spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 1 March 2005
doi: 10.1242/jcs.01726


Journal of Cell Science 118, 1299-1307 (2005)
Published by The Company of Biologists 2005
This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jcs.01726v1
118/6/1299    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sommerville, J.
Right arrow Articles by Pederson, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sommerville, J.
Right arrow Articles by Pederson, T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Research Article

Signal recognition particle assembly in relation to the function of amplified nucleoli of Xenopus oocytes

John Sommerville1,*, Craig L. Brumwell2,{ddagger}, Joan C. Ritland Politz2 and Thoru Pederson2

1 Division of Cell and Molecular Biology, School of Biology, University of St Andrews, KY16 9TS, UK
2 Department of Biochemistry and Molecular Pharmacology, and Program in Cell Dynamics, University of Massachusetts Medical School, Worcester, MA 01605, USA

* Author for correspondence (e-mail: js15{at}st-and.ac.uk)

Accepted 13 January 2005


    Summary
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The signal recognition particle (SRP) is a ribonucleoprotein machine that controls the translation and intracellular sorting of membrane and secreted proteins. The SRP contains a core RNA subunit with which six proteins are assembled. Recent work in both yeast and mammalian cells has identified the nucleolus as a possible initial site of SRP assembly. In the present study, SRP RNA and protein components were identified in the extrachromosomal, amplified nucleoli of Xenopus laevis oocytes. Fluorescent SRP RNA microinjected into the oocyte nucleus became specifically localized in the nucleoli, and endogenous SRP RNA was also detected in oocyte nucleoli by RNA in situ hybridization. An initial step in the assembly of SRP involves the binding of the SRP19 protein to SRP RNA. When green fluorescent protein (GFP)-tagged SRP19 protein was injected into the oocyte cytoplasm it was imported into the nucleus and became concentrated in the amplified nucleoli. After visiting the amplified nucleoli, GFP-tagged SRP19 protein was detected in the cytoplasm in a ribonucleoprotein complex, having a sedimentation coefficient characteristic of the SRP. These results suggest that the amplified nucleoli of Xenopus oocytes produce maternal stores not only of ribosomes, the classical product of nucleoli, but also of SRP, presumably as a global developmental strategy for stockpiling translational machinery for early embryogenesis.

Key words: Immunohistochemistry, In situ hybridization, Microinjection, Nuclear organization, Nucleolar function


    Introduction
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The signal recognition particle (SRP) is a ribonucleoprotein complex that directs the spatially correct synthesis and traffic of membrane and secreted proteins (Walter and Johnson, 1994Go; Walter et al., 2000Go). In vertebrates, the SRP consists of a ~300 nucleotide-long RNA and six proteins (Walter and Johnson, 1994Go). The structure and function of the SRP is currently understood in considerable detail (Keenan et al., 1998Go; Batey et al., 2000Go; Walter et al., 2000Go; Weichenrieder et al., 2000Go; Batey et al., 2001Go; Beckmann et al., 2001Go; Keenan et al., 2001Go; Weichenrieder et al., 2001Go; Wild et al., 2001Go; Hainzl et al., 2002Go; Oubridge et al., 2002Go; Pool et al., 2002Go; Nagai et al., 2003Go), but less is known about how this critically important ribonucleoprotein particle is assembled in the cell. Studies in both mammalian cells (Jacobson and Pederson, 1998Go; Politz et al., 2000Go; Politz et al., 2002Go; Alavian et al., 2004Go) and yeast (Ciufo and Brown, 2000Go; Grosshans et al., 2001Go) have implicated the nucleolus as a possible initial site in the assembly of the SRP. The presence of SRP components in yeast and mammalian nucleoli constitutes one of several lines of evidence that the nucleolus has functions beyond its classically established role in ribosome synthesis (Pederson, 1998Go; Olson et al., 2000Go; Olson et al., 2002Go; Gerbi et al., 2003Go).

The oocytes of amphibians and certain other eukaryotic organisms contain a special class of multiple nucleoli (Montgomery, 1898Go; Painter and Taylor, 1942Go). These multiple nucleoli are amplified from the genomic ribosomal RNA genes into hundreds or thousands of extrachromosomal nucleoli that produce the massive amounts of maternal ribosomes needed to support early embryonic development (Brown and Dawid, 1968Go; Gall, 1968Go; Macgregor, 1972Go; Gall, 1978Go). Because these specialized nucleoli have such a clear developmental purpose, we were interested to know whether SRP components might also be present within them. If the biological rationale of the amplified nucleoli is to produce a maternal stockpile not only of ribosomes per se, but of translational machinery altogether, it might be anticipated that they also are committed to SRP biosynthesis. The findings we now report strongly support this hypothesis and suggest that at least the initial steps in SRP ribonucleoprotein assembly, involving SRP RNA and SRP19 protein, occur in these nucleoli.


    Materials and Methods
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Oocyte microinjection experiments
Female Xenopus laevis at 8-9 cm length were obtained from Blades Biologicals (Kent, UK) and maintained in an aquarium under optimal conditions for further growth. Ovary was removed from mature animals killed under Schedule 1 (Home Office, London, Animals Scientific Procedures Act 1986) and individual oocytes were released by stirring the tissue in a solution of 0.2% collagenase (Sigma, Type I) in OR2 medium minus Ca2+ (Evans and Kay, 1991Go). Mid-vitellogenic oocytes at stage IV/V (Dumont, 1977) were selected and maintained in OR2 medium (including 1 mM CaCl2) at 19-20°C. Fluorescent RNA or protein was microinjected into either the cytoplasm or germinal vesicle (nucleus) as previously described in detail (Ryan et al., 1999Go). The injection volume was typically 20 nl for cytoplasmic and 10 nl for nuclear injection. Oocytes were dissected under oil into germinal vesicles (GVs) and cytoplasm at various times after microinjection, and RNA or protein distribution was analysed as detailed below. GV spreads were prepared as previously described (Callan et al., 1987Go).

Fluorescent RNA
Human SRP RNA, which shares ~87% sequence homology with Xenopus SRP RNA (Ullu and Tschudi, 1984Go), was used in this study. Plasmid phR (Zwieb, 1991Go; Jacobson and Pederson, 1998Go) was linearized by DraI digestion and transcribed with T7 RNA polymerase in the presence of all four ribonucleoside triphosphates and 5-Alexa 488-UTP (Molecular Probes) present at the same concentration as UTP, using a Megascript kit (Ambion). A transcript with a sequence complementary to canine SRP RNA was transcribed with SP6 RNA polymerase from EcoR1 linearized plasmid pSP7SL (Strub et al., 1991Go) with ribonucleoside triphosphates and 5-Alexa 488-UTP as above. Transcripts were purified using Biogel P-30 spin columns (BioRad), ethanol precipitated and dissolved at a concentration of approximately 1 µg/µl in water. Injected specific (sense) and control (antisense) probes had comparable levels of fluorescence.

Immunoblots and immunocytochemistry
GVs and cytoplasms were isolated and extracted as described previously (Smillie and Sommerville, 2002Go). Extracts equivalent to four GVs and one cytoplasm were denatured in an equal volume of Laemmli sample buffer (Sigma) and subjected to electrophoresis on 12% SDS-polyacrylamide gels and then electro-transferred onto nitrocellulose membrane (`Protran', Schleicher and Schull). Transfers were blocked overnight at 4°C in 10% dried nonfat milk dissolved in phosphate-buffered saline containing 0.1% Tween 20 (PBST) followed by incubation with a primary antibody diluted in PBST for 1 hour at 20°C, washing through five changes of PBST, and then incubated with a peroxidase-conjugated secondary antibody diluted in PBST. Bands were developed using the ECL (Amersham Biosciences) procedure.

GV spreads were blocked in 10% fetal calf serum in PBS (FCS/PBS), incubated with a primary antibody diluted in FCS/PBS for 1 hour at 20°C, washed through five changes of PBS and then incubated with a fluorochrome-conjugated secondary antibody diluted in FCS/PBS). After further washing with PBS, preparations were mounted in 50% glycerol, 1 mg/ml p-phenylenediamine, pH 8.5, and viewed in a Leitz Ortholux fluorescence microscope. Controls omitting a primary antibody incubation showed no secondary antibody labelling.

GFP-labelled SRP19 protein
The insert from a fusion plasmid described previously (Politz et al., 2000Go) containing the coding sequence for EGFP-SRP19 was cloned into a bacterial expression plasmid (pET vector, Novagen) containing a [His]6 in-frame coding sequence (Henry et al., 1997Go) to create a recombinant plasmid that would express H2N-[His]6-EGFP-SRP19-COOH. Escherichia coli was transformed with this plasmid and the expressed GFP-SRP19 protein was recovered and purified by selection on a Ni NTA agarose column (Qiagen) essentially as described previously (Henry et al., 1997Go), except that samples were concentrated using Biomax-100K filters (Millipore). The purified protein was diluted in water at a concentration of 1 µg/µl for microinjection. The localization of GFP-SRP19 protein in the nucleus after microinjection was analysed by fluorescence microscopy of spread GV contents. The level of GFP-SRP19 protein in the nuclear or cytoplasmic fractions was also determined by immunoblotting using a rabbit antibody to GFP (kindly provided by David Russell, Washington University School of Medicine) at a dilution of 1/8000 and peroxidase-conjugated anti-rabbit antibody (Sigma) at a dilution of 1/10,000. In some experiments, oocytes were incubated with leptomycin B (kindly provided by Minori Yoshida, University of Tokyo) at a concentration of 50 ng/ml. In other experiments, oocytes were co-injected in the cytoplasm with both GFP-SRP19 and an equimolar amount of recombinant human importin-{alpha}2 (Calbiochem). Assembly of GFP-SRP19 into a cytoplasmic particle was investigated by sedimentation of cytoplasmic extracts, prepared as previously described (Smillie and Sommerville, 2002Go) on 15-30% linear glycerol gradients. Some samples were digested before gradient analysis with ribonuclease A at 1 µg/ml for 30 minutes in the absence of Mg2+ (Walter and Blobel, 1983Go). Fluorescence in each fraction was read first in a fluorimeter (VersaFluorTM, Biorad) with filters appropriate for EGFP. Protein was then precipitated from the gradient fractions with 3 volumes of acetone at –20°C and pelleted by centrifugation at 10,000 g for 20 minutes. Dried pellets were dissolved in Laemmli sample buffer (Sigma) and subjected to immunoblot analysis with GFP antibody.

RT-PCR
In all, 900, 300, 120, 50, 30 and 25 oocytes at stage I, II, III, IV, V and VI, respectively, were selected to produce equal volumes of clarified supernatant after extraction with trichlorotrifluoroethane (Sigma) and centrifugation at 10,000 g for 2 minutes, followed by RNA extraction as described previously (Evans and Kay, 1991Go). RT-PCR (Ready-to-Go beads, Amersham Biosciences) was run using primers specific for Xenopus SRP RNA (forward: 5'GCTGTGGCGTGTGCCTGTAATCCAG and reverse: 5'GGGTTTTGACCTGCTCCGTTTCCGAC) and SRP54 mRNA (forward: 5'CTGGAGGAAATGGCATCTGGCTTGA and reverse: 5'TAGAAGGGTATTCTGGCTTTTGTGGC). RT-PCR products amplified after 15, 20 and 25 cycles at 95°C, 48°C and 72°C, respectively, in a MiniCycler (MJ Research), were separated on 2% agarose gels and 5S RNA was separated directly from the total RNA sample. Intensity of staining with ethidium bromide was captured using a GeneSnap system and measured using GeneTools (Synoptics Ltd).

RNA in situ hybridization
GV spread preparations were incubated with a tetramethylrhodamine-6-isothiocyanate-labelled peptide nucleic acid probe synthesized by Applied Biosystems (Politz et al., 2002Go), complementary to nucleotides 231-245 of Xenopus SRP RNA. Hybridization was carried out with 0.3 ng/µl of probe in 40% formamide, 4x SSC, 0.1 M phosphate, pH 7.2, 0.2 mg/ml tRNA and 0.2 mg/ml denatured sonicated DNA, for 12 hours at 42°C. Washes were as described (Politz et al., 2002Go). As a control, a peptide nucleic acid probe complementary to nucleotides 192-206 of Schizosaccharomyces pombe SRP RNA was used.

Detection of endogenous SRP19 protein
To detect endogenous SRP19 protein, extracts were electrophoresed on 16% polyacrylamide gels and transferred to nitrocellulose as above. Immunoblotting was with a chicken antibody against the human SRP19 protein (see below) diluted 1/5000, followed by peroxidase-conjugated rabbit anti-chicken IgG (Sigma) diluted 1/10,000.

GV spreads were immunostained with the SRP19 antibody diluted 1/200, followed by FITC-conjugated rabbit anti-chicken IgG (Sigma) diluted 1/2000.

The antibody to human SRP19 protein was generated in collaboration with Jos Raats and Walther van Venrooij, University of Nijmegen, Holland. Human SRP19 protein was expressed in E. coli transformed with a (His)6-tagged human SRP19 plasmid and purified as detailed previously (Henry et al., 1997Go) and then conjugated to keyhole limpet haemocyanin. Chickens (Gallus domesticus) were immunized and sera were screened by ELISA against the immunogen. An animal displaying a strong immune response (threshold detection at a serum dilution of 1:12,800) was boosted with another injection. Immunoglobulin Y was isolated from eggs laid by this animal by subjecting pooled yolks to lipoprotein depletion and ammonium sulphate precipitation (Eggcellent IgY Purification Kit, Pierce Biotechnology), followed by affinity purification on a Sepharose column to which the recombinant SRP19 protein had been coupled.

Image acquisition
Preparations were examined using a Leitz Ortholux Fluorescence Microscope (100x oil-immersion objective) and photographed on Kodak Ektachrome P1600 colour reversal film (Kodak Eastman). Frames were scanned with a Microtek FilmScan 35 using CyberView interface software (Microtek Europe B.V.) and imported into Adobe Photoshop. Any recolouring was carried out using the Photoshop application and merged constrained images were created and flattened.


    Results
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Synthesis of oocyte SRP components coincides with activity of amplified nucleoli
To establish the occurrence and timing of SRP biosynthesis, equal masses of oocytes from Xenopus stages I to VI (Dumont, 1972Go) were examined for the presence of SRP RNA, mRNA encoding the 54 kDa SRP protein (SRP54, which is the final protein to be added to the SRP in a reaction that appears to occur in the cytoplasm) and the 19 kDa SRP protein (SRP19) itself.

RT-PCR was set up with primers specific for Xenopus SRP RNA and SRP54 mRNA, using total RNA from each oogenic stage as templates, and reaction products were recorded from agarose gels after 15, 20 and 25 cycles. Products were detected at all oogenic stages (Fig. 1A). To compare the levels of SRP RNA with another RNA polymerase III (pol III) transcript, the amount of endogenous 5S RNA was recorded from the same samples (Fig. 1A). Conversion of band densities to amounts of RNA per oocyte (Fig. 1D) showed that whereas accumulation of 5S RNA occurs during previtellogenesis (stages I to II), accumulation of SRP RNA, which is also transcribed by pol III, occurs throughout oogenesis (including vitellogenic stages II to VI), although at a slower rate after stage IV. Thus, the kinetics of SRP RNA synthesis in oocytes appear to be more akin to those of ribosomal RNA (Scheer, 1973Go; Scheer et al., 1976Go) than those of the major pol III species, 5S RNA and tRNA (Ford, 1971Go; Mairy and Denis, 1971Go). On estimating the amounts per oocyte of SRP54 mRNA from RT-PCR (Fig. 1A) and the amounts of SRP19 protein contained within particles sedimenting at ~11S (the sedimentation rate of mature mammalian SRP) (Walter and Blobel, 1983Go) by immunoblotting (Fig. 1B,C), it appears that the kinetics of synthesis of SRP proteins are similar to those of SRP RNA (Fig. 1D). Given that accumulation of ribosomes in oocytes is dependent on the development of active, amplified nucleoli (Miller and Beatty, 1969Go), we questioned whether the observed accumulation of SRP components through mid-vitellogenesis likewise involves active, amplified nucleoli.



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 1. Expression of endogenous SRP RNA and SRP proteins in Xenopus oocytes. (A) Staged oocytes were collected to give an equal volume of soluble extract and RNA was extracted for RT-PCR and quantitation on 2% agarose gels. RT-PCR products were generated using primers specific for SRP RNA (20 cycles) and SRP54 mRNA (25 cycles), and 5S RNA was separated directly from the total RNA sample. (B) Sedimentation analysis of SRP19 protein present in cytoplasms isolated from stage IV oocytes. Gradient fractions were immunoblotted using a chicken antibody directed against SRP19 protein. Reactive bands were detected in fractions sedimenting at 10-12 S. Positions of sedimentation mass markers run in a parallel gradient are indicated by stars (from left: haemoglobin, Mr ~67,000; alcohol dehydrogenase, Mr ~180,000; apoferritin, Mr ~443,000; microglobulin, Mr ~670,000; immunoglobulin M, Mr ~960,000: see also Fig. 5). Positions of electrophoretic mass markers are shown (kDa). (C) Immunoblot using anti-SRP19 of the 10-12 S fraction isolated from extracts equivalent to the range of oocyte stages and oocyte numbers described in (A). (D) Relative amounts of product per oocyte were calculated by dividing amounts detected from equal masses of oocytes by the number of oocytes contained in that mass at each stage. Graph shows: SRP RNA (open circles), SRP54 mRNA (open squares), 5 S RNA (black circles) and SRP19 protein (black squares). Intensity of staining with ethidium bromide or recorded on film after ECL was captured using a GeneSnap system and measured using GeneTools (Synoptics Ltd).

 



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 5. Sedimentation analysis of GFP-SRP19 present in cytoplasm isolated from injected oocytes. The injected oocytes were either immediately enucleated and frozen or incubated for 48 hours before enucleation and freezing. Half of the 48 hour sample was treated with ribonuclease A (RNase) for 30 minutes in buffer lacking Mg2+. Clarified cytoplasms from 25 oocytes taken immediately after injection (open circles), after 48 hours (filled circles) and after 48 hours and treated with RNase (open squares) were loaded on glycerol gradients and centifuged under the same conditions as described in Fig. 1. Gradient fractions were collected and (A) scanned at for fluorescence at 510 nm (FL, arbitrary units). Fractions from parallel gradients loaded with the sedimentation markers described in Fig. 1 were scanned at 280 nm (Mr, open triangles). The predicted sedimentation position of SRP (11 S, Mr ~335,000) is indicated by an arrow. Fractions were then precipitated with acetone and (B) analysed by immunoblotting using antibodies to GFP or, in the case of markers, staining of the gel with Coomassie brilliant blue.

 
SRP RNA localizes in the amplified nucleoli after microinjection into the GV
Fluorescent human SRP RNA was injected into the germinal vesicles (GVs) of stage IV/V oocytes and its distribution among nuclear components was examined in spread preparations of isolated GVs (Fig. 2). At 18 hours after microinjection, distinct, strong fluorescence was observed in the nucleoli (Fig. 2C). No significant signal was observed in either the chromosomes or Cajal bodies (Fig. 2A,B), nor in snurposomes (present throughout the field). All of the amplified nucleoli examined were labelled. When GVs were analysed at shorter times after microinjection of SRP RNA, there was no indication of fluorescence in nuclear structures other than the nucleoli, suggesting that SRP RNA directly localizes in the nucleoli after microinjection, rather than first passing through some other nuclear structures. The nucleolar localization of SRP RNA was sequence-specific, as shown by the lack of detectable nucleolar localization of a control RNA with the antisense sequence to canine SRP RNA (Fig. 2D-F).



View larger version (81K):
[in this window]
[in a new window]
 
Fig. 2. Incorporation of SRP RNA into amplified nucleoli. Recombinant human SRP RNA (A-C) and control RNA antisense to canine SRP RNA (D-F) were labelled with Alexa 488 and injected into the GVs of Xenopus oocytes. After 18 hours, GVs were isolated and spread preparations were counterstained with DAPI. Fields containing nucleoli (No) were located by phase-contrast microscopy (A,D) and generally also contained chromosomes (Ch), Cajal bodies (CB) and B-snurposomes (smaller particles throughout the field). DNA-rich regions of chromosomes (chromomeres) and nucleoli (fibrillar centres) were located by DAPI fluorescence (B,E) and injected RNA was located by Alexa 488 fluorescence (C,F). SRP RNA was targeted specifically to nucleoli (C), whereas control antisense RNA failed to concentrate in any nuclear structures (F), although autofluorescence is seen from a contaminating yolk platelet (YP).

 

Endogenous SRP RNA is present in the amplified nucleoli
The localization of fluorescent SRP RNA in the amplified nucleoli following its microinjection into the nucleus does not necessarily mean that endogenous SRP RNA is present there as well. To address this point, GV spreads were subjected to RNA hybridization in situ with a peptide nucleic acid (PNA) probe specific for Xenopus SRP RNA (see Materials and Methods). As shown in Fig. 3C, hybridization was detected specifically in the nucleoli and not appreciably in the chromosomes or other nuclear structures (Fig. 3A). The SRP RNA hybridization was specific, as shown by the lack of hybridization when a control probe for yeast SRP RNA was used (Fig. 3E-G). Fields containing contaminating autofluorescent yolk platelets are shown to allow comparison with specific hybridization signals (Fig. 3C,G).



View larger version (83K):
[in this window]
[in a new window]
 
Fig. 3. In situ hybridization of TRITC-labelled PNA probes with amplified nucleoli. Probes antisense to Xenopus SRP RNA (A-D) and sense of yeast SRP RNA (control, E-G) were hybridized to GV spread preparations. Phase-contrast images (A,E) show nucleoli (No), chromosomes (Ch) and Cajal bodies (CB). DAPI images (B,F) show staining of fibrillar centres and chromomeres. TRITC fluorescence shows that the antisense probe hybridizes to nucleoli, although not significantly to the fibrillar centres (C). This differential localization is seen clearly in merged images in which the DAPI image is computer-coloured green (D). Coincidence of signals appears as yellow: the small amount of coincidence in nucleoli can be accounted for by overlapping nucleolar components, whereas complete coincidence is seen with the wide-spectrum autofluorescence of a contaminating yolk platelet (YP). The control probe fails to hybridize to nucleoli, although signal is seen over the yolk platelets (YP) in (G).

 

Notably, the localization of SRP RNA signal within the nucleoli did not appear to be uniform. Nucleoli typically have a tripartite structure, consisting of small foci called fibrillar centres (FCs; the sites of the ribosomal genes) situated within regions called the dense fibrillar component (DFC); these regions in turn are surrounded by a granular component (GC), and specific stages of the ribosome biosynthesis pathway have been assigned to these three domains (Goessens, 1984Go; Hernandez-Verdun, 1991Go; Spector, 1993Go; Shaw and Jordan, 1995Go; Scheer and Hock, 1999Go; Olson et al., 2000Go). This classical tripartite organization is also observed in the amplified nucleoli of amphibian oocytes (Mais and Scheer, 2001Go).

In the nucleolar preparations examined in the current study, the FCs were identified as the DAPI-staining structures and the DFC was defined by immunostaining with an antibody to the Xenopus nucleolar protein, xNop180 (Cairns and McStay, 1995Go; Schmidt-Zachmann, et al., 1984Go). In Fig. 3D, the DNA signal has been computationally coloured green and merged with the in situ hybridization signal (red). In all four of the nucleoli, the DNA-rich regions and the SRP RNA appear to be highly segregated, with the probe located largely around the FCs and extending through much of the DFC and into the GC.

The SRP19 protein is imported into the GV
The findings that microinjected SRP RNA targets the nucleoli and that the endogenous SRP RNA is localized in them raise the possibility that the amplified nucleoli are sites of SRP RNA assembly into nascent SRP particles. The binding of the SRP19 protein to SRP RNA is the first step in the biochemically determined assembly pathway of the signal recognition particle. Therefore, it would be expected that SRP19 would colocalize with SRP RNA in the nucleoli if SRP assembly in fact occurs at these sites. To follow SRP19 protein in the oocyte, we used a recombinant GFP-SRP19 fusion protein (see Materials and Methods). We first investigated whether the GFP-tagged SRP19 protein was capable of being imported into the nucleus. It was injected into the cytoplasm of oocytes and its distribution in nuclear and cytoplasmic fractions was analyzed by immunoblots with a GFP antibody (Fig. 4). The GFP-SRP19 protein appeared in the nuclear fraction in increasing amounts over a 10 hour period (Fig. 4A). The apparent molecular weight of ~47 kDa is close to that anticipated, as the fusion protein consists of SRP19 and the ~26 kDa GFP, and the persistence of this band indicates that the nucleus-imported GFP-SRP19 remains intact. Quantitation of the immunoblot results revealed a near-linear nuclear import over the 10 hour period of these experiments (Fig. 4B). By immunoblotting with the SRP19 antibody (see Fig. 1B,C), it was estimated that GFP-SRP19, recovered from injected oocytes after 10 hours, amounted to 10-20% of endogenous SRP19. In parallel experiments, the nuclear import factor importin-{alpha} was co-injected into the cytoplasm with GFP-SRP19 protein. This resulted in a pronounced initial increase in the kinetics of GFP-SRP19 import (Fig. 4B), adding further evidence that the GFP version of SRP19 was behaving in a physiologically relevant manner.



View larger version (48K):
[in this window]
[in a new window]
 
Fig. 4. Import of GFP-SRP19 into the germinal vesicle and export back to the cytoplasm. Samples of GFP-SRP19 (20 ng) were injected into the cytoplasm of oocytes, and GVs and cytoplasms were isolated under oil at 1, 2, 5 and 10 hours (h) after injection. (A) Protein was extracted and analysed by immunoblotting using antibodies to GFP. Bands at 47 kDa corresponding to the mass of the fusion protein (lane S, noninjected protein sample) show a steady increase in translocation from cytoplasm (C) to GV (N). (B) Ratios of nuclear to cytoplasmic concentration ([N]/[C]) were calculated from band density scans and mean values from four different injection experiments were plotted against time (open circles). In a separate series of experiments, co-injection of 25 ng of the import receptor importin-{alpha} shows an enhanced initial rate of nuclear uptake of GFP-SRP19 (filled circles). (C) Export of GFP-SRP19 from the germinal vesicle to the cytoplasm. From 10 hours after injection of GFP-SRP19 into the cytoplasm the nuclear to cytoplasmic concentration ratio ([N]/[C]) starts to fall (white columns), indicating export from the GV. This fall is inhibited by incubating the oocytes in the presence of 50 nM leptomycin B (LMB, grey columns).

 

The SRP19 protein is exported from the GV and is incorporated into a cytoplasmic RNP particle
To assess further the behaviour of GFP-SRP19 protein in oocytes, its longer-term distribution between the nucleus and the cytoplasm was investigated after treatment of oocytes with leptomycin B, an inhibitor of the Crm1 nuclear export machinery. Experiments in yeast have established that the nuclear export of SRP particles is Crm1-mediated (Ciufo and Brown, 2000Go; Grosshans et al., 2001Go), and there is evidence that this is also the case in mammalian cells (Alavian et al., 2004Go). As shown in Fig. 4C, GFP-SRP19 normally began to leave the nucleus after 10 hours, but treatment with leptomycin B resulted in an increased level of GFP-SRP19 in the nuclear fraction at 10 hours of treatment, this effect becoming more pronounced at 20 hours, suggesting that GFP-SRP19 export from the oocyte nucleus is Crm1-dependent.

We next asked if GFP-SRP19 protein is assembled into a ribonucleoprotein particle in the oocyte. GFP-SRP19 was injected into the nucleus and cytoplasmic extracts were prepared after 48 hours. Glycerol gradient analysis revealed that the majority of GFP fluorescence sedimented at ~10S (Fig. 5A), which is close to the sedimentation coefficient (~11S) of native SRP (Fig. 1B). Treatment of the cytoplasmic fraction with ribonuclease resulted in a substantial decrease in the sedimentation velocity of the SRP19 protein to less than 4S (Fig. 5A). In cytoplasms isolated immediately after injection, the fluorescent signal sedimented close to that expected for soluble protein monomers (Fig. 5A). The gradient fractions were further analysed by immunoblotting with GFP antibody (Fig. 5B), confirming that the fluorescent signal corresponded to the distribution of intact GFP-SRP19. Thus, by all these criteria (nuclear import, effect of importin-{alpha} on nuclear import, leptomycin B inhibition of nuclear export and assembly the exported protein into a ~10S cytoplasmic particle, the GFP-SRP19 protein behaved in a manner entirely consistent with the pathway of SRP biosynthesis described in other systems.

The SRP19 protein localizes in the amplified nucleoli
We investigated the nuclear localization of GFP-SRP19 after import from the cytoplasm. As shown in Fig. 6C, at 1 hour after microinjection into the cytoplasm there was a faint signal in the nucleoli. After 2-5 hours, the nucleolar signals became progressively stronger, spreading out from around the DAPI-staining FCs to encompass the whole nucleolar space (Fig. 6F,I,L). Of the GFP-SRP19 contained in the nucleus at 5 hours postinjection, more than 80% could be pelleted by low-speed centifugation (3000 g for 5 minutes), indicating that only a minor component was present in the nucleoplasm. This observation was confirmed by microscopic examination of GV contents isolated in the presence of 1 mM Mg2+; the nucleoplasm, gelled under this condition, exhibiting a much lower concentration of fluorescence than the embedded nucleoli (not shown). There was no indication of GFP-SRP19 protein localizing on the chromosomes or Cajal bodies (compare fluorescence in F,I,L with the phase-contrast images in D,G,J). All other fields examined failed to show labelling on structures other than nucleoli. A negative control for fluorescence is provided by the nuclear behaviour of GFP itself. As we have shown previously, GFP expressed from microinjected plasmids equilibrates throughout the oocyte but does not bind significantly to any nuclear structures (Smillie and Sommerville, 2002Go).



View larger version (81K):
[in this window]
[in a new window]
 
Fig. 6. Incorporation of injected GFP-SRP19 into amplified nucleoli. At 1 (A-C), 2 (D-F), 3 (G-I) and 5 (J-L) hours after injecting GFP-SRP19 into the cytoplasm of oocytes, GVs were isolated and spread preparations were stained with DAPI and examined for fluorescence. Although nucleoli (No), chromosomes (Ch) and Cajal bodies (CB) were identified in most fields by phase-contrast (A,D,G,J), and DAPI staining (B, E, H, K) only nucleoli showed GFP fluorescence (C,F,I,L). The fluorescent signal is seen to spread with time from regions around the DAPI-staining fibrillar centres at 2 hours after injection (E, F) to occupy most of the nucleolar space by 5 hours (K,L).

 

When spread GV contents are exposed to low-salt medium lacking MgCl2, the nucleoli become distended into a necklace-like array of beaded substructure (Wu and Gall, 1997Go) due to a loosening and dissociation of a cortical structure that extends over the nucleolar surface (Kneissel et al., 2001Go). When GFP-SRP19 protein was injected into the cytoplasm and nuclear spreads were then prepared in a low-salt medium lacking MgCl2, the signal was observed to be extended in a spatial configuration that coincided with the distended nucleolar substructure (Fig. 7A-C). Moreover, the GFP-SRP19 protein remained associated with this nucleolar substructure after storage of preparations in 70% ethanol (Fig. 7D-F), a condition under which GFP alone is solubilized (J.S., unpublished). This result establishes that the GFP-SRP19 protein is tightly associated with nucleolar components.



View larger version (56K):
[in this window]
[in a new window]
 
Fig. 7. Location of GFP-SRP19 in partially dissociated nucleoli. At 5 hours after injecting GFP-SRP19 into the cytoplasm of oocytes, GV spreads were prepared in the absence of Mg2+ and either examined unfixed (A-C) or after storing the preparations for 18 hours in 70% ethanol (D-F). Distended nucleolar substructure is evident from the phase-contrast images (A,D), with globular dense fibrillar component organized around individual DAPI-staining fibrillar centres (B,E). The GFP signal remained located at the dense fibrillar component (C,F) and was absent from chromosomes (D-F) and other nuclear structures (not shown).

 

Endogenous SRP19 is present in the amplified nucleoli
GVs were again spread in low-salt medium lacking Mg2+ to reveal the substructures of the nucleoli at greater spatial resolution. As shown in Fig. 8C,E, the nucleoli showed distinct staining with an antibody to SRP19 protein, with no signal evident in Cajal bodies (Fig. 8A). Very fine foci lacking immunoreactivity were observed within the nucleolar beads and these corresponded to the DAPI-stained FCs (Fig. 8B,D). This suggests that the highest concentration of SRP19 protein is circumferentially arrayed around the FCs, as was observed for SRP RNA (Fig. 3). In the merged image (Fig. 8F), the FCs mostly appeared red, with some immediately adjacent merged signal (yellow), in turn surrounded by SRP19 alone (green). This suggests that SRP19 is distributed throughout the nucleoli except for the FCs, and that some of the protein occupies a location immediately adjacent to FCs. (It is probable that most of the merged signal in Fig. 8F represents spatial overlap in the z-axis.) These results show that the amplified nucleoli are the major intranuclear sites of the endogenous SRP19 protein in the oocyte nucleus. Together with the GFP-SRP19 results and the nucleolar localization of both microinjected and endogenous SRP RNA, our results strongly support the hypothesis that the amplified nucleoli of the amphibian oocyte are involved in SRP biosynthesis.



View larger version (58K):
[in this window]
[in a new window]
 
Fig. 8. Immunostaining of amplified nucleoli with antibodies to SRP19. GV spreads were prepared in low-salt medium without Mg2+. Nucleoli (No), Cajal bodies (CB) and B-snurposomes were identified by phase-contrast (A) and DAPI staining (B), but only the nucleoli were immunostained using chicken anti-SRP19 with FITC-conjugated anti-chicken IgG as a secondary antibody (C). The centres of the stained structures are seen to be relatively free of fluorescence. (D-F) The DAPI staining (D) and the immunostaining (E) are merged (F), with the DAPI computationally coloured red and yellow indicating spatial coincidence of the two signals.

 


    Discussion
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The initial idea that the nucleolus may have functions other than ribosome assembly (Pederson, 1998Go; Pederson, 1999Go; Pederson and Politz, 2000Go) has continued to be borne out by numerous studies that have revealed the presence in yeast and mammalian cell nucleoli of various proteins and RNA species that have no obvious connection with ribosome biosynthesis. In the present investigation we have identified both the RNA and a protein component of the signal recognition particle in the amplified nucleoli of Xenopus oocytes, specifically at a developmental stage, mid-vitellogenesis, when nucleolar activity is at a maximum. Previous studies had also identified SRP RNA and SRP proteins in the nucleoli of somatic mammalian cells (Jacobson and Pederson, 1998Go; Politz et al., 2000Go; Politz et al., 2002Go). One interpretation of those findings was that SRP assembly, at least its initial stages, takes place in nucleoli. However, another interpretation was that SRP RNA and SRP proteins remain uncomplexed in nucleoli and serve some unknown functions unrelated to SRP biosynthesis. This latter hypothesis can now be viewed as quite implausible as we show here that SRP RNA and the SRP19 protein are also present in the oocyte-amplified nucleoli. These nucleoli are specialized for (at least) ribosome assembly and reside in a cell-cycle-arrested (meiotic) nucleus. Yet they contain SRP RNA and an SRP protein, SRP19, which is involved in an early stage of SRP assembly. Therefore, it seems quite likely that the presence of the SRP components in oocyte nucleoli reflects an actual role of these nucleoli in producing a maternal stockpile of SRP. This interpretation is strongly supported by our observation that when GFP-SRP19 was injected into the cytoplasm and localized in the amplified nucleoli, it was subsequently observed to be exported back to the cytoplasm where it was identified in a ribonucleoprotein particle having a sedimentation coefficient in glycerol gradients close to that of the mammalian SRP particle. The present investigation thus moves the plurifunctional nucleolus concept ahead with respect to a role in the biosynthesis of the SRP.

The results of this study point to a high mobility of fluorescent SRP RNA injected into the nucleus of Xenopus oocytes, since the introduced RNA was observed to traffic to all of the ~1000 extrachromosomal nucleoli. Similar observations have been previously made in studies of other species of RNA injected into the germinal vesicle (Gerbi et al., 2003Go; Handwerger et al., 2003Go). The fact that endogenous SRP RNA was also found in all of the nucleoli implies that these molecules traffic extensively from their transcription site throughout the nucleoplasm to reach all of the amplified nucleoli. This wide-ranging mobility of RNA in the germinal vesicle is similar to the diffusive transport of RNA in the mammalian cell nucleus (Jacobson and Pederson, 1998Go; Politz et al., 1998Go; Politz et al., 1999; Politz et al., 2003Go).

We were struck by the unique concentration of SRP RNA in only the amplified nucleoli, and not in other RNA traffic centres of the Xenopus oocyte nucleus. Similarly, in previous studies on mammalian cells there was no evidence of SRP RNA in either of two RNA-rich structures: interchromatin granule clusters (also known as `speckles') or Cajal bodies (Jacobson and Pederson, 1998Go; Wang et al., 2003Go), and this was confirmed in the present study in which no association of SRP RNA with either B-snurposomes (homologous with speckles in mammalian somatic nuclei) or Cajal bodies was observed in the Xenopus oocyte nucleus. SRP RNA seems to be distinctive as one of the few nucleolus-trafficking small RNAs that does not also have a Cajal body resident stage (Gall, 2000Go; Gall, 2003Go; Pederson, 2004Go).

The present study also provides new information on the nuclear import of SRP19 protein and its export, studied here for the first time in amphibian oocytes. Our finding that the nuclear import of GFP-SRP19 is accelerated by co-microinjection of importin-{alpha} implicates this member of the importin family in the nuclear import of SRP19 in this developmentally specialized cell. A previous study of SRP19 protein nuclear import in a detergent-extracted mammalian cell in vitro system implicated two importins, importin 8 and transportin, both of which are members of the ß-importin family (Dean et al., 2001Go). How SRP proteins are imported into the nucleus of various eukaryotic cells clearly will require further work, but our results draw attention to importin-{alpha} in Xenopus oocytes. Whether or not SRP19 is actively recruited to the extrachromosomal nucleoli is not known: a search of the human SRP19 amino acid sequence did not reveal any regions corresponding to nucleolus-localizing elements that have been defined in other nucleolar proteins (S. Yarovoi and T.P., unpublished). Our finding that leptomycin B causes an accumulation of SRP19 protein in the amphibian oocyte nucleus implicates the Crm1 pathway of nuclear export, which is the export machinery identified for SRP nuclear export in yeast (Ciufo and Brown, 2000Go; Grosshans et al., 2001Go). We have found no indication of a nuclear export signal (NES) in SRP19; indeed, our results with mammalian cells (Alavian et al., 2004Go) support an indirect, rather than a direct, export of nascent SRP by the Crm1 pathway.

Our present findings that both SRP RNA and an SRP protein are present in the amplified nucleoli of a cell, the amphibian oocyte, that is designed to stockpile the machinery of translation, adds considerable weight to the hypothesis that the nucleolus plays a role in SRP biosynthesis. Moreover, the present investigation shows that the oocyte is likely to be a valuable system for investigating further the biosynthesis of the SRP, both with respect to its nucleolar phase and its overall developmental timetable. In keeping with numerous studies of gene expression in this specialized cell, in which features of transcription, RNA processing and ribonucleoprotein assembly are quantitatively and cytologically intensified, we are optimistic that the Xenopus oocyte will be a key system in continuing studies of both SRP biosynthesis and the plurifunctional nucleolus concept.


    Acknowledgments
 
This work was supported by a grant from the Wellcome Trust to J.S. and U.S. National Institutes of Health grant GM-21595 to T.P. We are indebted to Jos Raats (University of Nijmegen, The Netherlands) for his key role in generating the SRP19 antibody. We thank Howard Fried (University of North Carolina, Chapel Hill, NC) for providing the SRP19 bacterial expression plasmid, and we acknowledge Serge Yarovoi in the Pederson laboratory for constructing the GFP fusion protein. We thank Marion Schmidt-Zachmann (German Cancer Research Center, Heidelberg) for monoclonal antibody No-114 to detect xNopp180, David Russell (Washington University School of Medicine) for the GFP antibody and Minori Yoshida (University of Tokyo) for leptomycin B. Annemarie Mullin, Katherine Gilchrist and Ceri Jackson in the Sommerville laboratory are thanked for their help with the immunoblotting, in situ hybridization and RT-PCR experiments, and Laura Lewandowski in the Pederson laboratory is thanked for her skilfull transcription and fluorescent labelling of RNAs.


    Footnotes
 
{ddagger} Present address: Department of Neuroscience, University of Connecticut Health Center, Farmington, CT 06032, USA Back


    References
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

Alavian, C. N., Ritland Politz, J. C., Lewandowski, L. B., Powers, C. M. and Pederson. T. (2004). Nuclear export of signal recognition particle RNA in mammalian cells. Biochem. Biophys. Res. Comm. 313, 351-355.[CrossRef][Medline]

Batey, R. T., Rambo, R. P., Lucast, L., Rha, B. and Doudna, J. A. (2000). Crystal structure of the ribonucleoprotein core of the signal recognition particle. Science 287, 1232-1239.[Abstract/Free Full Text]

Batey, R. T., Sagar, M. B. and Doudna, J. A. (2001). Structural and energetic analysis of RNA recognition by a universally conserved protein from the signal recognition particle. J. Mol. Biol. 307, 229-246.[CrossRef][Medline]

Beckmann, R., Spahn, C. M., Eswar, N., Helmers, J., Penczek, P. J., Sali, A., Frank, J. and Blobel, J. (2001). Architecture of the protein-conducting channel associated with the translating 80S ribosome. Cell 107, 361-372.[CrossRef][Medline]

Brown, D. D. and Dawid, I. (1968). Specific gene amplification in oocytes. Science 160, 272-280.[Free Full Text]

Cairns, C. and McStay, B. (1995). Identification and cDNA cloning of a Xenopus nucleolar phosphoprotein, xNopp180, that is the homolog of the rat nucleolar protein Nopp140. J. Cell Sci. 108, 3339-3347.[Abstract]

Callan, H. G., Gall, J. G. and Berg, C. A. (1987). The lampbrush chromosomes of Xenopus laevis: Preparation, identification and distribution of 5S DNA sequences. Chromosoma 95, 236-250.[CrossRef][Medline]

Ciufo, L. F. and Brown, J. D. (2000). Nuclear export of yeast signal recognition particle lacking Srp54p by the Xpo1p/Crm1p NES-dependent pathway. Curr. Biol. 10, 1256-1264.[CrossRef][Medline]

Dean, K. A., von Ahsen, O., Gorlich, D. and Fried, H. M. (2001). Signal recognition particle protein 19 is imported into the nucleus by importin 8 (RanBP8) and transportin. J. Cell Sci. 114, 3479-3485.[Abstract/Free Full Text]

Dumont, J. N. (1972). Oogenesis in Xenopus laevis (Daudin). Stages of oocyte development in laboratory maintained animals. J. Morphol. 136, 153-180.[CrossRef][Medline]

Evans, J. P. and Kay, B. K. (1991). Biochemical fractionation of oocytes. Methods Cell Biol. 36, 133-148.[Medline]

Ford, P. J. (1971). Non-coordinated accumulation and synthesis of 5S ribonucleic acid by ovaries of Xenopus laevis. Nature 233, 561-564.[CrossRef][Medline]

Gall, J. G. (1968). Differential synthesis of the genes for rRNA during amphibian oogenesis. Proc. Natl. Acad. Sci. USA. 60, 553-560.[Free Full Text]

Gall, J. G. (1978). Early studies on gene amplification. Harvey Lectures Ser. 71, 55-70.

Gall, J. G. (2000). Cajal bodies: the first 100 years. Ann. Rev. Cell Dev. Biol. 16, 273-300.[CrossRef][Medline]

Gall, J. G. (2003). The centennial of the Cajal body. Nat. Rev. Mol. Cell. Biol. 4, 975-980.[CrossRef][Medline]

Gerbi, S. A., Borovjagin, A. V. and Lange, T. S. (2003). The nucleolus: a site of ribonucleoprotein maturation. Curr. Opin. Cell Biol. 15, 318-325.[CrossRef][Medline]

Goessens, G. (1984). Nucleolar structure. Int. Rev. Cytol. 87, 107-158.[Medline]

Grosshans, H., Deinert, K., Hurt, E. and Simos, G. (2001). Biogenesis of the signal recognition particle (SRP) involves import of SRP proteins into the nucleolus, assembly with the SRP-RNA, and Xpo1p-mediated export. J. Cell Biol. 153, 745-762.[Abstract/Free Full Text]

Hainzl, T., Huang, S. and Sauer-Eriksson, A. E. (2002). Structure of the SRP19 RNA complex and implications for signal recognition particle assembly. Nature 417, 767-771.[CrossRef][Medline]

Handwerger, K. E., Murphy, C. and Gall, J. G. (2003). Steady-state dynamics of Cajal body components in the Xenopus germinal vesicle. J. Cell Biol. 160, 495-504.[Abstract/Free Full Text]

Henry, K. A., Zwieb, C. and Fried, H. M. (1997). Purification and biochemical characterization of the 19-kDa signal recogniiton particle RNA-binding protein expressed as a hexahistidine-tagged polypeptide in Escherichia coli. Prot. Expr. Purif. 9, 15-26.[Medline]

Hernandez-Verdun, D. (1991). The nucleolus today. J. Cell Sci. 99, 475-471.

Jacobson, M. R. and Pederson, T. (1998). Localization of signal recognition particle RNA in the nucleolus of mammalian cells. Proc. Natl. Acad. Sci. USA 95, 7981-7986.[Abstract/Free Full Text]

Keenan, R. J., Freymann, D. M., Stroud, R. M. and Walter, P. (2001). The signal recognition particle. Annu. Rev. Biochem. 70, 755-775.[CrossRef][Medline]

Keenan, R. J., Freymann, D. M., Walter, P. and Stroud, R. M. (1998). Crystal structure of the signal sequence binding subunit of the signal recognition particle. Cell 94, 181-191.[CrossRef][Medline]

Kneissel, S., Franke, W. W., Gall, J. G., Heid, G., Reidenbach, S., Schnolzer, M., Spring, H., Zentgraf, H. and Schmidt-Zachmann, M. S. (2001). A novel karyoskeletal protein: characterization of protein NO145, the major component of nucleolar cortical skeleton in Xenopus oocytes. Mol. Biol. Cell 12, 3904-3918.[Abstract/Free Full Text]

Macgregor, H. C. (1972). The nucleolus and its genes in amphibian oogenesis. Biol. Rev. Camb. Phil. Soc. 47, 177-210.[Medline]

Mairy, M. and Denis, H. (1971). Biochemical studies on oogenesis. 1. RNA synthesis and accumulation during oogenesis of the South African toad Xenopus laevis. Dev. Biol. 24, 143-165.[CrossRef][Medline]

Mais, C. and Scheer, U. (2001). Molecular architecture of the amplified nucleoli of Xenopus oocytes. J. Cell. Sci. 114, 709-714.[Abstract]

Miller, O. L. and Beatty, B. R. (1969). Extrachromosomal nucleolar genes in amphibian oocytes. Genetics 61 Suppl., 133-143.[Medline]

Montgomery, T. H. (1898). Comparative cytological studies, with especial regard to the morphology of the nucleolus. J. Morphol. 15, 265-582.

Nagai, K., Oubridge, C., Kuglstatter, A., Menichelli, E., Isel, C. and Jovine, L. (2003). Structure, function and evolution of the signal recognition particle. EMBO J. 22, 3479-3485.[CrossRef][Medline]

Olson, M. O., Dundr, M. and Szebeni, A. (2000). The nucleolus: an old factory with unexpected capabilities. Trends Cell Biol. 10, 189-196.[CrossRef][Medline]

Olson, M. O., Hingorani, K. and Szebeni, A. (2002). Conventional and nonconventional roles of the nucleolus. Int. Rev. Cytol. 219, 199-266.[Medline]

Oubridge, C., Kuglstatter, A., Jovine, L. and Nagai, K. (2002). Crystal structure of SRP19 in complex with the S domain of SRP RNA and its implication for the assembly of the signal recognition particle. Mol. Cell. 9, 1251-1261.[CrossRef][Medline]

Painter, T. S. and Taylor. A. N. (1942). Nucleic acid storage in the toad's egg. Proc. Natl. Acad. Sci. USA 28, 311-317.[Free Full Text]

Pederson, T. (1998). The plurifunctional nucleolus. Nucleic Acids Res. 26, 3871-3876.[Abstract/Free Full Text]

Pederson, T. (1999). Growth factors in the nucleolus? J. Cell Biol. 143, 279-281.

Pederson, T. and Politz, J. C. (2000). The nucleolus and the four ribonucleoproteins of translation. J. Cell Biol. 148, 1091-1095.[Abstract/Free Full Text]

Pederson, T. (2004). Can telomerase be put in its place? J. Cell Biol. 164, 637-639.[Abstract/Free Full Text]

Politz, J. C., Browne, E. S., Wolf, D. E. and Pederson, T. (1998). Intranuclear diffusion and hybridization state of oligonucleotides measured by fluorescence correlation spectroscopy. Proc. Natl. Acad. Sci USA 95, 6043-6048.[Abstract/Free Full Text]

Politz, J. C., Yarovoi, S., Kilroy, S. M., Gowda, K., Zwieb, C. and Pederson, T. (2000). Signal recognition particle components in the nucleolus. Proc. Natl. Acad. Sci. USA 97, 55-60.[Abstract/Free Full Text]

Politz, J. C., Lewandowski, L. B. and Pederson, T. (2002). Signal recognition particle RNA localization within the nucleolus differs from the classical sites of ribosome synthesis. J. Cell Biol. 159, 411-418.[Abstract/Free Full Text]

Politz, J. C. R., Tuft, R. A. and Pederson, T. (2003). Diffusion-based transport of nascent ribosomes in the nucleus. Mol. Biol. Cell 14, 4805-4812.[Abstract/Free Full Text]

Pool, M. R., Stumm, J., Fulga, T. A., Sinning, I. and Dobberstein, B. (2002). Distinct modes of signal recognition particle interaction with the ribosome. Science 297, 1345-1348.[Abstract/Free Full Text]

Ryan, J., Llinas, A. J., White, D. A., Turner, B. M. and Sommerville, J. (1999). Maternal histone deacetylase is accumulated in the nuclei of Xenopus oocytes as protein complexes with potential enzyme activity. J. Cell Sci. 112, 2441-2462.[Abstract]

Scheer, U. (1973). Nuclear pore flow rate of ribosomal RNA and chain growth rate of its precursor during oogenesis of Xenopus laevis. Dev. Biol. 30, 13-28.[CrossRef][Medline]

Scheer, U. and Hock, R. (1999). Structure and function of the nucleolus. Curr. Opin. Cell Biol. 11, 385-390.[CrossRef][Medline]

Scheer, U., Trendelenburg, M. F. and Franke, W. W. (1976). Regulation of transcription of genes of ribosomal RNA during amphibian oogenesis: A biochemical and morphological study. J. Cell Biol. 69, 465-489.[Abstract/Free Full Text]

Schmidt-Zachmann, M., Hugle, B., Scheer, U. and Franke. W. W. (1984). Identification and localization of a novel nucleolar protein of high molecular weight by a monoclonal antibody. Exp. Cell Res. 153, 327-346.[CrossRef][Medline]

Shaw, P. J. and Jordan, E. G. (1995). The nucleolus. Ann. Rev. Cell Dev. Biol. 11, 93-121.[CrossRef][Medline]

Smillie, D. A. and Sommerville, J. (2002). RNA helicase p54 (DDX6) is a shuttling protein involved in nuclear assembly of stored mRNP particles. J. Cell Sci. 115, 395-407.[Abstract/Free Full Text]

Spector, D. L. (1993). Macromolecular domains within the cell nucleus. Annu. Rev. Cell Biol. 9, 265-315.[CrossRef][Medline]

Strub, K., Moss, J. and Walter, P. (1991). Binding sites of the 9- and 14-kilodalton heterodimeric protein subunit of the signal recognition particle (SRP) are contained exclusively in the Alu domain of SRP RNA and contain a sequence motif that is conserved in evolution. Mol. Cell. Biol. 11, 3949-3959.[Abstract/Free Full Text]

Ullu, E. and Tshudi, C. (1984). Alu sequences are processed 7SL RNA genes. Nature 312, 171-172.[Medline]

Walter, P. and Blobel, G. (1983). Disassembly and reconstitution of signal recognition particle. Cell 34, 525-533.[CrossRef][Medline]

Walter, P. and Johnson, A. E. (1994). Signal sequence recognition and protein targeting to the endoplasmic reticulum membrane. Ann. Rev. Cell Biol. 10, 87-119.[CrossRef]

Walter, P., Keenan, R. and Schmitz, U. (2000). SRP – where the RNA and membrane worlds meet. Science 287, 1212-1213.[Free Full Text]

Wang, C., Politz, J. C., Pederson, T. and Huang, S. (2003). RNA polymerase III transcripts and the PTB protein are essential for the integrity of the perinucleolar compartment. Mol. Biol. Cell 14, 2425-2435.[Abstract/Free Full Text]

Weichenrieder, O., Wild, K., Strub, K. and Cusack, S. (2000). Structure and assembly of the Alu domain of the mammalian signal recognition particle. Nature 408, 167-173.[CrossRef][Medline]

Weichenrieder, O., Stehlin, C., Kapp, U., Birse, D. E., Timmins, P. A., Strub, K. and Cusack, S. (2001). Hierarchical assembly of the Alu domain of the mammalian signal recognition particle. RNA 7, 731-740.[Abstract]

Wild, K., Sinning, I. and Cusack, S. (2001). Crystal structure of an early protein-RNA assembly complex of the signal recognition particle. Science 294, 598-601.[Abstract/Free Full Text]

Wu, Z. and Gall, J. G. (1997). "Micronucleoli" in the Xenopus germinal vesicle. Chromosoma 105, 438-443.[Medline]

Zwieb, C. (1991). Interaction of protein SRP19 with signal recognition particle RNA lacking individual RNA-helices. Nucleic Acids Res. 19, 2955-2960.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Poult. Sci.Home page
S. H. Lee, H. S. Lillehoj, D. W. Park, S. I. Jang, A. Morales, D. Garcia, E. Lucio, R. Larios, G. Victoria, D. Marrufo, et al.
Induction of passive immunity in broiler chickens against Eimeria acervulina by hyperimmune egg yolk immunoglobulin Y
Poult. Sci., March 1, 2009; 88(3): 562 - 566.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
L. Meng, Q. Zhu, and R. Y. L. Tsai
Nucleolar Trafficking of Nucleostemin Family Proteins: Common versus Protein-Specific Mechanisms
Mol. Cell. Biol., December 15, 2007; 27(24): 8670 - 8682.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
R. A. Haeusler and D. R. Engelke
Spatial organization of transcription by RNA polymerase III
Nucleic Acids Res., October 18, 2006; 34(17): 4826 - 4836.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. D. Stewart, J. Sommerville, and J. Wong
Dynamic Regulation of Histone Modifications in Xenopus Oocytes through Histone Exchange.
Mol. Cell. Biol., September 1, 2006; 26(18): 6890 - 6901.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
Y. Lustig, H. Goldshmidt, S. Uliel, and S. Michaeli
The Trypanosoma brucei signal recognition particle lacks the Alu-domain-binding proteins: purification and functional analysis of its binding proteins by RNAi
J. Cell Sci., October 1, 2005; 118(19): 4551 - 4562.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
J. C. R. Politz, I. Polena, I. Trask, D. P. Bazett-Jones, and T. Pederson
A Nonribosomal Landscape in the Nucleolus Revealed by the Stem Cell Protein Nucleostemin
Mol. Biol. Cell, July 1, 2005; 16(7): 3401 - 3410.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jcs.01726v1
118/6/1299    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sommerville, J.
Right arrow Articles by Pederson, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sommerville, J.
Right arrow Articles by Pederson, T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?