin C head, rod or tail domains, and onto immobilized LAP2{alpha} (Dechat et al., 2000aGo). Similar to the known lamin C-binding protein LAP2{alpha}, hLEM2 strongly bound to the C-terminus of lamin C (Fig. 4F, lane 3). The lamin C fragments containing the lamin C head (lane 1) or rod (lane 2) or LAP2{alpha} (lane 4) or GST alone (lane 5) did not bind hLEM2 above background level. The N-terminus of hLEM2 also bound to the lamin C C-terminus, although the interaction was weaker than those of full-length LEM2 (Fig. 4F). Altogether, our data strongly support a role of A-type lamins in targeting and stabilizing hLEM2 at the NE by a direct interaction.

The N-terminus of hLEM2 is required for retention at the INM
To determine the domain(s) of hLEM2 responsible for NE targeting and retention, we investigated the localization of hLEM2 fragments with a C-terminal V5 tag in HeLa cells. Whereas fragments lacking the C-terminus, including the MSC and the second transmembrane region (Fig. 5, LEM2{Delta}CT), still localized to the NE in a continuous rim, fragments missing nearly the complete N-terminus were no longer retained at the NE and localized mostly to the ER (LEM2{Delta}LEM+NT). This suggested that the N-terminus is essential for NE retention of LEM2. As LEM2 fragments missing a ~70aa region (aa 130-203) within the N-terminus close to the first transmembrane domain (LEM2{Delta}NT) behaved like wild-type protein, we concluded that the potential N-terminal nuclear retention signal is located upstream of position 130. To test whether the N-terminal retention signal is sufficient for LEM2 targeting, we expressed the N-terminus without the transmembrane domains and the C-terminus (LEM2-NT). This fragment localized to the nucleus but did not accumulate at the NE. Thus, the N-terminus is sufficient for nuclear targeting but not for targeting to the INM. The latter process requires an additional transmembrane region. This observation is consistent with previous studies showing that the localization of INM proteins to the nuclear periphery requires both a transmembrane domain and a retention signal mediating binding to a nuclear component (Holmer and Worman, 2001Go). In order to test whether the retention signal might reside within the LEM domain, which could retain LEM2 in the INM by binding to the chromatin protein BAF, we expressed the N-terminal 74 aa fragment of LEM2 containing the entire LEM motif (LEM2-LEM). However LEM2-LEM localized throughout the cell, indicating that the LEM domain of LEM2 is not sufficient for nuclear retention. On the basis of our observation that NE targeting of LEM2 is dependent on the presence of A-type lamins, we reasoned that the retention domain within the N-terminus of LEM2 might mediate the association with lamin A/C complexes. To test this possibility, we expressed the LEM2 N-terminus in Lmna–/– MEFs. In contrast to wild-type HeLa cells, LEM2-NT did not accumulate in the nucleus in lamin A-deficient cells (Fig. 5, lower right panel). Taking all data together, targeting of LEM2 to the NE requires both a transmembrane domain and an N-terminal retention signal located between residues 74-130, which mediates association with lamin A/C complexes.



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 5. The N-terminus of LEM2 is essential and sufficient for lamin A-mediated nuclear targeting. Confocal immunofluorescence images of HeLa cells or Lmna–/– MEFs transiently expressing different V5-tagged truncation mutants of hLEM2, as indicated in the schematic drawing below each image. The LEM domain is shown in red, transmembrane domains in blue, and MSC domain in green. Numbers depict aa that border each deletion. LEM2 polypeptides were detected by immunofluorescence using anti-V5 antibody (red). DNA was stained with Hoechst (blue). Arrows in the lower right image mark cytoplasmic staining of LEM2-NT in Lmna–/– MEFs. Bars, 10 µm.

 
High-level overexpression of LEM2 affects NE structure
Low-to-moderate stable expression of hLEM2-V5 in several cell lines resulted in a smooth and continuous distribution of the protein at the nuclear periphery, which is typical for integral INM proteins (see Fig. 2A). If the protein was expressed at high levels (ratio of ectopic to endogenous LEM mRNA >2) in stable cell lines (e.g. HeLa and C2C12 myoblasts), it accumulated in discrete, patchy structures apparently localizing in the nuclear interior (Fig. 6A). However, in z-stacks or optical xz sections through these cells by confocal microscopy, all LEM2 structures were located at the nuclear periphery (Fig. 6B), and transmission electron microscopy resolved numerous finger-type intrusions of the nuclear membrane(s) in these cells (Fig. 6C). The LEM2 patches were often arranged in a regular pattern along the entire NE and varied in size (Fig. 6A,B). The LEM2 patches were not stained in digitonin-extracted cells (data not shown, see also Fig. 2), suggesting that they are located at the INM.



View larger version (70K):
[in this window]
[in a new window]
 
Fig. 6. Overexpressed LEM2 accumulates in peripheral patches. (A) HeLa or C2C12 cells expressing high levels of LEM2-V5 were processed for indirect immunofluorescence microscopy using anti-V5 antibody (red) and DNA was stained with Hoechst dye (blue). Bars, 10 µm. (B) Confocal images of cells in xy and xz optical sections. White line indicates location of xz section. Bars, 2 µm. (C) Transmission electron microscopic images of thin sections of embedded wild-type HeLa cells (left) or hLEM2-overexpressing HeLa cells (right). Bars, 5 µm.

 

To test whether formation of these LEM2 clusters can affect the distribution of other INM or lamina proteins, we analysed the localization of various NE proteins in transfected versus untransfected cells by double immunofluorescence microscopy. Lamin B1 (data not shown) and the lamin B-binding partner LBR (Fig. 7) did not significantly accumulate in LEM2 clusters. By contrast, A-type lamins were partially enriched in LEM2 patches, although they still localized throughout the entire NE (Fig. 7, arrowheads). Furthermore, emerin, which interacts with lamin A (Clements et al., 2000Go; Holaska et al., 2003Go), and BAF, which might be associated with the LEM domains of LEM2 and/or emerin, showed the most dramatic reorganizations to LEM2 clusters at the NE (Fig. 7). Therefore, we concluded that highly overexpressed LEM2 accumulated in patches in the INM and recruited A-type lamins and A-type lamin-binding proteins, whereas B-type lamins and their interaction partners (LBR) were not affected. These results indicate that LEM2 is associated with lamin A/C structures and support the model of a lamin A/C-dependent stabilization and retention of LEM2 at the NE shown above. Interestingly, overexpressed hMAN1-V5 did not accumulate in patches, but coexpression of MAN1-V5 and LEM2-GFP caused accumulation of both proteins in clusters, indicating that LEM2 can also recruit MAN1.



View larger version (113K):
[in this window]
[in a new window]
 
Fig. 7. A subset of NE proteins is recruited to LEM2 patches. HeLa cells constitutively expressing high levels of V5-tagged hLEM2 were processed for immunofluorescence microscopy using anti-V5 antibody (green) and antibodies to different NE proteins (red). Bottom row shows images of HeLa cells stably expressing V5-tagged MAN1 (red) and co-transfected with human LEM2-GFP (green)-encoding plasmid. Images on the right show untransfected HeLa cells stained for the NE proteins indicated (control; red) or cells expressing V5-tagged MAN1 alone (bottom row). Arrowheads in left image (row 4) depicts lamin A patches. Bars, 10 µm.

 

LEM2 overexpression induced formation of tubular structures between nuclei
Unlike untransfected control cells, a significant number (up to 10%) of LEM2-overexpressing cells contained tubular structures between nuclei of adjacent cells. These structures, which also contained LEM2, were up to 30 µm long and originated frequently from LEM2 patches at the NE (Fig. 8B, arrows). Double staining of these cells for actin (Fig. 8A) revealed that the tubular connections occur between individual cells that have completed cytokinesis. Furthermore, the tubular structures seem to be stable and can be maintained for a long time, as we detected up to four interconnected cells (Fig. 8F). Regarding the biogenesis of these tubular structures, it seems very likely that they are formed during NE assembly in telophase and G1. LEM2-containing tubular structures extend from LEM2 patches on chromatin in telophase and increase in length during progression to G1 phase (Fig. 8E, arrows). The formation of the tubular connections between adjacent cells apparently did not affect cell-cycle progression and subsequent cell divisions. Connected interphase cells contain phospho-histone 3, a marker for dividing cells (Fig. 8C), and cell pairs in late telophase/G1 phase can be linked to large interphase cells (Fig. 8D), indicating that cells with tubular connections can divide normally.



View larger version (109K):
[in this window]
[in a new window]
 
Fig. 8. LEM2-induced tubules are stable connections, persisting throughout several cell cycles. HeLa cells stably overexpressing V5-tagged hLEM2 were processed for immunofluorescence microscopy using antibodies to indicated proteins. Images depict LEM2 stained with anti-V5 (green) and actin (A, red) or phospho-histone H3 (C, red) or BAF (F, red), and DNA (A-E, blue). Arrows in (C) indicate cells shown at higher magnification in (E). Arrows in (E) depict LEM2 patches from which tubular structures emerge. Single colour images corresponding to the merged images in A and B are shown. Bars, 10 µm.

 
Double immunofluorescence microscopy using antibodies to different lamina proteins revealed that, similar to the LEM2-containing patches at the NE (Fig. 7), the tubular structures between the nuclei also contained lamin A, emerin and BAF (Fig. 9), whereas lamin B1 and LBR were hardly or not at all detectable (Fig. 9). Because the structures between nuclei contained several nuclear membrane proteins, they most probably represent membrane structures continuous with the NEs of connected nuclei. However, nuclear pores (Fig. 9, NUP62) and the ER protein {alpha}-calnexin were absent. Furthermore, cytoskeletal proteins such as tubulin (Fig. 9) or actin (Fig. 8) were not detectable in the connecting tubules. We propose that the recruitment of A-type lamins and lamin A-associated proteins to overexpressed LEM2 causes abnormalities of the NE, leading to the formation of extra membrane sheets extending from the chromatin-attached nuclear membranes.



View larger version (95K):
[in this window]
[in a new window]
 
Fig. 9. LEM2-containing tubular structures between adjacent nuclei also contain lamin A/C-associated proteins. HeLa cells stably overexpressing V5-tagged hLEM2 were processed for immunofluorescence microscopy using antibodies to indicated proteins. Cells were stained for LEM2-V5 (green), DNA (blue), and either lamin A, emerin, BAF, NUP62, lamin B1, LBR, {alpha}-tubulin or {alpha}-calnexin (red). Bars, 10 µm.

 

    Discussion
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
LEM2 and MAN1 comprise a subfamily within the LEM family that is highly conserved in evolution
In this study, we characterized a novel member of the LEM-domain protein family, which we named LEM2 according to a previously suggested nomenclature (Lee et al., 2000Go). Extensive computational analyses defined LEM2 and MAN1 as a subfamily characterized by a common domain organization, consisting of an N-terminal LEM motif, two transmembrane domains and a highly conserved C-terminal MSC domain. MAN1 differs from LEM2 proteins by the presence of an additional RRM domain at the extreme C-terminus. On the basis of these criteria, Ce-LEM2, which has been described previously as a MAN1 orthologue in C. elegans (Lee et al., 2000Go), is a LEM2-type protein. Intriguingly, structure analyses of the LEM domain have indicated a homology with domains found in bacterial proteins, suggesting a common ancestor in evolution (Mans et al., 2004Go). According to this hypothesis, a helix-extension-helix motif found in the yeast protein Src1p might represent a common ancestor of both the LEM domain and the highly related SAP motif (Aravind and Koonin, 2000Go). Yeast Src1p might thus represent an ancestral LEM2-type protein as it harbours a LEM/SAP domain, two predicted transmembrane regions and the C-terminal MSC domain. Moreover, yeast Src1p might also share some functions with LEM2/MAN1 proteins, as a GFP-tagged Src1p has been localized to the yeast nuclear envelope, where it could be involved in sister chromatid segregation (Rodriguez-Navarro et al., 2002Go).

LEM2 is an INM protein linked to A-type lamin complexes
Our studies demonstrate that LEM2 is localized to the INM and is a genuine lamina protein, characterized by its co-fractionation with insoluble lamin structures upon treatment of nuclei with detergent and high salt (Foisner and Gerace, 1993Go). Unfortunately, our efforts to produce antibodies against N-terminal peptides remained unsuccessful and the characterization of mammalian LEM2 thus relies on ectopic expression data. Interestingly, we found that LEM2 required A-type lamins at the nuclear periphery for NE targeting. Lack of A-type lamins or disruption of endogenous lamin A structures caused a mislocalization of LEM2 to the ER. Thus, LEM2 can be considered as an A-type lamin-associated protein. Our in vitro binding data revealing an interaction of in-vitro-translated LEM2 with lamin C suggest direct interaction of these proteins, which is in accordance with various studies on Ce-LEM2 and human MAN1. First, Ce-LEM2, which is the only LEM2-type protein to date that has been analysed by biochemical and genetic means, also required lamins for its NE localization and has been shown to interact with Ce-lamin through the N-terminus (Ce-LEM2; aa 1-333) in blot overlay assays (Liu et al., 2003Go). Second, the N-terminus of MAN1 was found to interact in vitro with the globular tail domains of both A- and B-type lamins (Mansharamani and Wilson, 2005Go). In line with these findings, we also found that the domain mediating lamin A-dependent retention of LEM2 in the NE is localized in a region ~60 residues in length within the N-terminus of LEM2. A similar behaviour has been described for emerin, which binds to A-type lamins in vitro (Clements et al., 2000Go; Holaska et al., 2003Go) and requires A-type lamins for NE localization (Sullivan et al., 1999Go; Vaughan et al., 2001Go).

Potential functions of LEM2
High-level overexpression of LEM2 caused accumulation of the protein in patches at the NE and formation of NE invaginations, effects that were not observed with overexpressed human MAN1. Intriguingly, lamin A, emerin and BAF were, unlike lamin B1 and LBR, also reorganized to these structures, suggesting a role of LEM2 in the structural organization of a subset of NE components. As this subset of NE proteins included mostly proteins that have previously been detected in A-type lamin complexes, we propose that LEM2 is involved in the organization of A-type lamins within the NE. Given the fact that emerin and BAF seem to be recruited into these patch-like structures more efficiently than A-type lamins, it is tempting to speculate that these proteins might bind directly to LEM2 with high affinity. Whereas binding of BAF to LEM2 might be mediated by the LEM domain and a C-terminal region (Liu et al., 2003Go), binding of emerin might be mediated by a region in LEM2 related to MAN1, as an interaction between emerin and MAN1 has recently been demonstrated (Mansharamani et al., 2005Go). Interestingly, the LEM2 structures seem to be distinct from lamin B-containing protein complexes. Previous studies showed that overexpressed GFP-tagged LBR (Ellenberg et al., 1997Go), as well as endogenous LBR, accumulated in `microdomains' within the NE (Makatsori et al., 2004Go). These observations suggest that the NE might be organized in different subdomains, each of which contains a specific subset of INM and lamina proteins.

In addition to LEM2 patches, we also observed tubular structures interconnecting nuclei of adjacent cells, which contained LEM2, lamin A, emerin, MAN1 and BAF, but rarely lamin B and LBR. Currently, the molecular details of how these membranous internuclear connections are formed are unknown. Analyses of the appearance of these structures in living cells suggested that they are formed at telophase emanating from LEM2 patches at chromatin, but we did not see anaphase bridges described in Ce-LEM2–Ce-emerin double-deficient or in Ce-BAF-deficient worms (Liu et al., 2003Go). Although we detected little chromatin in about 20% of these structures, we never found phosphorylated histone H3 as described in C. elegans. Excess LEM2 might disturb the assembly of A-type lamins and/or associated proteins, such as emerin and BAF, during post-metaphase NE reassembly. One could speculate that the internuclear bridges in LEM2-overexpressing cells are also caused by a defect in nuclear membrane assembly after sister chromatid separation, although the insertion of functional NPCs into these bridges was not observed. Interestingly, connected cells remained replication competent and re-entered mitosis normally. Altogether, the observed phenotypes upon overexpression of LEM2 imply functions of the protein in membrane assembly and in the dynamic NE organization during the cell cycle.

The properties of LEM2 presented here also make the protein an interesting candidate for involvement in laminopathy-type diseases (Burke and Stewart, 2002Go; Gotzmann, 2004; Gruenbaum et al., 2005Go; Hutchison and Worman, 2004Go; Mounkes and Stewart, 2004Go). First, LEM2 was found to associate with A-type lamin complexes. Disease-linked mutations in the LMNA gene could disrupt the potential function of this complex in nuclear and chromatin organization. Second, upon loss of lamin A, LEM2 behaved exactly like emerin, implying overlapping functions of these proteins also in vertebrates. As mutations in emerin were found to cause Emery-Dreifuss muscular dystrophy (EDMD) (Bione et al., 1994Go; Emery, 1987Go; Emery and Dreifuss, 1966Go; Manilal et al., 1996Go), LEM2 might be linked to similar diseases. In this context, it is important to note that only 40% of clinically diagnosed EDMD cases are linked to mutations in either lamin A or emerin, whereas 60% of cases are probably caused by mutations in other NE components with similar functions as lamin A/C and emerin. Third, mutations in MAN1 have recently been linked to osteopoikilosis, Buschke-Ollendorf syndrome and melorheostosis characterized by increased bone density (Hellemans et al., 2004Go). However, it is likely that at least some of the clinical phenotypes detected in these diseases are related to the recently identified role of MAN1 as an antagonist of the pathways mediated by BMP, TGF-ß or activin (Lin et al., 2004; Lin et al., 2005Go; Osada et al., 2003Go; Pan et al., 2005Go). So far, we have not been able to detect a similar antagonistic signalling activity for LEM2 (our unpublished data), most likely because LEM2 lacks the C-terminal RRM motif, known to mediate binding to the R-Smads (Osada et al., 2003Go; Pan et al., 2005Go). Nevertheless, signalling-independent functions of MAN1 might also contribute to the disease phenotype, in which case one would also expect clinical symptoms for loss of LEM2.


    Acknowledgments
 
We thank K. Furukawa (Niigata University, Japan), E. Ivessa (Medical University of Vienna, Austria), H. Hermann (DKFZ, Heidelberg, Germany), D. Vaux (Sir William Dunn School of Pathology, Oxford, UK) and C. Stewart (NCI-Frederick, USA) for their generous gifts of reagents. This work was supported by a research grant from the Austrian Science Research Fund (FWF, P15312) to R.F. and by grant HSJ-2 from the `Hochschuljubiläumsstiftung der Stadt Wien' to J.G.


    References
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

Adam, S. A., Marr, R. S. and Gerace, L. (1990). Nuclear protein import in permeabilized mammalian cells requires soluble cytoplasmic factors. J. Cell Biol. 111, 807-816.[Abstract/Free Full Text]

Aravind, L. and Koonin, E. V. (2000). SAP – a putative DNA-binding motif involved in chromosomal organization. Trends Biochem. Sci. 25, 112-114.[CrossRef][Medline]

Ashery-Padan, R., Ulitzur, N., Arbel, A., Goldberg, M., Weiss, A. M., Maus, N., Fisher, P. A. and Gruenbaum, Y. (1997). Localization and posttranslational modifications of otefin, a protein required for vesicle attachment to chromatin, during Drosophila melanogaster development. Mol. Cell. Biol. 17, 4114-4123.[Abstract]

Bengtsson, L. and Wilson, K. L. (2004). Multiple and surprising new functions for emerin, a nuclear membrane protein. Curr. Opin. Cell Biol. 16, 73-79.[CrossRef][Medline]

Berger, R., Theodor, L., Shoham, J., Gokkel, E., Brok-Simoni, F., Avraham, K. B., Copeland, N. G., Jenkins, N. A., Rechavi, G. and Simon, A. J. (1996). The characterization and localization of the mouse thymopoietin/lamina-associated polypeptide 2 gene and its alternatively spliced products. Genome Res. 6, 361-370.[Abstract/Free Full Text]

Bione, S., Maestrini, E., Rivella, S., Mancini, M., Regis, S., Romeo, G. and Toniolo, D. (1994). Identification of a novel X-linked gene responsible for Emery-Dreifuss muscular dystrophy. Nat. Genet. 8, 323-327.[CrossRef][Medline]

Burge, C. and Karlin, S. (1997). Prediction of complete gene structures in human genomic DNA. J. Mol. Biol. 268, 78-94.[CrossRef][Medline]

Burke, B. and Stewart, C. L. (2002). Life at the edge: the nuclear envelope and human disease. Nat. Rev. Mol. Cell. Biol. 3, 575-585.[CrossRef][Medline]

Cai, M., Huang, Y., Ghirlando, R., Wilson, K. L., Craigie, R. and Clore, G. M. (2001). Solution structure of the constant region of nuclear envelope protein LAP2 reveals two LEM-domain structures: one binds BAF and the other binds DNA. EMBO J. 20, 4399-4407.[CrossRef][Medline]

Clements, L., Manilal, S., Love, D. R. and Morris, G. E. (2000). Direct interaction between emerin and lamin A. Biochem. Biophys. Res. Commun. 267, 709-714.[CrossRef][Medline]

Cserzo, M., Eisenhaber, F., Eisenhaber, B. and Simon, I. (2004). TM or not TM: transmembrane protein prediction with low false positive rate using DAS-TMfilter. BioInformatics 20, 136-137.[Abstract/Free Full Text]

de Virgilio, M., Weninger, H. and Ivessa, N. E. (1998). Ubiquitination is required for the retro-translocation of a short-lived luminal endoplasmic reticulum glycoprotein to the cytosol for degradation by the proteasome. J. Biol. Chem. 273, 9734-9743.[Abstract/Free Full Text]

Dechat, T., Gotzmann, J., Stockinger, A., Harris, C. A., Talle, M. A., Siekierka, J. J. and Foisner, R. (1998). Detergent-salt resistance of LAP2alpha in interphase nuclei and phosphorylation-dependent association with chromosomes early in nuclear assembly implies functions in nuclear structure dynamics. EMBO J. 17, 4887-4902.[CrossRef][Medline]

Dechat, T., Korbei, B., Vaughan, O. A., Vlcek, S., Hutchison, C. J. and Foisner, R. (2000a). Lamina-associated polypeptide 2alpha binds intranuclear A-type lamins. J. Cell Sci. 113, 3473-3484.[Abstract]

Dechat, T., Vlcek, S. and Foisner, R. (2000b). Review: lamina-associated polypeptide 2 isoforms and related proteins in cell cycle-dependent nuclear structure dynamics. J. Struct. Biol. 129, 335-345.[CrossRef][Medline]

Dechat, T., Gajewski, A., Korbei, B., Gerlich, D., Daigle, N., Haraguchi, T., Furukawa, K., Ellenberg, J. and Foisner, R. (2004). LAP2{alpha} and BAF transiently localize to telomeres and specific regions on chromatin during nuclear assembly. J. Cell Sci. 117, 6117-6128.[Abstract/Free Full Text]

Dreger, C. K., Konig, A. R., Spring, H., Lichter, P. and Herrmann, H. (2002). Investigation of nuclear architecture with a domain-presenting expression system. J. Struct. Biol. 140, 100-115.[CrossRef][Medline]

Ellenberg, J., Siggia, E. D., Moreira, J. E., Smith, C. L., Presley, J. F., Worman, H. J. and Lippincott-Schwartz, J. (1997). Nuclear membrane dynamics and reassembly in living cells: targeting of an inner nuclear membrane protein in interphase and mitosis. J. Cell Biol. 138, 1193-1206.[Abstract/Free Full Text]

Emery, A. E. (1987). X-linked muscular dystrophy with early contractures and cardiomyopathy (Emery-Dreifuss type). Clin. Genet. 32, 360-367.[Medline]

Emery, A. E. and Dreifuss, F. E. (1966). Unusual type of benign x-linked muscular dystrophy. J. Neurol. Neurosurg. Psychiatry 29, 338-342.[Free Full Text]

Foisner, R. (2001). Inner nuclear membrane proteins and the nuclear lamina. J. Cell Sci. 114, 3791-3792.[Free Full Text]

Foisner, R. (2003). Cell cycle dynamics of the nuclear envelope. ScientificWorldJournal 3, 1-20.[CrossRef][Medline]

Foisner, R. and Gerace, L. (1993). Integral membrane proteins of the nuclear envelope interact with lamins and chromosomes, and binding is modulated by mitotic phosphorylation. Cell 73, 1267-1279.[CrossRef][Medline]

Furukawa, K. (1999). LAP2 binding protein 1 (L2BP1/BAF) is a candidate mediator of LAP2-chromatin interaction. J. Cell Sci. 112, 2485-2492.[Abstract]

Furukawa, K., Pante, N., Aebi, U. and Gerace, L. (1995). Cloning of a cDNA for lamina-associated polypeptide 2 (LAP2) and identification of regions that specify targeting to the nuclear envelope. EMBO J. 14, 1626-1636.[Medline]

Furukawa, K., Fritze, C. E. and Gerace, L. (1998). The major nuclear envelope targeting domain of LAP2 coincides with its lamin binding region but is distinct from its chromatin interaction domain. J. Biol. Chem. 273, 4213-4219.[Abstract/Free Full Text]

Goldman, R. D., Gruenbaum, Y., Moir, R. D., Shumaker, D. K. and Spann, T. P. (2002). Nuclear lamins: building blocks of nuclear architecture. Genes Dev. 16, 533-547.[Free Full Text]

Gotzmann, J., Vlcek, S. and Foisner, R. (2000). Caspase-mediated cleavage of the chromosome-binding domain of lamina-associated polypeptide 2 alpha. J. Cell Sci. 113, 3769-3780.[Abstract]

Gotzmann, J., Huber, H., Thallinger, C., Wolschek, M., Jansen, B., Schulte-Hermann, R., Beug, H. and Mikulits, W. (2002). Hepatocytes convert to a fibroblastoid phenotype through the cooperation of TGF-beta1 and Ha-Ras: steps towards invasiveness. J. Cell Sci. 115, 1189-1202.[Abstract/Free Full Text]

Gotzmann, J. and Foisner, R. (2004). Lamins and emerin in muscular dystrophy: the nuclear envelope connection. In Molecular Mechanisms of Muscular Dystrophies, Chapter 12 (ed. S. J. Winder), pp. 1-18. Georgetown, Texas: Landes Biosciences.

Gruenbaum, Y., Lee, K. K., Liu, J., Cohen, M. and Wilson, K. L. (2002). The expression, lamin-dependent localization and RNAi depletion phenotype for emerin in C. elegans. J. Cell Sci. 115, 923-929.[Abstract/Free Full Text]

Gruenbaum, Y., Margalit, A., Goldman, R. D., Shumaker, D. K. and Wilson, K. L. (2005). The nuclear lamina comes of age. Nat. Rev. Mol. Cell. Biol. 6, 21-31.[CrossRef][Medline]

Haraguchi, T., Koujin, T., Segura-Totten, M., Lee, K. K., Matsuoka, Y., Yoneda, Y., Wilson, K. L. and Hiraoka, Y. (2001). BAF is required for emerin assembly into the reforming nuclear envelope. J. Cell Sci. 114, 4575-4585.

Harris, C. A., Andryuk, P. J., Cline, S., Chan, H. K., Natarajan, A., Siekierka, J. J. and Goldstein, G. (1994). Three distinct human thymopoietins are derived from alternatively spliced mRNAs. Proc. Natl. Acad. Sci. USA 91, 6283-6287.[Abstract/Free Full Text]

Hellemans, J., Preobrazhenska, O., Willaert, A., Debeer, P., Verdonk, P. C., Costa, T., Janssens, K., Menten, B., Van Roy, N., Vermeulen, S. J. et al. (2004). Loss-of-function mutations in LEMD3 result in osteopoikilosis, Buschke-Ollendorff syndrome and melorheostosis. Nat. Genet. 36, 1213-1218.[CrossRef][Medline]

Holaska, J. M., Lee, K. K., Kowalski, A. K. and Wilson, K. L. (2003). Transcriptional repressor germ cell-less (GCL) and barrier to autointegration factor (BAF) compete for binding to emerin in vitro. J. Biol. Chem. 278, 6969-6975.[Abstract/Free Full Text]

Holaska, J. M., Kowalski, A. K. and Wilson, K. L. (2004). Emerin caps the pointed end of actin filaments: evidence for an actin cortical network at the nuclear inner membrane. PLoS Biol. 2, E231.[CrossRef][Medline]

Holmer, L. and Worman, H. J. (2001). Inner nuclear membrane proteins: functions and targeting. Cell. Mol. Life Sci. 58, 1741-1747.[CrossRef][Medline]

Holt, I., Ostlund, C., Stewart, C. L., Man, N., Worman, H. J. and Morris, G. E. (2003). Effect of pathogenic mis-sense mutations in lamin A on its interaction with emerin in vivo. J. Cell Sci. 116, 3027-3035.[Abstract/Free Full Text]

Hutchison, C. J. and Worman, H. J. (2004). A-type lamins: guardians of the soma? Nat. Cell Biol. 6, 1062-1067.[CrossRef][Medline]

Izumi, M., Vaughan, O. A., Hutchison, C. J. and Gilbert, D. M. (2000). Head and/or CaaX domain deletions of lamin proteins disrupt preformed lamin A and C but not lamin B structure in mammalian cells. Mol. Biol. Cell 11, 4323-4337.[Abstract/Free Full Text]

Jayasinghe, S., Hristova, K. and White, S. H. (2001). MPtopo: A database of membrane protein topology. Protein Sci. 10, 455-458.[CrossRef][Medline]

Juan, G., Traganos, F., James, W. M., Ray, J. M., Roberge, M., Sauve, D. M., Anderson, H. and Darzynkiewicz, Z. (1998). Histone H3 phosphorylation and expression of cyclins A and B1 measured in individual cells during their progression through G2 and mitosis. Cytometry 32, 71-77.[CrossRef][Medline]

Krogh, A., Larsson, B., von Heijne, G. and Sonnhammer, E. L. (2001). Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J. Mol. Biol. 305, 567-580.[CrossRef][Medline]

Laguri, C., Gilquin, B., Wolff, N., Romi-Lebrun, R., Courchay, K., Callebaut, I., Worman, H. J. and Zinn-Justin, S. (2001). Structural characterization of the LEM motif common to three human inner nuclear membrane proteins. Structure (Camb.) 9, 503-511.

Lee, K. K. and Wilson, K. L. (2004). All in the family: evidence for four new LEM-domain proteins Lem2 (NET-25), Lem3, Lem4 and Lem5 in the human genome. Symp. Soc. Exp. Biol. 56, 329-339.

Lee, K. K., Gruenbaum, Y., Spann, P., Liu, J. and Wilson, K. L. (2000). C. elegans nuclear envelope proteins emerin, MAN1, lamin, and nucleoporins reveal unique timing of nuclear envelope breakdown during mitosis. Mol. Biol. Cell 11, 3089-3099.[Abstract/Free Full Text]

Lee, K. K., Haraguchi, T., Lee, R. S., Koujin, T., Hiraoka, Y. and Wilson, K. L. (2001). Distinct functional domains in emerin bind lamin A and DNA-bridging protein BAF. J. Cell Sci. 114, 4567-4573.

Letunic, I., Copley, R. R., Schmidt, S., Ciccarelli, F. D., Doerks, T., Schultz, J., Ponting, C. P. and Bork, P. (2004). SMART 4.0: towards genomic data integration. Nucleic Acids Res. 32, D142-D144.[Abstract/Free Full Text]

Lin, F., Blake, D. L., Callebaut, I., Skerjanc, I. S., Holmer, L., McBurney, M. W., Paulin-Levasseur, M. and Worman, H. J. (2000). MAN1, an inner nuclear membrane protein that shares the LEM domain with lamina-associated polypeptide 2 and emerin. J. Biol. Chem. 275, 4840-4847.[Abstract/Free Full Text]

Lin, F., Morrison, J. M., Wu, W. and Worman, H. J. (2005). MAN1, an integral protein of the inner nuclear membrane, binds Smad2 and Smad3 and antagonizes transforming growth factor-{beta} signaling. Hum. Mol. Genet. 14, 437-445.[Abstract/Free Full Text]

Liu, J., Lee, K. K., Segura-Totten, M., Neufeld, E., Wilson, K. L. and Gruenbaum, Y. (2003). MAN1 and emerin have overlapping function(s) essential for chromosome segregation and cell division in Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 100, 4598-4603.[Abstract/Free Full Text]

Makatsori, D., Kourmouli, N., Polioudaki, H., Shultz, L. D., McLean, K., Theodoropoulos, P. A., Singh, P. B. and Georgatos, S. D. (2004). The inner nuclear membrane protein lamin B receptor forms distinct microdomains and links epigenetically marked chromatin to the nuclear envelope. J. Biol. Chem. 279, 25567-25573.[Abstract/Free Full Text]

Manilal, S., Nguyen, T. M., Sewry, C. A. and Morris, G. E. (1996). The Emery-Dreifuss muscular dystrophy protein, emerin, is a nuclear membrane protein. Hum. Mol. Genet. 5, 801-808.[Abstract/Free Full Text]

Mans, B. J., Anantharaman, V., Aravind, L. and Koonin, E. V. (2004). Comparative genomics, evolution and origins of the nuclear envelope and nuclear pore complex. Cell Cycle 3, 1612-1637.[Medline]

Mansharamani, M. and Wilson, K. L. (2005). Nuclear membrane protein MAN1: Direct binding to emerin in vitro and two modes of binding to BAF. J. Biol. Chem. 280, 13863-13870.[Abstract/Free Full Text]

Markiewicz, E., Dechat, T., Foisner, R., Quinlan, R. A. and Hutchison, C. J. (2002). Lamin A/C binding protein LAP2alpha is required for nuclear anchorage of retinoblastoma protein. Mol. Biol. Cell 13, 4401-4413.[Abstract/Free Full Text]

Maske, C. P. and Vaux, D. J. (2004). CAAX-dependent modifications of the lamin proteins in the organization of the nuclear periphery. Symp. Soc. Exp. Biol. 56, 317-328.

Mounkes, L. C. and Stewart, C. L. (2004). Aging and nuclear organization: lamins and progeria. Curr. Opin. Cell Biol. 16, 322-327.[CrossRef][Medline]

Muchir, A., Medioni, J., Laluc, M., Massart, C., Arimura, T., van der Kooi, A. J., Desguerre, I., Mayer, M., Ferrer, X., Briault, S. et al. (2004). Nuclear envelope alterations in fibroblasts from patients with muscular dystrophy, cardiomyopathy, and partial lipodystrophy carrying lamin A/C gene mutations. Muscle Nerve 30, 444-450.[CrossRef][Medline]

Nili, E., Cojocaru, G. S., Kalma, Y., Ginsberg, D., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Berger, R., Shaklai, S., Amariglio, N. et al. (2001). Nuclear membrane protein LAP2beta mediates transcriptional repression alone and together with its binding partner GCL (germ-cell-less). J. Cell Sci. 114, 3297-3307.

Osada, S., Ohmori, S. Y. and Taira, M. (2003). XMAN1, an inner nuclear membrane protein, antagonizes BMP signaling by interacting with Smad1 in Xenopus embryos. Development 130, 1783-1794.[Abstract/Free Full Text]

Ostlund, C., Bonne, G., Schwartz, K. and Worman, H. J. (2001). Properties of lamin A mutants found in Emery-Dreifuss muscular dystrophy, cardiomyopathy and Dunnigan-type partial lipodystrophy. J. Cell Sci. 114, 4435-4445.

Ovcharenko, I., Boffelli, D. and Loots, G. G. (2004). eShadow: a tool for comparing closely related sequences. Genome Res. 14, 1191-1198.[Abstract/Free Full Text]

Pan, D., Estevez-Salmeron, L. D., Stroschein, S. L., Zhu, X., He, J., Zhou, S. and Luo, K. (2005). The integral inner nuclear membrane protein MAN1 physically interacts with the R-Smad proteins to repress signaling by the TGFbeta superfamily of cytokines. J. Biol. Chem. 280, 15992-16001.[Abstract/Free Full Text]

Raharjo, W. H., Enarson, P., Sullivan, T., Stewart, C. L. and Burke, B. (2001). Nuclear envelope defects associated with LMNA mutations cause dilated cardiomyopathy and Emery-Dreifuss muscular dystrophy. J. Cell Sci. 114, 4447-4457.

Rodriguez-Navarro, S., Igual, J. C. and Perez-Ortin, J. E. (2002). SRC1: an intron-containing yeast gene involved in sister chromatid segregation. Yeast 19, 43-54.[CrossRef][Medline]

Schirmer, E. C., Florens, L., Guan, T., Yates, J. R., 3rd. and Gerace, L. (2003). Nuclear membrane proteins with potential disease links found by subtractive proteomics. Science 301, 1380-1382.[Abstract/Free Full Text]

Schultz, J., Milpetz, F., Bork, P. and Ponting, C. P. (1998). SMART, a simple modular architecture research tool: identification of signaling domains. Proc. Natl. Acad. Sci. USA 95, 5857-5864.[Abstract/Free Full Text]

Segura-Totten, M. and Wilson, K. L. (2004). BAF: roles in chromatin, nuclear structure and retrovirus integration. Trends Cell Biol. 14, 261-266.[CrossRef][Medline]

Segura-Totten, M., Kowalski, A. K., Craigie, R. and Wilson, K. L. (2002). Barrier-to-autointegration factor: major roles in chromatin decondensation and nuclear assembly. J. Cell Biol. 158, 475-485.[Abstract/Free Full Text]

Shimi, T., Koujin, T., Segura-Totten, M., Wilson, K. L., Haraguchi, T. and Hiraoka, Y. (2004). Dynamic interaction between BAF and emerin revealed by FRAP, FLIP, and FRET analyses in living HeLa cells. J. Struct. Biol. 147, 31-41.[CrossRef][Medline]

Shumaker, D. K., Lee, K. K., Tanhehco, Y. C., Craigie, R. and Wilson, K. L. (2001). LAP2 binds to BAF.DNA complexes: requirement for the LEM domain and modulation by variable regions. EMBO J. 20, 1754-1764.[CrossRef][Medline]

Sullivan, T., Escalante-Alcalde, D., Bhatt, H., Anver, M., Bhat, N., Nagashima, K., Stewart, C. L. and Burke, B. (1999). Loss of A-type lamin expression compromises nuclear envelope integrity leading to muscular dystrophy. J. Cell Biol. 147, 913-920.[Abstract/Free Full Text]

Thompson, J. D., Higgins, D. G. and Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673-4680.[Abstract/Free Full Text]

Vaughan, A., Alvarez-Reyes, M., Bridger, J. M., Broers, J. L., Ramaekers, F. C., Wehnert, M., Morris, G. E., Whitfield, W. G. F. and Hutchison, C. J. (2001). Both emerin and lamin C depend on lamin A for localization at the nuclear envelope. J. Cell Sci. 114, 2577-2590.

Vergnes, L., Peterfy, M., Bergo, M. O., Young, S. G. and Reue, K. (2004). Lamin B1 is required for mouse development and nuclear integrity. Proc. Natl. Acad. Sci. USA 101, 10428-10433.[Abstract/Free Full Text]

Vlcek, S., Korbei, B. and Foisner, R. (2002). Distinct functions of the unique C terminus of LAP2alpha in cell proliferation and nuclear assembly. J. Biol. Chem. 277, 18898-18907.[Abstract/Free Full Text]

Wagner, N., Schmitt, J. and Krohne, G. (2004). Two novel LEM-domain proteins are splice products of the annotated Drosophila melanogaster gene CG9424 (Bocksbeutel). Eur. J. Cell Biol. 82, 605-616.[CrossRef][Medline]

Worman, H. J., Yuan, J., Blobel, G. and Georgatos, S. D. (1988). A lamin B receptor in the nuclear envelope. Proc. Natl. Acad. Sci. USA 85, 8531-8534.[Abstract/Free Full Text]

Ye, Q. and Worman, H. J. (1994). Primary structure analysis and lamin B and DNA binding of human LBR, an integral protein of the nuclear envelope inner membrane. J. Biol. Chem. 269, 11306-11311.[Abstract/Free Full Text]

Zastrow, M. S., Vlcek, S. and Wilson, K. L. (2004). Proteins that bind A-type lamins: integrating isolated clues. J. Cell Sci. 117, 979-987.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
JCBHome page
S. E. Grund, T. Fischer, G. G. Cabal, O. Antunez, J. E. Perez-Ortin, and E. Hurt
The inner nuclear membrane protein Src1 associates with subtelomeric genes and alters their regulated gene expression
J. Cell Biol., September 8, 2008; 182(5): 897 - 910.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
B. S. Pinto, S. R. Wilmington, E. E. L. Hornick, L. L. Wallrath, and P. K. Geyer
Tissue-Specific Defects Are Caused by Loss of the Drosophila MAN1 LEM Domain Protein
Genetics, September 1, 2008; 180(1): 133 - 145.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Mulky, T. V. Cohen, S. V. Kozlov, B. Korbei, R. Foisner, C. L. Stewart, and V. N. KewalRamani
The LEM Domain Proteins Emerin and LAP2{alpha} Are Dispensable for Human Immunodeficiency Virus Type 1 and Murine Leukemia Virus Infections
J. Virol., June 15, 2008; 82(12): 5860 - 5868.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
T. Haraguchi, T. Koujin, H. Osakada, T. Kojidani, C. Mori, H. Masuda, and Y. Hiraoka
Nuclear localization of barrier-to-autointegration factor is correlated with progression of S phase in human cells
J. Cell Sci., June 15, 2007; 120(12): 1967 - 1977.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
N. Naetar, S. Hutter, D. Dorner, T. Dechat, B. Korbei, J. Gotzmann, H. Beug, and R. Foisner
LAP2{alpha}-binding protein LINT-25 is a novel chromatin-associated protein involved in cell cycle exit
J. Cell Sci., March 1, 2007; 120(5): 737 - 747.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. M. Holaska, S. Rais-Bahrami, and K. L. Wilson
Lmo7 is an emerin-binding protein that regulates the transcription of emerin and many other muscle-relevant genes
Hum. Mol. Genet., December 1, 2006; 15(23): 3459 - 3472.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
G. S. Wilkie and E. C. Schirmer
Guilt by Association: The Nuclear Envelope Proteome and Disease
Mol. Cell. Proteomics, October 1, 2006; 5(10): 1865 - 1875.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Caputo, J. Couprie, I. Duband-Goulet, E. Konde, F. Lin, S. Braud, M. Gondry, B. Gilquin, H. J. Worman, and S. Zinn-Justin
The Carboxyl-terminal Nucleoplasmic Region of MAN1 Exhibits a DNA Binding Winged Helix Domain
J. Biol. Chem., June 30, 2006; 281(26): 18208 - 18215.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brachner, A.
Right arrow Articles by Gotzmann, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brachner, A.
Right arrow Articles by Gotzmann, J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?