|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 25 April 2006
doi: 10.1242/jcs.02935
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
1 Departments of Anaesthesia and Research, Basel University Hospital, Hebelstrasse 20, 4031 Basel, Switzerland
2 INSERM U607/CEA/UJF, Lab CCFP/DRDC, Rue des Martyrs 17, 38054, Grenoble, Cedex 9 France
3 Department of Physiology and Pharmacology, Gerontology, Wake Forest University School of Medicine, Winston-Salem, NC 27157, USA
4 Department of Internal Medicine, Gerontology, Wake Forest University School of Medicine, Winston-Salem, NC 27157, USA
5 Department of Experimental and Diagnostic Medicine, General Pathology Section, University of Ferrara, Via Borsari 46, 44100 Ferrara, Italy
* Author for correspondence (e-mail: zor{at}unife.it)
Accepted 14 February 2006
| Summary |
|---|
|
|
|---|
-interacting domain in the I-II loop. ß1a, a Cav1 subunit, also interacts with the cytosolic domain of JP-45, and its presence drastically reduces the interaction between JP-45 and the I-II loop. The functional effect of JP-45 on Cav1.1 activity was assessed by investigating charge movement in differentiated C2C12 myotubes after overexpression or depletion of JP-45. Overexpression of JP-45 decreased peak charge-movement and shifted VQ1/2 to a more negative potential (-10 mV). JP-45 depletion decreased both the content of Cav1.1 and peak charge-movements. Our data demonstrate that JP-45 is an important protein for functional expression of voltage-dependent Ca2+ channels.
Key words: Voltage-dependent Ca2+ channel, JP-45, Sarcoplasmic reticulum, Excitation-contraction coupling
| Introduction |
|---|
|
|
|---|
1, ß,
2
and
(Leung et al., 1987
2
subunits have regulatory functions; the role of the
subunit has yet to be clearly defined (Catterall, 1995
-interacting domain (AID) (Pragnell et al., 1994
In skeletal muscle, Cav1.1 responds to transverse tubule depolarisation by sensing the voltage change and it induces Ca2+ release from the SR through a direct interaction with the RyR. Besides the RyR, however, the junctional face membrane contains numerous other proteins that, because of their anatomical location, are deemed to be involved in E-C coupling (Zhang et al., 1997
; Costello et al., 1986
; Zorzato et al., 2000
). In the past few years a number of investigators have begun to define the major and minor structural components of the junctional face membrane (Ito et al., 2001
; Takeshima et al., 2000
). In previous studies (Zorzato et al., 2000
; Anderson et al., 2003
), we identified and characterized - at the biochemical and molecular level - JP-45, an integral membrane protein constituent of the SR junctional face membrane in skeletal muscle. We also showed that JP-45 colocalizes with the RyR Ca2+-release channel and interacts with Cav1.1 and the luminal Ca2+-binding protein calsequestrin (Anderson et al., 2003
). To gather insight into the functional role of JP-45, we defined the domains involved in the interaction between JP-45 and Cav1.1. Our results demonstrate that the cytoplasmic domain of JP-45 interacts directly with the I-II loop, the C-terminal domain of Cav1.1 subunit and also with the ß1a subunit of Cav1. In addition, we show that the interaction between JP-45 and the I-II loop occurs through the AID domain, and can be displaced by ß1a. Experimental evidence has demonstrated that the ß1a subunit interacts with the Cav1.1 subunit via AID (Pragnell et al., 1994
; Chen et al., 2004
) and that this protein-protein interaction is involved in the insertion of the voltage sensor to its proper membrane compartment (Flucher et al., 2002
). To confirm the functional role of JP-45 in vivo, we overexpressed and silenced endogenous JP-45 in C2C12 cells and studied their electrophysiological properties. Based on the results of the present report, JP-45 is involved in the regulation of the functional expression of Cav1.1 into the transverse tubular membrane compartment.
| Results and Discussion |
|---|
|
|
|---|
|
|
|
Immunoprecipitation experiments revealed that JP-45 interacts with the I-II loop of subunit Cav1.1 and with purified recombinant ß1a subunit (Fig. 3B). The ß1a has been shown to interact strongly with the I-II loop of the
1.1 subunit and to affect its functional expression (Flucher et al., 2000
; Chien et al., 1995
). In the next set of experiments, we therefore characterized in greater detail the latter protein-protein interaction.
Effect of the ß1a subunit on the interaction of JP-45 and Cav1.1
We investigated the role of the ß1a subunit on the interaction between JP-45 and Cav1.1 by pull-down and co-immunoprecipitation assays (Fig. 4). JP-45 domain-2 fusion protein was immobilized on GST-Sepharose and incubated with the His-tagged Cav1.1 subunit I-II loop fusion protein in the presence or absence of increasing concentrations of ß 1a fusion protein. As seen in Fig. 4A the presence of ß1a interferes with the interaction between the I-II loop and JP-45. Pull-down assays were also performed by using the solubilized light microsomal vesicles as ligand. In the latter case, the association between the GST-JP-45 domain-2 fusion protein and the native Cav1.1 subunit was remarkably weaker in the presence of excess ß1a-His-tagged fusion protein (Fig. 4B). The interference of the interaction between JP-45 and the Cav1.1 subunit by excess ß1a, was also confirmed by performing co-immunoprecipitation experiments with anti-JP-45 Abs to pull-down the native solubilized complex (Fig. 4C). These results suggest that the presence of excess ß1a disrupts the complex between Cav1.1 and JP-45. We cannot discriminate whether JP-45 interacts with the Cav1.1 or ß1a, subunit, or whether JP-45 interacts with both subunits, thereby forming an oligomeric complex.
|
-interacting domain (AID). It is thought that the interaction between AID and the ß1a subunit is important to determine the stability of this Ca2+ channel on the plasma membrane (Birnbaumer et al., 1998
|
To investigate the functional effect of JP-45, we altered the stoichiometry of the JP-45-Cav1.1 supramolecular complex either by JP-45 overexpression or by JP-45 gene silencing in differentiated C2C12 myotubes, and then examined Cav1.1 activity by measuring charge movement.
Effect of JP-45-DsRed2 overexpression on the function of the Cav1.1
To examine the expression of JP45 and the Cav1.1, we carried out western blot analysis on subcellular fractions isolated from transfected cells. Fig. 6A shows a western blot of total microsome fractions from C2C12 cells transfected either with pFP-N3 coupled to red fluorescent protein (DsRed2) (pFP-N3-DsRed2) vector or with JP-45-pFP-N3-DsRed2 plasmid. Cells transfected with the latter plasmid show an immunoreactive band of approximately 45 kDa, which represents endogenous JP-45, and a band of approximately 70 kDa, which represents the JP-45-DsRed fusion protein. To verify whether overexpression of JP-45 affects the average amount of Cav1.1 subunit, we performed immunoprecipitation experiments. Total C2C12 lysate of control and JP45-overexpressing cells contain two distinct high-molecular mass bands of 175 kDa and 170 kDa that can be attributed to the Cav1.1 subunit (Leung et al., 1987
). The relative amount of protein in the bands did not show a major change (intensity ratio of Cav1.1 bands in JP45-overexpressing cells to those of cells expressing empty vector was 0.971±0.06, mean ± s.d.). C2C12 cells were transfected with JP-45-pFP-N3-DsRed2 and the expression of JP-45-DsRed2 fusion protein was monitored by fluorescence microscopy to measure direct charge-movement. Fig. 7A shows the maximal charge movement. Fluorescence relationship for C2C12 cells transfected with JP-45-pFP-N3-DsRed2 construct (A, n=17) or pFP-N3/DsRed2 vector alone as control (B, n=15). As the magnitude of JP-45-DsRed2 fluorescence increased, the peak charge-movement significantly decreased (Fig. 7A), a phenomenon that was not observed in the control cells transfected only with the pFP-3/DsRed2 plasmid (Fig. 7B). For analysis of the charge-movement versus membrane-voltage relationship of cells transfected with either JP-45-pFP-N3-DsRed2 (Fig. 7C) or pFP-N3-DsRed2 plasmid (Fig. 7D), data points were fitted to a Boltzmann equation of the form:
![]() |
threefold) but also in the half activation potential of the charge movement (Table 1). High expression levels of JP-45 are associated with a shift of VQ1/2 to more negative potentials of
10 mV (Fig. 7C,D). No differences in the steepness of the curve were observed between these two groups of cells (Table 1).
|
|
|
The observation that alteration of peak charge movement is tightly linked to the magnitude of JP-45 expression suggests that, the stoichiometry of the JP-45/Cav1.1 supramolecular complex is crucial for the proper function of the Cav1.1. If this is so, we reasoned that depletion of JP-45 in differentiated myotubes would similarly affect the charge movement of Cav1.1.
Effect of JP-45 gene silencing on Cav1.1 function
The mRNA encoding JP-45 was much less abundant in C2C12 myotubes transfected with the plasmid containing JP-45 siRNA than in cells transfected with the control pSHAG vector (Fig. 8A). The presence of residual mRNA for JP-45 could either be due to the presence of a small subpopulation of cells which had not been transfected with the JP-45 siRNA construct, or to the inability of the construct to fully eliminate the transcript of JP-45. The amount of ß-actin transcript did not differ significantly between cells transfected with the two constructs (Fig. 8A lower panel). Western blot analysis was performed to confirm depletion of JP-45 in differentiated C2C12 myotubes. Expression of JP-45 in C2C12 cells transfected with JP-45 siRNA is lower than the detection limit of the anti-JP-45 Abs that were raised against the N-terminal-interacting domain of the protein (Fig. 8B). However, we did not see changes in the expression of the housekeeping gene ß-actin. Having established a reduction in transcription and expression of JP-45, we next measured Cav1.1 charge-movement. C2C12 cells were co-transfected with pFP-N3-DsRed2 and either the JP-45 siRNA pSHAG vector or pSHAG vector. Based on the expression of the DsRed2 reporter, C2C12 cells were identified and charge-movement measurements were performed. Fig. 9A shows that depletion of JP-45 in C2C12 myotubes is associated with a decrease in Qmax, apparently without affecting VQ1/2 or the steepness of the curves (Table 2). Fig. 9 also shows charge-movement traces recorded in C2C12 cells transfected with pSHAG (B) or JP-45 siRNA (C). The lower Qmax value in JP-45-depleted C2C12 cells might originate from a decrease in the amount of Cav1.1 in muscle cell membrane. To verify this, we quantified by western blot analysis the relative amount of the Cav1.1 in membranes of C2C12 cells that had been transfected with JP-45 siRNA or pSHAG. The Cav1.1 shows two distinct high-molecular mass bands of 175 kDa and 170 kDa (Fig.9 D,E) (Leung et al., 1987
). Furthermore, in JP-45-depleted C2C12 myotubes, there is a significant reduction of the immunoreactive band that referes to the Cav1.1 (Fig. 9D,E). Expression of the Cav1.1, measured as the ratio of the immunopositive band between siRNA-JP-45-transfected and control pSHAG-vector-transfected C2C12 cells, was 0.63±0.10 (mean ± s.e.m., n=4). The fractional decrease of Cav1.1 expression is 0.37±0.09 (mean ± s.e.m., n=4) and matches the decrease in charge movement (fractional decrease is 0.34) shown in Table 2. These results indicate that JP-45 is important for proper insertion of the
1.1 subunit into the membrane of muscle cells.
|
|
|
A number of data have been obtained in the last few years concerning structural determinant(s) necessary for the proper functional insertion of Cav1.1 into the plasma membrane. Although not all aspects of the functional insertion into the membrane and of the targeting of the Cav1.1 are fully understood, the emerging idea is that cooperation of the AID domain in the I-II loop with the C-terminal domain, as well as the tertiary and quaternary structure assembly of the Cav1 complex, play a crucial role in the functional expression of the Cav1.1 in the cell membrane (Flucher et al., 2002
). However, involvement of additional protein-protein interactions between other polypeptides of the triad membrane has been implied for the proper functional insertion of the Cav1.1. We suggest that JP-45 is one of these additional polypeptides important for the proper assembly of the Cav1.1 macromolecular complex into the plasma membrane.
Here, we have shown that JP-45 domain 2 interacts with the AID sequence and with the C-terminal domain of the Cav1.1, two important structural determinants for functional expression of the Cav1.1. In addition, we have provided clear evidence that the level of JP-45 expression in C2C12 myotubes affects the functional properties and expression of Cav1.1. By altering expression levels of JP-45 in differentiated C2C12 myotubes by overexpressing its cDNA or by JP-45 gene silencing, the stoichiometry of the JP-45-Cav1.1 supramolecular complex is dramatically altered. It is tempting to speculate that alteration of the stoichiometry of the complex influences the functional expression of the Cav1.1 by different mechanisms. Fig. 10 summarizes a speculative model, which describes the potential mode of action of JP-45 on Cav1.1 function and underlines the importance of the correct stoichiometry of JP-45-Cav1.1 on the functional expression of Cav1.1. Overexpression of JP-45 does not seem to induce major changes in the expression levels of
1.1, however it could enforce occupation of its binding site of the I-II loop. This occupation of the JP-45 binding site within the I-II loop might occur as consequence of a partial dissociation of the Cav1 ß1a subunit or through interaction with the Cav1.1, which does not stably bind ß1a subunit (Garcia et al., 2002
; Jones et al., 2002). The I-II loop is adjacent to a repeat within the
1.1 subunit domain involved in channel gating. It is tempting to speculate that the effect of the overexpression and binding of JP-45 to the binding site within I-II loop is twofold: (1) Interference with the ß1a action on gating currents (Strube et al., 1996
, Sheridan et al., 2003
). (2) Perturbation of the functional role of the adjacent repeat on channel function. Each outcome, or the combination of both, would confer a restricted conformation on the JP-45-Cav1.1 supramolecular complex, leading to a decrease in charge movement. However, as indicated by western blot analysis, depletion of JP-45 affects the total amount of Cav1.1 in the cell membrane and, in parallel, also decreases the maximal charge movement. The mechanism leading to the decrease in the amount of Cav1.1 in cell membranes of JP-45-depleted cells might have several explanations. First, our results show that JP-45 interacts with the C-terminal domain, a region that has been shown to encompass a sequence involved in membrane targeting. When this sequence does not interact with JP-45, proper membrane targeting of Cav1.1 might be impaired. Second, JP-45 is involved in stabilizing the Cav1 complex. The functional consequence of both events is a decrease in Qmax, with no changes in the voltage dependence of the charge movement.
|
JP-45 is expressed at a very early stage of skeletal-muscle development - its transcript appears in 15-day-old embryos (Anderson et al., 2003
) - in a developmental phase in which ER-SR membrane transition is not completed. In immature skeletal muscle fibres JP-45 might be localized in the ER-SR membrane network; then, in adult muscle fibres, JP-45 is targeted to the junctional face membrane of the SR. JP-45 might be involved in the retention of the Cav1.1 into the ER-SR membrane during the assembly of the Cav1.1 complex at an early stage of skeletal-muscle development. The appearance of the ß1a subunit interferes with the interaction of JP-45 with the I-II loop of the Cav1.1. Such an event, together with an interaction of JP-45 and the C-terminal targeting domain, allows the functional expression of the Cav1.1 to the transverse tubular membranes.
| Materials and Methods |
|---|
|
|
|---|
1 subunit polyclonal Abs against the skeletal muscle Cav1.1 were from Santa Cruz Biotechnology Inc.; isopropyl-ß-D-thiogalactoside (IPTG), chemiluminescence kit, restriction enzymes, fugene transfection reagent, peroxidase-conjugated anti-goat Abs and EDTA-free anti-protease cocktail were from Roche Applied Science; protein-G peroxidase, protein assay determination kit and SDS-PAGE protein standards were from Bio-Rad; Talon metal affinity resin was from BD Bioscience; tricine, anti-poly-histidine, anti-ß-actin Abs and peroxidase-conjugated anti-mouse Abs were from Sigma. Jet PEI transfection reagent was from Polyplus-Transfection SAS (Illkirch, France). Protein G plus Agarose was from Santa Cruz Biotechnology, Santa Cruz, CA. The pFP-N3/DsRed2 vector was constructed by in-frame substitution of the sequence encoding EGFP with that of DsRed2 in the pEGFP plasmid (Clonetech). The sequence of the plasmid backbone used for subsequent cloning of JP-45 cDNA was confirmed by sequencing. All other chemicals were reagents of highest grade available.
Production and purification of fusion proteins
PCR-amplified cDNA encoding overlapping sequences of mouse skeletal muscle JP-45 were cloned in-frame into the multiple cloning site of pGex5x-3. PCR amplification conditions and primer sequences were as previously described (Anderson et al., 2003
), using the following sets of primers (forward and reverse, respectively): domain 1, encompassing residues 1-29 (5'-AGAATTCTATGACTACCAGAGGCCTGG-3' and 5'-AGTCGACGGCTGGTCCCTCCAGAAAT-3'); domain 2, encompassing residues 1-80 (5'-AGAATTCTATGACTACCAGAGGCCTGG-3' and 5'-AGTCGACTGTGCTCTCCTTGCCCGCTA-3'); domain 3, encompassing residues 81-125 (5'-AGAATTCTGGCAAAGCGGGAACAA-3' and 5'-AGTCGACATCTCCCCAGGGCAGGTC-3'); the N-terminus, encompassing residues 1-125 (5'-AGAATTCTATGACTACCAGAGGCCTGG-3' and 5'-AGTCGACATCTCCCCAGGGCAGGTC-3'); the C-terminus, encompassing residues 149-331 (5'-AGAATTCTCGGGACGCAGTGGCT-3' and 5'-AGTCGACGTCACGCCCCTTCCCTCGCTT-3'). The EcoRI restriction site was added to facilitate subsequent subcloning. cDNA was amplified in a Perkin Elmer GeneAmp 2400 PCR System under the following conditions: 5 minutes at 95°C, followed by 35 cycles of 40 seconds annealing at 61°C, 45 seconds extension at 72°C, 30 seconds denaturation at 92°C and a final elongation step of 4 minutes at 72°C.
The cDNAs encoding different domains of rabbit skeletal muscle Cav1.1
1.1 subunit (Tanabe et al., 1987
) were cloned into the pMR78 expression vector designed to express His-tagged proteins. The
1.1 subunit constructs used include the N-terminus (encompassing residues 1-51), the I-II loop (encompassing residues 335-432), the II-III loop (encompassing residues 654-797), the III-IV loop (encompassing residues 1059-1118), the proximal C-terminus (encompassing residues 1382-1585), the distal C-terminus (encompassing residues 1588-1878) and the full-length Cav1.1 ß1a subunit. All constructs were checked by direct sequencing. Plasmids were used to transform E.coli DH5
cells and fusion-protein production was induced by the addition of 100 µM of isopropyl-ß-D-thiogalactoside (IPTG). Fusion proteins were purified, according to the manufacturer's recommendations, with glutathione-Sepharose for GST-tagged fusion proteins and the Talon metal affinity resins for the His-tagged
1.1 subunit fusion proteins. The protein concentration of the purified proteins was determined with the Bio-Rad protein assay kit and bovine serum albumin as standard (Bradford, 1976
). Proteins eluted from the affinity columns were analysed by SDS-PAGE or Tricine-SDS-PAGE (Schagger and von Jagow, 1987
) and visualized by either Coomassie Brilliant Blue or stained with anti-poly-histidine Abs.
Immunoprecipitation and co-immunoprecipitation experiments
Light microsomal vesicles derived from rabbit skeletal muscle were prepared as described by Saito et al. (Saito et al., 1984
) Membranes were solubilized at a final concentration of 1 mg/ml, for 30 minutes at room temperature in a buffer composed of 1% CHAPS, 200 mM NaCl, 1 mM dithiothreitol, 50 mM Tris-HCl pH 8.5 to which the protease inhibitor cocktail was added. Co-immunoprecipitation experiments of native proteins were performed as previously described with the monoclonal anti-JP-45 Ab (Anderson et al., 2003
). To identify the domain(s) of JP-45 interacting with the Cav1.1, CHAPS-solubilized light microsomal vesicles were incubated for 60 minutes with glutathione-Sepharose beads to which GST-JP-45 fusion proteins had been bound. Following low-speed centrifugation, the beads were washed three times with PBS; bound proteins were eluted using glutathione elution buffer, separated on a 10% SDS-PAGE and transferred onto nitrocellulose. To identify JP-45-binding domains of Cav1.1, the JP-45 domain-2 fusion protein encompassing was immobilized on GST-Sepharose beads and incubated for 60 minutes with purified His-tagged fusion proteins covering various domains of the
1.1 subunit, including the N-terminal domain, the I-II, II-III, III-IV loops, the C-terminal-distal and C-terminal-proximal domains, and the ß1a domain in 10 mM HEPES and 150 mM NaCl plus anti-proteases. Beads were processed as described above.
C2C12 cells were washed with PBS, treated with 1% digitonin buffer (1% digitonin, 185 mM KCl, 1.5 mM CaCl2, 10 mM HEPES pH 7.4) on ice for 1 hour and centrifuged at 10,000 g for 10 minutes at 4°C. The lysate (500 µg total protein) was precleared by adding 0.5 µg of mouse IgG together with 20 µl of Protein G plus Agarose, and incubated for 30 minutes on a rotating device at 4°C. After centrifugation at 1000 g, the supernatant was transferred to a fresh tube on ice. Mouse Cav1.1
1 subunit primary Ab (IIF7) (kindly provided by Kevin P. Campbell, University of Iowa, Howard Hughes Medical Institute, Iowa City, IA) (Leung et al., 1987
) was added and incubated overnight at 4°C. Then 20 µl Protein G plus Agarose was added to each tube and incubated for 2 hours. After centrifugation, the pellets were washed with PBS and resuspended in 20 µl of double-strength sample buffer for 30 minutes at room temperature (Murray and Olendieck, 1997
). The proteins were separated on a 10% SDS-PAGE gel and subsequently transferred onto PVDF membrane. Non-specific binding was blocked by incubating the membrane in 5% non-fat milk in PBS for 60 minutes at room temperature. Incubation in the primary Ab (1:1000 diluted in blot buffer) was for 2 hours at room temperature after which proteins were washed three times for 5 minutes with PBS. The membrane was incubated with anti-mouse IgG conjugated with horseradish peroxidase (HP) for 60 minutes, washed, and finally incubated in ECL Reagent and visualized in X-ray films. Autoradiograms were scanned and analyzed with KODAK-1D Image Analysis Software (Eastman Kodak Company, Rochester, NY).
Polyclonal Ab production and western blot analysis
Rabbit polyclonal antiserum was generated by immunizing a New Zealand white rabbit with glutathione-Sepharose purified GST-JP-45 fusion protein encompassing the cytoplasmic domain (aa 1-125) of JP-45. Serum was tested for the presence of Ab one month after immunization and subsequently the IgG fraction was purified by protein A column chromatography. Immunodetection of
1.1 subunit His-tagged fusion proteins was carried out with monoclonal anti-poly-histidine Ab, followed by HP-conjugated anti-mouse IgG; immunodetection of
1.1 subunit and JP-45 was carried out as described (Anderson et al., 2003
). Immunopositive bands were visualized by chemiluminescence.
Cell culture and transfection
The mouse C2C12 muscle cell line was obtained from American Type Culture Collection (ATCC, Rockville, MD), cultured in standard conditions and maintained in growth medium (Dulbecco's modified Eagle's medium, DMEM, supplemented with 20% foetal bovine serum, 100 units/ml penicillin and 100 µg/ml streptomycin). Cells were induced to differentiate by switching the medium to differentiation medium (DMEM supplemented with 2% horse serum, 100 units/ml penicillin and 100 µg/ml streptomycin). For overexpression experiments, C2C12 cells were transfected with the cDNA encoding JP-45, cloned in-frame into a hybrid pFP-N3-DsRed2 vector. Briefly, 2 days after plating, cells were transfected by adding a solution of plasmid DNA (1 µg) and 3 µl FUGENE6 previously mixed for 30 minutes at room temperature, to the tissue culture medium. Electrophysiological measurements were made on differentiated cells 5-6 days after cell transfection. To deplete C2C12 of JP-45, we transfected cells with a JP-45 siRNA vector pSHAG. JP-45 RNA interference oligos were designed with siRNA Wizard software available at InvivoGene webpage. We chose the GCTCAACAAGTGCCTGGTACTGGCCTCGCTG nucleotides of JP-45 coding sequence. Complementary JP-45 RNAi oligos were synthesised according to the instructions of G. Hannon (Cold Spring Harbor), annealed and ligated downstream U6 RNA Pol III promoter of the pSHAG-1 vector as previously described (Treves et al., 2004
). The nucleotide sequence of the JP-45 siRNA construct was verified by sequencing. For transfection experiments, C2C12 cells were plated on 12-mm diameter glass coverslips or on 100-mm diameter tissue culture dishes and once they reached 50-60% confluency they were transfected by a combination of CaPO4 and Jet PEI, using a total of 7.5 µg of plasmid DNA (coverslips) or 15 µg plasmid DNA (cell culture dishes). The day after transfection, the medium was changed and the cells were allowed to recover for 24 hours. On day 3, the cells were induced to differentiate by switching the medium to differentiation medium (DMEM supplemented with 2% horse serum, 100 units/ml penicillin and 100 µg/ml streptomycin) and were transfected again as described above to increase transfection efficiency. The next day fresh differentiation medium was added and cells were allowed to differentiate for another 3 days, after which multinucleated myotubes were clearly visible. Total RNA was extracted from transfected cells, converted into DNA as previously described (Treves et al., 2004
) and reverse transcriptase (RT)-PCR was carried out with JP-45-specific or ß-actin-specific primers. Western bloting was done with an Ab recognizing the N-terminal domain of JP-45.
Charge movement and fluorescence recordings
For charge movement recordings, C2C12 cells were plated on glass coverslips and mounted in a small flow-through Lucite chamber positioned on a microscope stage. Myotubes were continuously perfused with the external solution (see below) using a push-pull syringe pump (WPI, Saratoga, FL.). Cells were voltage-clamped in the whole-cell configuration of the patch-clamp (Hamill et al., 1981
; Wang et al., 1999
) using an Axopatch-200B amplifier (Axon Instruments/Molecular Devices, Union City, CA). Micropipettes were pulled from borosilicate glasses (Boralex) using a Flaming Brown micropipette puller (P97, Sutter Instrument Co., Novato, CA) to obtain electrode resistance ranging from 2-4 M
. The composition of the internal solution (pipette) was (in mM): 140 Cs-aspartate; 5 Mg-aspartate2, 10 Cs2EGTA (ethylene glycol-bis(
-aminoethyl ether)-N,N,N'N'-tetraacetic acid), 10 HEPES, pH was adjusted to 7.4 with CsOH. The high concentration of Mg2+ in the pipette solution helped to stabilize the preparation for longer periods. The external solution contained (in mM): 145 TEA (tetraethylammonium)-Cl, 10 CaCl2, 10 HEPES and 0.001 tetrodotoxin. Solution pH was adjusted to 7.4 with TEA.OH. For charge movement recording, Ca2+ current was blocked by the addition of 0.5 Cd2+ plus 0.3 La3+ to the external solution (Hamill et al., 1981
; Wang et al., 1999
; Wang et al., 2000
; Beam and Franzini-Armstrong, 1997
).
Whole-cell currents were acquired and filtered at 5 kHz with pClamp 6.04 software (Axon). A Digidata 1200 interface (Axon) was used for A-D conversion. Membrane current during a voltage pulse, P, was initially corrected by analogue subtraction of linear components. The remaining linear components were digitally subtracted on-line using hyperpolarizing control pulses of one-quarter test pulse amplitude (-P/4 procedure) (Delbono, 1992
). The four control pulses were applied before the test pulse. We recorded the charge movement corresponding to gating of the L-type Ca2+ channel Cav1.1. To this end, we used a prepulse protocol consisting of a 2-second prepulse to -30 mV and a subsequent 5-millisecond repolarization to a pedestal potential of -50 mV, followed by a 12.5-millisecond depolarization from -50 mV to 50 mV with 10-mV intervals (Adams et al., 1990
). The optimal duration of the prepulse defined as the value at which no further immobilization of charge movement is attained was determined to be 2 seconds, after testing a range of prepulses from 1-6 seconds (Wang et al., 2000
). Intramembrane charge movements were calculated as the integral of the current in response to depolarizing pulses (charge on, Qon) and were expressed per membrane capacitance (Coulombs per Farad). The complete blockade of the inward Ca2+ current was verified by the Qon - Qoff linear relationship. Membrane capacitance was calculated as the integral of the transient current in response to a brief hyperpolarizing pulse from -80 mV (holding potential) to -100 mV.
To correlate the level of transfection with charge movement, we recorded fluorescence intensity arising from pFP-N3-DsRed2 in JP-45-transfected or pFP-N3-DsRed2-transfected cells with a Radiance 2100K1 laser scanning confocal system (Zeiss, Oberkochen, Germany). Fluorescence intensity was acquired in all the areas of the cell by using a krypton laser at 568 nm and recording the emission at 640 nm. The acquisition settings, including iris aperture (used at maximum), laser intensity, exposure, and gain were maintained unmodified from cell to cell to standardize recordings and make the comparison among cells valid. The maximum fluorescent intensity of the whole cell was analyzed in digitized images and expressed in arbitrary units (AU).
Data were analyzed using Student's t-test or analysis of variance (ANOVA). A value of P<0.05 was considered significant. Data are expressed as mean ± s.e.m. with the number of observations (n).
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Adams, B. A., Tanabe, T., Mikami, A., Numa, S. and Beam, K. G. (1990). Intramembrane charge movement restored in dysgenic skeletal muscle by injection of dihydropyridine receptor. Nature 346, 569-572.[CrossRef][Medline]
Ahern, C. A., Sheridan, D. C., Cheng, W., Mortenson, L., Nataaraj, P., Allen, P., DeWaard, M. and Coronado, R. (2003). Ca2+ current and charge movements in skeletal myotubes promoted by the beta-subunit of the dihydropyridine receptor in the absence of ryanodine receptor type 1. Biophys. J. 84, 942-959.[Medline]
Anderson, A. A., Treves, S., Biral, D., Betto, R., Sandona, D., Ronjat, M. and Zorzato, F. (2003). The novel skeletal muscle sarcoplasmic reticulum JP-45 protein. Molecular cloning, tissue distribution, developmental expression, and interaction with alpha 1.1 subunit of the voltage-gated calcium channel. J. Biol. Chem. 278, 39987-39992.
Beam, K. G. and Franzini-Armstrong, C. (1997). Functional and structural approaches to the study of excitation-contraction coupling. Methods Cell Biol. 52, 283-306.[Medline]
Beurg, M., Ahern, C. A., Vallejo, P., Conklin, M. W., Powers, P. A., Gregg, R. G. and Coronado, R. (1999). Involvement of the carboxy-terminus region of the dihydropyridine receptor beta1a subunit in excitation-contraction coupling of skeletal muscle. Biophys. J. 77, 2953-2967.[Medline]
Bichet, D., Cornet, V., Geib, S., Carlier, E., Volsen, S., Hoshi, T., Mori, Y. and DeWaard, M. (2000). The I-II loop of the Ca2+ channel alpha1 subunit contains an endoplasmic reticulum retention signal antagonized by the beta subunit. Neuron 25, 177-190.[CrossRef][Medline]
Birnbaumer, L., Qin, N., Olcese, R., Tareilus, E., Platano, D., Costantin, J. and Stefani, E. (1998). Structures and functions of calcium channel beta subunits. J. Bioenerg. Biomembr. 30, 357-375.[CrossRef][Medline]
Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248-254.[CrossRef][Medline]
Catterall, W. A. (1995). Structure and function of voltage-gated ion channels. Annu. Rev. Biochem. 64, 493-531.[CrossRef][Medline]
Chen, Y., Li, M., Zhang, Y., He, L., Yamada, Y., Fitzmaurice, A., Shen, Y., Zhang, H., Tong, L. and Yang, J. (2004). Structural basis of the alpha1-beta subunit interaction of voltage-gated Ca2+ channels. Nature 429, 675-680.[CrossRef][Medline]
Chien, A. J., Zhao, X., Shirokov, R. E., Puri, T. S., Chang, C. F., Sun, D., Rios, E. and Hosey, M. M. (1995). Roles of a membrane-localized beta subunit in the formation and targeting of functional L-type Ca2+ channels. J. Biol. Chem. 270, 30036-30044.
Costello, B., Chadwick, C., Saito, A., Chu, A., Maurer, A. and Fleischer, S. (1986). Characterization of the junctional face membrane from terminal cisternae of sarcoplasmic reticulum. J. Cell Biol. 103, 741-753.
Delbono, O. (1992). Calcium current activation and charge movement in denervated mammalian skeletal muscle fibres. J. Physiol. Lond. 451, 187-203.
Endo, M. (1977). Calcium release from sarcoplasmic reticulum. Physiol. Rev. 57, 71-108.
Fleischer, S. and Inui, M. (1989). Biochemistry and biophysics of excitation-contraction coupling. Annu. Rev. Biophys. Biophys. Chem. 18, 333-364.[CrossRef][Medline]
Flucher, B. E., Kasielk, N. and Grabner, M. (2000). The triad targeting signal of the skeletal muscle calcium channel is localized in the COOH terminus of the alpha(1S) subunit. J. Cell Biol. 151, 467-478.
Flucher, B. E., Weiss, R. G. and Grabner, M. (2002). Cooperation of two-domain Ca(2+) channel fragments in triad targeting and restoration of excitation-contraction coupling in skeletal muscle. Proc. Natl. Acad. Sci. USA 99, 10167-10172.
Franzini-Armstrong, C. (1980). Structure of sarcoplasmic reticulum. Fed. Proc. 39, 2403-2409.[Medline]
Franzini-Armstrong, C. A. and Jorgensen, A. O. (1994). Structure and development of E-C coupling units in skeletal muscle. Annu. Rev. Physiol. 56, 509-534.[CrossRef][Medline]
Garcia, R., Carrillo, E., Rebolledo, S., Garcia, M. C. and Sanchez, J. A. (2002). The beta1a subunit regulates the functional properties of adult frog and mouse L-type Ca2+ channels of skeletal muscle. J. Physiol. 545, 407-419.
Grabner, M., Dirksen, R. T., Suda, N. and Beam, K. G. (1999). The II-III loop of the skeletal muscle dihydropyridine receptor is responsible for the Bi-directional coupling with the ryanodine receptor. J. Biol. Chem. 274, 21913-21919.
Gregg, R. G., Meissing, A., Strube, C., Beurg, M., Moss, R., Behan, M., Sukhareva, M., Haynes, S., Powell, J. A., Coronado, R. et al. (1996). Absence of the beta subunit (cchb1) of the skeletal muscle dihydropyridine receptor alters expression of the alpha 1 subunit and eliminates excitation-contraction coupling. Proc. Natl. Acad. Sci. USA 93, 13961-13966.
Hamill, O. P., Marty, A., Neher, E., Sakmann, B. and Sigworth, F. J. (1981). Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches. Pflugers Arch. 391, 85-100.[CrossRef][Medline]
Ito, K., Komazaki, S., Sasamoto, K., Yoshida, M., Nishi, M., Kitamura, K. and Takeshima, H. (2001). Deficiency of triad junction and contraction in mutant skeletal muscle lacking junctophilin type 1. J. Cell Biol. 154, 1059-1067.
Kugler, G., Weiss, R. G., Flucher, B. E. and Grabner, M. (2004). Structural requirements of the dihydropyridine receptor alpha1S II-III loop for skeletal-type excitation-contraction coupling. J. Biol. Chem. 279, 4721-4728.
Jones, L. P., Wei, A. K. and Yue, D. T. (1998). Mechanism of auxiliary subunit modulation of neuronal alpha1E calcium channels. J. Gen. Physiol. 112, 125-143.
Jones, S. W. (2002). Calcium channels: when is a subunit not a subunit? J. Physiol. 545, 33.
Lacerda, A. E., Kim, H. S., Ruth, P., Perez-Reyes, E., Flockerzi, V., Hofmann, F., Birnbaumer, L. and Brown, A. M. (1991). Normalization of current kinetics by interaction between the alpha 1 and beta subunits of the skeletal muscle dihydropyridine-sensitive Ca2+ channel. Nature 352, 527-530.[CrossRef][Medline]
Lamb, G. D. and Stephenson, D. G. (1990). Control of calcium release and the effect of ryanodine in skinned muscle fibres of the toad. J. Physiol. Lond. 423, 519-542.
Leung, A. T., Imagawa, T. and Campbell, K. P. (1987). Structural characterization of the 1,4-dihydropyridine receptor of the voltage-dependent Ca2+ channel from rabbit skeletal muscle. Evidence for two distinct high molecular weight subunits. J. Biol. Chem. 262, 7943-7946.
Ma, J. and Pan, Z. (2003). Junctional membrane structure and store operated calcium entry in muscle cells. Front. Biosci. 8, d242-d255.[Medline]
Meissner, G. (1994). Ryanodine receptor/Ca2+ release channels and their regulation by endogenous effectors. Annu. Rev. Physiol. 56, 485-508.[CrossRef][Medline]
Murray, B. E. and Ohlendieck, K. (1997). Cross-linking analysis of the ryanodine receptor and alpha1-dihydropyridine receptor in rabbit skeletal muscle triads. Biochem. J. 324, 689-696.
Nakai, J., Sekiguchi, N., Rando, T. A., Allen, P. D. and Beam, K. G. (1998). Two regions of the ryanodine receptor involved in coupling with L-type Ca2+ channels. J. Biol. Chem. 273, 13403-13406.
Pragnell, M., De Waard, M., Mori, Y., Tanabe, T., Snutch, T. P. and Campbell, K. P. (1994). Calcium channel beta-subunit binds to a conserved motif in the I-II cytoplasmic linker of the alpha 1-subunit. Nature 368, 67-70.[CrossRef][Medline]
Saito, A., Seiler, S., Chu, A. and Fleischer, S. (1984). Preparation and morphology of sarcoplasmic reticulum terminal cisternae from rabbit skeletal muscle. J. Cell Biol. 99, 875-885.
Schagger, H. and von Jagow, G. (1987). Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 166, 368-379.[CrossRef][Medline]
Sheridan, D. C., Cheng, W., Ahern, C. A., Mortenson, L., Alsammarae, D., Vallejo, P. and Coronado, R. (2003). Truncation of the carboxyl terminus of the dihydropyridine receptor beta1a subunit promotes Ca2+ dependent excitation-contraction coupling in skeletal myotubes. Biophys. J. 84, 220-237.[Medline]
Sheridan, D. C., Cheng, W., Carboneau, L., Ahern, C. A. and Coronado, R. (2004). Involvment of a heptad repeat in the carboxyl terminus of the dihydropyridine receptor beta1a subunit in the mechanism of excitation-contraction coupling in skeletal muscle. Biophys. J. 87, 929-942.[CrossRef][Medline]
Snutch, T. P. and Reiner, P. B. (1992). Ca2+ channels: diversity of form and function. Curr. Opin. Neurobiol. 2, 247-253.[CrossRef][Medline]
Strube, C., Beurg, M., Powers, P. A., Gregg, R. G. and Coronado, R. (1996). Reduced Ca2+ current, charge movement, and absence of Ca2+ transients in skeletal muscle deficient in dihydropyridine receptor beta 1 subunit. Biophys. J. 71, 2531-2543.[Medline]
Sutko, J. L. and Airey, J. A. (1996). Ryanodine receptor Ca2+ release channels: does diversity in form equal diversity in function? Physiol. Rev. 76, 11027-11071.
Rios, E. and Pizarro, G. (1991). Voltage sensor of excitation-contraction coupling in skeletal muscle Physiol. Rev. 71, 849-908.
Takeshima, H., Komazaki, S., Nishi, M., Iino, M. and Kangawa, K. (2000). Junctophilins: a novel family of junctional membrane complex proteins. Mol. Cell 6, 11-22.[CrossRef][Medline]
Tanabe, T., Takeshima, H., Mikami, A., Flockerzi, V., Takahashi, M., Kangawa, K., Kojima, M., Matsuo, H., Hirose, T. and Numa, S. (1987). Primary structure of the receptor for calcium channel blockers from skeletal muscle. Nature 328, 313-318.[CrossRef][Medline]
Treves, S., Franzini-Armstrong, C., Moccagatta, L., Arnoult, C., Grasso, C., Schrum, A., Ducreux, S., Zhu, M. X., Mikoshiba, K., Girard, T. et al. (2004). Junctate is a key element in calcium entry induced by activation of InsP3 receptors and/or calcium store depletion. J. Cell Biol. 166, 537-548.
Tsien, R. W., Ellinor, P. T. and Horne, W. A. (1991). Molecular diversity of voltage-dependent Ca2+ channels. Trends Pharmacol. Sci. 12, 349-354.[CrossRef][Medline]
Van Petegem, F., Clark, K. A., Chatelain, F. C. and Minor, D. L., Jr (2004). Structure of a complex between a voltage-gated calcium channel beta-subunit and an alpha-subunit domain. Nature 429, 671-675.[CrossRef][Medline]
Wang, Z.-M., Messi, M. L. and Delbono, O. (1999). Patch-clamp recording of charge movement, Ca(2+) current, and Ca(2+) transients in adult skeletal muscle fibers. Biophys. J. 77, 2709-2716.[Medline]
Wang, Z.-M., Messi, M. L. and Delbono, O. (2000). L-Type Ca(2+) channel charge movement and intracellular Ca(2+) in skeletal muscle fibers from aging mice. Biophys. J. 78, 1947-1954.[Medline]
Zhang, L., Kelley, J., Schmeisser, G., Kobayashi, Y. M., Jones, L. R. (1997). Complex formation between junctin, triadin, calsequestrin, and the ryanodine receptor. Proteins of the cardiac junctional sarcoplasmic reticulum membrane. J. Biol. Chem. 272, 23389-23397.
Zorzato, F., Anderson, A. A., Ohlendieck, K., Froemming, G., Guerrini, R. and Treves, S. (2000). Identification of a novel 45 kDa protein (JP-45) from rabbit sarcoplasmic-reticulum junctional-face membrane. Biochem. J. 351, 537-543.
This article has been cited by other articles:
![]() |
B. T. Corona, E. M. Balog, J. A. Doyle, J. C. Rupp, R. C. Luke, and C. P. Ingalls Junctophilin damage contributes to early strength deficits and EC coupling failure after eccentric contractions Am J Physiol Cell Physiol, February 1, 2010; 298(2): C365 - C376. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Treves, M. Vukcevic, M. Maj, R. Thurnheer, B. Mosca, and F. Zorzato Minor sarcoplasmic reticulum membrane components that modulate excitation\#8211;contraction coupling in striated muscles J. Physiol., July 1, 2009; 587(13): 3071 - 3079. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Delbono, J. Xia, S. Treves, Z.-M. Wang, R. Jimenez-Moreno, A. M. Payne, M. L. Messi, A. Briguet, F. Schaerer, M. Nishi, et al. Loss of skeletal muscle strength by ablation of the sarcoplasmic reticulum protein JP45 PNAS, December 11, 2007; 104(50): 20108 - 20113. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||