|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 9 May 2006
doi: 10.1242/jcs.02947
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
1 Department of Medical Protein Research, Faculty of Medicine and Health Sciences, Flanders Interuniversity Institute for Biotechnology, VIB09, Ghent University, A. Baertsoenkaai 3, 9000 Ghent, Belgium
2 Institute of Pharmacology and Toxicology, Medical Faculty of the RWTH Aachen University, 52074 Aachen, Germany
* Author for correspondence (e-mail: jan.tavernier{at}UGent.be)
Accepted 20 February 2006
| Summary |
|---|
|
|
|---|
Key words: Leptin receptor, SOCS proteins, Signalling, Cross-regulation
| Introduction |
|---|
|
|
|---|
The LR was addressed to the type I cytokine receptor family based on sequence homology (Tartaglia et al., 1995
). It is closely related to the gp130 receptor family, especially gp130, oncostatin M (OSM) and leukaemia inhibitory factor (LIF) receptors, and to the G-CSF receptor (granulocyte-colony stimulating factor) (Zabeau et al., 2003
). Leptin typically signals through the JAK-STAT pathway. An overview of LR signalling events is shown in Fig. 1A. The LR carries three conserved tyrosines in its cytoplasmic tail (positions Y985, Y1077 and Y1138 in the murine LR), whereby the membrane distal tyrosine Y1138 is embedded in a STAT3 (signal transducer and activator of transcription) recruitment motif. The activated receptor recruits STAT3 molecules through their SH2 domain (Baumann et al., 1996
; Vaisse et al., 1996
), and, after tyrosine phosphorylation, they translocate as homodimers to the nucleus to induce specific gene expression.
|
CIS (cytokine-inducible SH2 protein) was the founding member of the SOCS (suppressor of cytokine signalling) family, now consisting of eight proteins: SOCS1-7 and CIS. SOCS proteins typically have an SH2-domain, an N-terminal preSH2-domain and a C-terminal SOCS box (Starr et al., 1997
). The SOCS box targets signalling proteins to the proteasome for degradation by recruitment of an ubiquitin-transferase system (Kile et al., 2002
). Elongin B or C of the E3 ligase complex is recruited to the BC box in the SOCS box (Kamura et al., 1998
). SOCS1 and 3 also carry a KIR (kinase inhibitory region) domain that may act as a pseudosubstrate for direct inhibition of JAK kinase activity. Although SOCS1 associates with JAK2, SOCS3 binds the receptor in close proximity to the kinase and shows only weak affinity for JAK2 (Kubo et al., 2003
). Competition for binding to shared recruitment sites can also contribute to the negative regulation of signalling pathways, as exemplified for CIS and SOCS2 in case of STAT5 recruitment at the growth hormone receptor (Greenhalgh et al., 2002a
; Ram and Waxman, 1999
).
SOCS3 was identified as a potent inhibitor of LR signalling. It associates predominantly with the pY985 motif in the LR. Weak interaction at position pY1077 may explain its additive effect on inhibition of LR signalling (Bjorbaek et al., 2000
; Eyckerman et al., 2000
). SOCS3 is rapidly expressed in the hypothalamus upon leptin stimulation making it part of a STAT3-mediated negative feedback system (Bjorbaek et al., 1998a
; Dunn et al., 2005
). Recently, PTP-1B was also identified as a negative mediator of LR signalling, targeting both the JAK-STAT and the MAPK pathway (Kaszubska et al., 2002
).
It is well established that in many cytokine receptor systems multiple SOCS proteins can be involved in regulation. In the case of the growth hormone, erythropoietin and prolactin receptors, this includes CIS, SOCS2 and SOCS3. Since leptin can activate STAT5 (Baumann et al., 1996
; Hekerman et al., 2005
) and since CIS and SOCS2 are known regulators of STAT5 recruitment (Ram et al., 1999; Greenhalgh et al., 2002a
), we questioned whether CIS or SOCS2 could be involved in LR signalling. Consistent with this, highly conserved tyrosine-based motifs compatible with CIS and SOCS2 association are present in the LR. Also, leptin can induce CIS and SOCS3 expression, and to a lesser extent SOCS2 in insulinoma cells (data not shown). To analyse these interactions with the LR we used two alternative versions of the MAPPIT (mammalian protein-protein interaction trap) strategy (Fig. 1). We observed differential binding of CIS and SOCS2 with the LR and demonstrate two distinct mechanisms for functional interference by SOCS2.
| Results |
|---|
|
|
|---|
To monitor interactions with isolated tyrosine motifs of the LR, we developed a MAPPIT configuration whereby the cytosolic domain of the LR is replaced by a large array of Gly-Gly-Ser (GGS) repeats (Fig. 1C). The MAPPIT technique also allows the analysis of interactions with the LR itself by simple mutation of the Y1138 STAT3-recruitment motif to phenylalanine (Fig. 1D). LRs with different combinations of Y to F mutations of the two other conserved tyrosine motifs (located at positions Y985 and Y1077) were used. This allows the study of protein associations with the LR in its normal oligomeric configuration.
MAPPIT analysis of CIS and SOCS2 interactions with the LR
To determine interaction with the LR, the CISprey fusion protein was transiently co-expressed with the LR(YYF) mutant and the luciferase reporter construct (Fig. 2A). Clear induction of luciferase activity indicated that CIS interacts with the LR. MAPPIT experiments using LR(YFF), LR(FYF) or LR(F3) showed that CIS can interact with both Y985 and Y1077 motifs, whereas no interaction was detected with the LR lacking tyrosines. In a similar way we also tested the SOCS2-LR interaction (Fig. 2A). SOCS2 clearly associates with the LR, but only at position Y1077. Expression of the LR mutants was analysed using a leptin-SEAP binding assay (Fig. 2B), and expression of the FLAG-tagged CIS and SOCS2 preys was revealed by immunoblotting using an anti-FLAG antibody (Fig. 2C).
|
|
|
Analysis of CIS and SOCS2 interactions with the LR using GGS-MAPPIT
A new adaptation of the classic MAPPIT method, called GGS-MAPPIT (Fig. 1C), was used to confirm the interaction of CIS and SOCS2 with the LR. In this configuration the cytosolic domain of the LR, following the JAK2 interaction site, is replaced by 60 GGS repeats. GGS triplet repeats are often used as hinge sequences for their known structural flexibility. By using this GGS-MAPPIT strategy any background prey association with the LR-F3 is prevented. The bait constructs containing the LR motifs surrounding Y985 or Y1077 were transiently co-transfected with the prey construct and the rPAP luciferase reporter construct in HEK293T cells. Using GGS MAPPIT we were again able to detect the interaction of CIS with both the Y985 and Y1077 motifs, whereas SOCS2 only interacts with the Y1077 motif, but not with the pY985 motif (Fig. 5A). We tested this GGS-MAPPIT strategy further in erythroleukaemic TF-1 cells and obtained similar results as those found in HEK293T cells (Fig. 5B). A full-length FKBP12 bait was used to evaluate non-specific binding of the CIS and SOCS2 preys. FACS analysis, using antibodies against the extracellular domain of the EpoR, allowed monitoring of the expression of the different GGS baits (Fig. 5C).
|
SOCS2 interferes with STAT5a recruitment
We previously showed that STAT5 can be activated by the LR upon recruitment to the LR Y1077 and Y1138 motifs (Hekerman et al., 2005
). Given the strong interaction of SOCS2 at position Y1077 we examined whether SOCS2 can interfere with STAT5 association at this position. The SH2 domain of STAT5a was inserted in a prey construct and used in MAPPIT experiments using the Y1077 motif as bait in GGS-MAPPIT. In HEK293T cells, co-expression of SOCS2 or a SOCS2 mutant lacking the entire SOCS box completely abolished the MAPPIT signal. Similarly, co-expression of SOCS2
box in TF-1 cells also abrogated the MAPPIT signal, thus excluding a role for elongin B/C recruitment in this suppressive effect (Fig. 6A,B). Similar data were obtained using the LR(FYF) as bait (data not shown). We conclude that SOCS2 can compete with STAT5a association at the pY1077 motif.
|
SOCS2 interacts with the SOCS box of CIS
Given the discrepancy between binding experiments at position Y985, i.e. SOCS2 interferes with CIS binding without interacting with this recruitment motif itself, we examined whether SOCS2 can directly associate with CIS. We first used a MAPPIT configuration with CIS as bait. Here, SOCS2 clearly interacted specifically with full-length CIS (Fig. 7A). In Fig. 7B, we confirmed this interaction by co-immunoprecipitation. Next we looked at association of SOCS2 with the SOCS box of CIS in a MAPPIT experiment and also observed clear interaction (Fig. 7C).
|
Elongin B/C recruitment is involved in SOCS2 interference with receptor-binding of CIS
We developed a mutant of SOCS2, SOCS2(LC-QQ), in which elongin B/C recruitment is abrogated by mutating leucine 163 and cysteine 167, analogous to an elongin B/C recruitment-deficient SOCS1 mutant reported before (Kamura et al., 1998
). We mutated both residues to glutamines to minimise structural alterations. Elongin B/C association was analysed using a two-step purification method, TAP2, based on the classic TAP method (Puig et al., 2001
). This sequential purification procedure involves a first protein A tag-based step, followed by TEV protease cleavage to remove the protein A part of the tag and followed by a FLAG-tag-based immunoprecipitation step. Clearly, this SOCS2(LC-QQ) mutant no longer interacted with elongin B or C (Fig. 8A). Furthermore, this SOCS2 mutant as a prey protein still bound CIS in a MAPPIT experiment (Fig. 8B).
|
| Discussion |
|---|
|
|
|---|
CIS binding was observed with the conserved mLR Y985 and Y1077 tyrosine-based motifs. By contrast, SOCS2 interacted only at the Y1077 position. In all cases, a Y to F mutation abrogated signalling, indicative of the phosphorylation-dependent nature of the interactions. We compared MAPPIT-based interaction analysis with a biochemical approach using affinity chromatography with phosphorylated and non-phosphorylated peptides matching the Y1077 or the Y985 motifs. The interaction between SOCS2 and the pY1077 motif was readily demonstrated, in contrast to CIS and its matching phosphopeptides. This is probably due to the more transient or weak nature of the latter interactions. In line with this proposal, competition experiments showed that whereas CIS over-expression could clearly interfere with CISprey binding to either motif, no cross-competition with the SOCS2prey occurred. Conversely, SOCS2 could easily interfere with CISprey binding to pY1077.
Previous reports indicated that the tyrosine at position Y1077 of the receptor was not phosphorylated and was not involved in LR signalling (Banks et al., 2000
; Li and Friedman, 1999
). However, several observations contradict this supposition. We reported earlier that SOCS3 can interact with the Y1077 domain, although in a rather weak manner, and that this interaction was dependent on tyrosine phosphorylation (Eyckerman et al., 2000
). More recently, Y1077 was also reported to induce STAT5 activation (Hekerman et al., 2005
). Consistent with a functional role, Y1077 is present in a highly conserved motif, with great similarity to the conserved Y985 domain (Eyckerman et al., 2000
). Our findings now lend further support for the important role of the pY1077 motif in LR signalling with two more members of the SOCS protein family interacting at this position, whereby SOCS2 can interfere with CIS and STAT5a prey recruitment.
Very surprisingly, SOCS2 not only interfered with CIS-prey interaction at position Y1077, but also at the Y985 motif without binding this site itself. We provided an explanation for this unexpected finding by showing that SOCS2 directly binds to the SOCS box of CIS. Abrogation of the elongin B/C recruitment ability of SOCS2 had no influence on its association with CIS, but its ability to eliminate CIS receptor binding at position Y985 was completely lost, implying that ubiquitylation and proteasomal degradation of CIS is involved. Very recently, it was reported that SOCS2 also interferes with SOCS3-dependent inhibition of IL-2 and IL-3 signalling (Tannahill et al., 2005
). Together, these findings point to an additional, new level of SOCS-mediated signalling control. Reminiscent of this, both mice lacking SOCS2 and SOCS2 transgenic mice exhibit increased growth due to prolonged growth-hormone-dependent STAT5 activity (Greenhalgh et al., 2002b
; Metcalf et al., 2000
). This dual effect of SOCS2 was also observed in vitro because low SOCS2 doses moderately inhibit GH signalling whereas higher levels positively regulate signalling, probably through interference with SOCS1 function (Favre et al., 1999
; Greenhalgh et al., 2005
). Our interaction analysis clearly implicates a complex biological role for SOCS2 and suggests an explanation for the abovementioned duality: SOCS2 can interfere with cytokine signalling through direct interaction with receptors, but can also enhance signalling by eliminating other SOCS proteins through proteasomal degradation. This latter effect may reflect a crucial physiological role of SOCS2 in restoring cellular responsiveness after cytokine activation. In line with this, SOCS2 is usually induced at later time points compared with CIS, SOCS1 and SOCS3 (Adams et al., 1998
; Pezet et al., 1999
; Tannahill et al., 2005
). Detailed quantitative analyses will be required to understand this balancing act in full.
Leptin resistance, which occurs in a majority of obese individuals, may be situated at different levels, e.g. saturation of leptin transport through the blood-brain barrier or aberrations in LR signalling in hypothalamic neurons (El-Haschimi et al., 2000
). LR Y1138S knock-in mice are severely obese and fail to activate STAT3, implying a dominant role for STAT3 in leptin-mediated regulation of the energy balance (Bates et al., 2003
). Aberrant negative feedback control of LR signalling may contribute to leptin resistance and obesity, because augmented leptin sensitivity and resistance to diet-induced obesity was observed in neural-cell-specific SOCS3 conditional-knockout mice or in SOCS3-haploinsufficient mice (Howard et al., 2004
; Mori et al., 2004
). In contrast to SOCS3, a negative regulatory role for CIS and SOCS2 on the hypothalamic LR STAT3 pathway is questionable. Bjorbaek and colleagues reported that JAK2 phosphorylation is inhibited by SOCS3 upon leptin stimulation in COS cells but not by SOCS2 or CIS, which both lack a KIR domain at the N-terminus (Bjorbaek et al., 1999
). Similarly, we did not observe any clear inhibitory effect on LR signalling through STAT3 by either CIS or SOCS2 (data not shown). This is not unexpected because STAT3 recruitment occurs at the Y1138 motif. Since expression of SOCS2 or CIS is also not up-regulated in the hypothalamus upon leptin administration in mice, a role in LR STAT3 signalling is thus unlikely (Bjorbaek et al., 1998a
).
CIS and SOCS2 can function through competition with STAT binding at the receptor recruitment site. This mechanism, for example, underlies down-modulation of STAT5 activation by both CIS and SOCS2 upon growth hormone receptor (GHR) activation (Greenhalgh et al., 2002a
; Ram and Waxman, 1999
). Likewise, the physiological role for CIS and SOCS2 on LR signalling through the Y985 and Y1077 motifs may involve inhibition of recruitment of downstream signalling moieties. This may be particularly relevant in peripheral cell types, known to respond to leptin. Experiments on MLR (mixed-lymphocyte reaction), resulting from the culture of T cells with major histocompatibility complex (MHC)-incompatible stimulator cells, indicated that leptin promotes proliferation of CD4+ T cells (helper T cells, Th) and induces a shifts to activation of Th1 cells, associated with elevated secretion of pro-inflammatory cytokines including interleukin-2 (IL-2) and interferon-
(IFN-
) (Lord et al., 1998
). Intriguingly, CIS transgenic mice show altered helper T-cell development with a switch toward Th2 cell response, accompanied by increased IL-4 levels (Matsumoto et al., 1999
). CIS may thus be involved in the leptin-dependent modulation of the Th1/Th2 balance. SOCS2 knock-out mice showed a remarkable increase in size whereas growth retardation was observed in CIS transgenic mice. Both SOCS proteins were identified as negative regulators of GHR signalling, presumably through STAT5 (Matsumoto et al., 1999
; Metcalf et al., 2000
). Considering the decreased linear growth observed in db/db mice and humans with truncated LR (Bates et al., 2003
; Clement et al., 1998
), SOCS2 and CIS may also exert their influence on growth through regulation of LR signalling. Since LR Y1138S knock-in mice are not reduced in size (Bates et al., 2003
) and since, in addition, no clear effect of CIS or SOCS2 was observed on leptin-dependent STAT3 signalling, this effect of SOCS2 and CIS probably occurs independently of STAT3. A good candidate is STAT5, since it is activated in different cell types upon leptin stimulation in vitro through the Y1077 and Y1138 positions in the LR (Baumann et al., 1996
; Hekerman et al., 2005
). We here showed that SOCS2 can inhibit STAT5a prey association at the LR Y1077 position.
In conclusion, the MAPPIT approach was shown to be a sensitive and flexible system for analysing interactions between proteins in a cellular context. We identified two SOCS proteins, CIS and SOCS2, as new interaction partners of the LR, and identified a novel regulatory role for SOCS2. Full understanding of the biological implications of cross-regulation between SOCS proteins on the different cytokine receptor systems will require detailed, quantitative analysis of all members of this protein family.
| Materials and Methods |
|---|
|
|
|---|
The pXP2d2-rPAPI-luciferase reporter, originating from the rPAPI (rat pancreatitis-associated protein I) promoter, is used as previously described (Eyckerman et al., 2001
). Expression plasmid vectors pEF-FLAG-I/mSOCS2 and pEF-FLAG-I/mCIS were a gift from R. Starr (The Walter and Eliza Hall Institute of Medical Research, Parkville, Australia). Generation of the prey constructs pMG2-CIS and pMG2-SOCS2 both containing part of the gp130 chain (aa 905-918) in duplicate was described elsewhere (Montoye et al., 2005
).
The pMET7-FLAG-CIS construct was created by a three-point ligation. The N-terminal FLAG-tag of CIS was cut from the pEF-FLAG-I/mCIS construct using EcoRI-PvuII and the C-terminal part of CIS was cut from the pMG1-CIS construct using KpnI-PvuII as described elsewhere (Eyckerman et al., 2001
). Both parts were ligated in the pMet7 vector digested with EcoRI-PvuII. To create the pMET7-Etag-CIS construct, CIS was amplified from the pMET7-FLAG-CIS using primers 5'-CGTCCGCGGCCGCGGTCCTCTGCGTACAGGGATC-3' and 5'-GCTGGCTCGAGTCAGAGTTGGAAGGGGTACTGTC-3' and was ligated in the NotI-XhoI digested pCAGGSE-mMyD88 construct, which was a gift from Rudy Beyaert (Ghent University, Ghent, Belgium). Etag-CIS was then digested with EcoRI-XhoI and ligated in the pMET7 vector.
pMET7-FLAG-SOCS2 was created by cutting SOCS2 from the pMG2-SOCS2 construct using EcoRI-XbaI and ligating it into the EcoRI-XbaI digested pMET7-FLAG-SOCS3 expression vector which was described elsewhere (Eyckerman et al., 2000
). SOCS2
box was amplified using primers 5'-TGCCTTTACTTCTAGGCCTG-3' and 5'-GCAGGTCTAGATTATGATGTATACAGAGGTTTG-3' from the templates pMET7-FLAG-SOCS2 cloned in the NotI-XbaI opened pMET7-FLAG-SOCS2 to create pMET7-FLAG-SOCS2
box. The pMET7-FLAG-SOCS2(LC-QQ) mutant was created by site-directed mutagenesis of the pMET7-FLAG-SOCS2 construct using primers 5'-GTATACATCAGCACCCACTCAGCAGCATTTCCAACGACTCGCCATTAAC-3' and 5'-GTTAATGGCGAGTCGTTGGAAATGCTGCTGAGTGGGTGCTGATGTATAC-3'.
Generation of the chimeric receptors containing the extracellular part of the EpoR and the transmembrane and intracellular parts of the leptin receptor, such as EpoR-LR(F3), were described elsewhere (Eyckerman et al., 2001
). A full-length CIS bait construct was generated by digesting the pCEL(2L)-Y480 bait construct with SstI and NotI and swapping the EpoR Y402 motif with a PCR product containing full-length CIS and the cloning sites SstI and NotI (primers 5'-GCGCGAGCTCAATGGTCCTCTGCGTACAGGG-3' and 5'-GCTCGCGGCCGCTCAGAGTTGGAAGGGGTACTGTCGG-3'). The CIS SOCS box bait was made using the same strategy and the PCR amplification of the CIS SOCS box was done with primers 5' GCGAGAGCTCCGGATCCGCCCGCAGCTTACAACATC and 5' CGCTGCGGCCGCTTAGAGTTGGAAGGGGTACTG. The SOCS2 (LC-QQ) prey was generated by mutating L163 and C167 of the Wild Type SOCS2 prey using primers 5'-GTATACATCAGCACCCACTCAGCAGCATTTCCAACGACTCGCCATTAAC-3' and 5'-GTTAATGGCGAGTCGTTGGAAATGCTGCTGAGTGGGTGCTGATGTATAC-3'. pMG2-STAT5aSH2 was created by amplifying the SH2 domain of STAT5a using primers 5'-GCGAGAATTCTCCGGACCCCACTGGAATGATGGGGC-3' and 5'-CGCTTCTAGATTAACTCGAGGAGAAGACCTCATCCTTGG-3' and EcoRI-XbaI cloning in the pMG2 vector.
To generate the pMET7TAP2 construct we used the primers 5'-GCGAGGGCCCGCCACCATGGCCCAGCACGACGAGATCTC-3' and 5'-CGCTCTCGAGGCCCTGGAAGTACAGGTTCTCGCTGGCGGTGGTGGGGATGTCGCTGTTGGCGTCCACGCTG-3' to amplify the proteinA domain from the pMA-SpaI construct obtained from the BCCM/LMBP plasmid collection and to add a TEV cleavage site and we cloned the PCR product in the pMET7 vector using ApaI-XhoI. The FLAGtag was introduced using primers 5'-GCGAGGGCCCGCCACCATGGCCCAGCACGACGAGATCTC-3' and 5'-GCGAGAATTCCCCGCTGCCCTTGTCATCGTCGTCCTTGTAGTCCTGGCGCGCGCCCTGGAAGTACAGGTTC-3' and cloned in the same vector using ApaI-EcoRI.
pMET7TAP2-SOCS2 was constructed by cutting SOCS2 from the pMG2-SOCS2 construct using EcoRI-NotI and ligating it in the pMET7TAP2 construct.
This construct was then used to create the pMET7TAP2-SOCS2(LC-QQ) by site-directed mutagenesis using the primers 5'-GTATACATCAGCACCCACTCAGCAGCATTTCCAACGACTCGCCATTAAC-3' and 5'-GTTAATGGCGAGTCGTTGGAAATGCTGCTGAGTGGGTGCTGATGTATAC-3'. All constructs were verified by DNA sequence analysis.
Cell culture, transfection and reporter assays
Culture conditions, transfection procedures and luciferase assays for HEK293T cells were as previously described (Eyckerman et al., 2000
). For a typical luciferase experiment, HEK293T cells were seeded in six-well plates 24 hours before overnight transfection with the desired constructs together with the luciferase reporter gene. Two days after transfection cells were left untreated (not stimulated NS) or were stimulated with 100 ng/ml leptin overnight. The luciferase activity of the transfected cells were measured by chemiluminescence. The factor-dependent TF-1 erythroleukaemia cell line was grown in RPMI medium supplemented with 10% foetal calf serum and 1 ng/ml GM-CSF. After electroporation (300 V, 1500 µF), cells were starved (removal of GM-CSF) for 24 hours and were subsequently stimulated with 5 ng/ml hEpo overnight. After 24 hours, luciferase activity was measured as described before.
Leptin binding assay
LR expression on the surface of HEK293T cells was measured using a binding assay with a mouse leptin-secreted alkaline phosphatase (SEAP) chimeric protein (Tartaglia et al., 1995
). 48 hours after transfection, cells were incubated for 2 hours with a 1:50 dilution of conditioned Cos1 medium containing the chimeric protein with or without an excess of leptin. After two washing steps, cells were lysed in a buffer (1% Triton X-100, 20 mM Tris-HCl pH 7.4) and alkaline phosphatase activity was measured by chemiluminescence, using CSPD substrate (PhosphaLight, Tropix) according to the protocol provided by the manufacturer.
FACS analysis
The expression of the chimeric hEpoR-mLR GGS baits was monitored using goat anti-human EpoR polyclonal IgG (R&D Systems) at 2 µg/ml and Alexa Fluor 488-conjugated donkey anti-goat IgG (Molecular Probes) at 4 µg/ml. Fluorescence-activated cell sorting (FACS) was performed on a FACSCalibur (Becton Dickinson).
Western blot analysis
Expression of the gp130-fusion proteins, CIS and SOCS2, all flag-tagged, were verified by western blot analysis. Transfected HEK293T or TF-1 cells were lysed in RIPA buffer: 200 mM NaCl, 50 mM Tris-HCl pH 8, 0.05% SDS, 2 mM EDTA, 1% NP40, 0.5% DOC, CompleteTM Protease Inhibitor Cocktail (Roche). 4x loading buffer (125 mM Tris-HCl pH 6.8, 6% SDS, 20% glycerol, 0.02% BFB, 10% ß-mercaptoethanol) was added to the lysates which were then loaded on a 10% polyacrylamide gel and blotted overnight. Blotting efficiency was checked using PonceauS staining (Sigma). Flag-tagged proteins were revealed using monoclonal anti-Flag antibody M2 (Sigma) and anti-mouse-HRP (horseradish peroxidase) (Amersham Biosciences).
(Phospho)peptide affinity chromatography
Approximately 35x106 HEK293T cells were transfected with either pEF-FLAG-1/mSOCS2 or pEF-FLAG-1/mCIS and were lysed in lysis buffer (20 mM HEPES pH 7, 1 mM MgCl2, 10 mM KCl, 0.5 mM DTT, 150 mM NaCl, 0.5% NP40, 20% glycerol, 1 mM NaVO4, CompleteTM Protease Inhibitor Cocktail). The lysates were centrifuged for 5 minutes at 10,000 g and loaded on a pre-column with Sepharose 4B beads and streptavidin-agarose to prevent nonspecific interactions. Pre-cleared lysates were then incubated for 2 hours at 4°C with the (phospho)-tyrosine peptides as indicated coupled to streptavidin-agarose beads through their biotin group. The beads were then washed twice with lysis buffer and resuspended in 2x loading buffer (62.5 mM Tris-HCl pH 6.8, 3% SDS, 10% glycerol, 0.01% BFB, 5% ß-mercaptoethanol). Specific protein binding was revealed by SDS-PAGE and immunoblotting using the anti-flag antibody and anti-mouse-HRP. The sequences of the used peptides were biotin-QRQPSVK(P)Y985ATLVSNDK and biotin-NHREKSVC(P)Y1077LGVTSVNR. Synthesis and purification of the biotinylated (phospho)tyrosine peptides and coupling to streptavidin-agarose beads was described before (Eyckerman et al., 2000
).
Co-immunoprecipitation
Approximately 2x106 HEK293T cells were transfected with pMet7-Flag-SOCS2 and pMet7-Etag-CIS. Cleared lysates (modified RIPA lysis buffer) were incubated with 4 µg/ml anti-FLAG mouse monoclonal antibody (Sigma) and protein-G-Sepharose (Amersham Biosciences). After immunoprecipitation, SDS-PAGE and western blotting, interactions were detected using anti-E-Tag antibody (Amersham Biosciences).
TAP2 purification and mass spectrometry
HEK293T cells were transfected with the appropriate constructs and lysed in cell lysis buffer (50 mM Tris-HCl pH 8, 10% glycerol, 1% NP40, 150 mM NaCl, 5 mM NaF, 5 µM ZnCl2, 1 mM Na3VO4, 10 mM EGTA, CompleteTM Protease Inhibitor Cocktail). The insoluble fraction was centrifuged and the supernatant was incubated with IgG Sepharose (Amersham Biosciences) overnight. The beads were washed three times with washing buffer (20 mM Tris-HCl pH 7.5, 5% glycerol, 0.1% NP40, 150 mM NaCl) and twice with TEV (Tobacco Etch Virus) protease cleavage buffer 1 (10 mM Tris-HCl pH 8, 150 mM NaCl, 0.1% NP40, 0.5 mM EDTA) and were then incubated with TEV protease in TEV protease cleavage buffer 1 for 2 to 4 hours. The beads were then centrifuged and the supernatant was incubated with anti-FLAG agarose (Sigma) in TEV protease cleavage buffer 2 (10 mM Tris-HCl pH 8, 150 mM NaCl, 0.1% NP40) for 2 to 4 hours. The anti-FLAG agarose beads were washed three times with washing buffer and incubated with FLAG peptide for 10 minutes. The beads were spun down and 4x loading buffer was added to the supernatants before loading on a polyacrylamide gel. Proteins were either visualised by silver staining, or for mass spectrometry analysis with Sypro Ruby protein gel stain according to the manufacturer's instructions (Molecular Probes). Proteins of interest were excised and in-gel digested with trypsin as described. The resulting peptide mixture was dried, re-dissolved in 20 µl of 0.1% formic acid in 2/98 (v/v) acetonitrile/water and half of it was applied for nano-LC-MS/MS analysis on an Ultimate (Dionex, Amsterdam, The Netherlands) in-line connected to an Esquire HCT ion trap (Bruker Daltonics, Bremen, Germany). The sample was first trapped on a trapping column (PepMapTM C18 column, 0.3 mm ID x5 mm, Dionex) and after back-flushing, the sample was loaded on a 75 µm ID x150 mm reverse-phase column (PepMapTM C18, Dionex). The peptides were eluted with a linear solvent gradient over 50 minutes of 0.1% formic acid in acetonitrile/water (7/3, v/v). Using data-dependent acquisition, only multiple charged ions with intensities above threshold 100,000 were selected for fragmentation. For MS/MS analysis, an MS/MS fragmentation amplitude of 0.7 V and a scan time of 40 milliseconds was used. The fragmentation spectra were converted to Mascot generic files (mgf) using the Automation Engine software (version 3.2, Bruker) and searched using the MASCOT database search engine (http://www.matrixscience.com) against the SwissProt and the NCBInr Database (taxonomy mammalia). Only spectra that exceeded Mascot's threshold score for identify (set at the 95% confidence level) were retained for further manual validation.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Adams, T. E., Hansen, J. A., Starr, R., Nicola, N. A., Hilton, D. J. and Billestrup, N. (1998). Growth hormone preferentially induces the rapid, transient expression of SOCS-3, a novel inhibitor of cytokine receptor signaling. J. Biol. Chem. 273, 1285-1287.
Banks, A. S., Davis, S. M., Bates, S. H. and Myers, M. G., Jr (2000). Activation of downstream signals by the long form of the leptin receptor. J. Biol. Chem. 275, 14563-14572.
Bates, S. H., Stearns, W. H., Dundon, T. A., Schubert, M., Tso, A. W., Wang, Y., Banks, A. S., Lavery, H. J., Haq, A. K., Maratos-Flier, E. et al. (2003). STAT3 signalling is required for leptin regulation of energy balance but not reproduction. Nature 421, 856-859.[CrossRef][Medline]
Baumann, H., Morella, K. K., White, D. W., Dembski, M., Bailon, P. S., Kim, H., Lai, C. F. and Tartaglia, L. A. (1996). The full-length leptin receptor has signaling capabilities of interleukin 6-type cytokine receptors. Proc. Natl. Acad. Sci. USA 93, 8374-8378.
Bjorbaek, C., Elmquist, J. K., Frantz, J. D., Shoelson, S. E. and Flier, J. S. (1998a). Identification of SOCS-3 as a potential mediator of central leptin resistance. Mol. Cell 1, 619-625.[CrossRef][Medline]
Bjorbaek, C., Elmquist, J. K., Michl, P., Ahima, R. S., van Bueren, A., Mccall, A. L. and Flier, J. S. (1998b). Expression of leptin receptor isoforms in rat brain microvessels. Endocrinology 139, 3485-3491.
Bjorbaek, C., El Haschimi, K., Frantz, J. D. and Flier, J. S. (1999). The role of SOCS-3 in leptin signaling and leptin resistance. J. Biol. Chem. 274, 30059-30065.
Bjorbaek, C., Lavery, H. J., Bates, S. H., Olson, R. K., Davis, S. M., Flier, J. S. and Myers, M. G., Jr (2000). SOCS3 mediates feedback inhibition of the leptin receptor via Tyr985. J. Biol. Chem. 275, 40649-40657.
Bjorbaek, C., Buchholz, R. M., Davis, S. M., Bates, S. H., Pierroz, D. D., Gu, H., Neel, B. G., Myers, M. G., Jr and Flier, J. S. (2001). Divergent roles of SHP-2 in ERK activation by leptin receptors. J. Biol. Chem. 276, 4747-4755.
Boado, R. J., Golden, P. L., Levin, N. and Pardridge, W. M. (1998). Up-regulation of blood-brain barrier short-form leptin receptor gene products in rats fed a high fat diet. J. Neurochem. 71, 1761-1764.[Medline]
Clement, K., Vaisse, C., Lahlou, N., Cabrol, S., Pelloux, V., Cassuto, D., Gourmelen, M., Dina, C., Chambaz, J., Lacorte, J. M. et al. (1998). A mutation in the human leptin receptor gene causes obesity and pituitary dysfunction. Nature 392, 398-401.[CrossRef][Medline]
Cohen, B., Novick, D. and Rubinstein, M. (1996). Modulation of insulin activities by leptin. Science 274, 1185-1188.
Duan, C., Li, M. and Rui, L. (2004). SH2-B promotes insulin receptor substrate 1 (IRS1)- and IRS2-mediated activation of the phosphatidylinositol 3-kinase pathway in response to leptin. J. Biol. Chem. 279, 43684-43691.
Dunn, S. L., Bjornholm, M., Bates, S. H., Chen, Z. B., Seifert, M. and Myers, M. G. (2005). Feedback inhibition of leptin receptor/Jak2 signaling via Tyr(1138) of the leptin receptor and suppressor of cytokine signaling 3. Mol. Endocrinol. 19, 925-938.
El-Haschimi, K., Pierroz, D. D., Hileman, S. M., Bjorbaek, C. and Flier, J. S. (2000). Two defects contribute to hypothalamic leptin resistance in mice with diet-induced obesity. J. Clin. Invest. 105, 1827-1832.[Medline]
Eyckerman, S., Waelput, W., Verhee, A., Broekaert, D., Vandekerckhove, J. and Tavernier, J. (1999). Analysis of Tyr to Phe and fa/fa leptin receptor mutations in the PC12 cell line. Eur. Cytokine Netw. 10, 549-556.[Medline]
Eyckerman, S., Broekaert, D., Verhee, A., Vandekerckhove, J. and Tavernier, J. (2000). Identification of the Y985 and Y1077 motifs as SOCS3 recruitment sites in the murine leptin receptor. FEBS Lett. 486, 33-37.[CrossRef][Medline]
Eyckerman, S., Verhee, A., der Heyden, J. V., Lemmens, I., Ostade, X. V., Vandekerckhove, J. and Tavernier, J. (2001). Design and application of a cytokine-receptor-based interaction trap. Nat. Cell Biol. 3, 1114-1119.[CrossRef][Medline]
Eyckerman, S., Lemmens, I., Cateeuw, D., Verhee, A., Vandekerckhove, J., Lievens, S. and Tavernier, J. (2005). Reverse MAPPIT: screening for protein-protein interaction modifiers in mammalian cells. Nat. Methods 2, 427-433.[CrossRef][Medline]
Favre, H., Benhamou, A., Finidori, J., Kelly, P. A. and Edery, M. (1999). Dual effects of suppressor of cytokine signaling (SOCS-2) on growth hormone signal transduction. FEBS Lett. 453, 63-66.[CrossRef][Medline]
Ghilardi, N., Ziegler, S., Wiestner, A., Stoffel, R., Heim, M. H. and Skoda, R. C. (1996). Defective STAT signaling by the leptin receptor in diabetic mice. Proc. Natl. Acad. Sci. USA 93, 6231-6235.
Greenhalgh, C. J., Bertolino, P., Asa, S. L., Metcalf, D., Corbin, J. E., Adams, T. E., Davey, H. W., Nicola, N. A., Hilton, D. J. and Alexander, W. S. (2002a). Growth enhancement in suppressor of cytokine signaling 2 (SOCS-2)-deficient mice is dependent on signal transducer and activator of transcription 5b (STAT5b). Mol. Endocrinol. 16, 1394-1406.
Greenhalgh, C. J., Metcalf, D., Thaus, A. L., Corbin, J. E., Uren, R., Morgan, P. O., Fabri, L. J., Zhang, J. G., Martin, H. M., Willson, T. A. et al. (2002b). Biological evidence that SOCS-2 can act either as an enhancer or suppressor of growth hormone signaling. J. Biol. Chem. 277, 40181-40184.
Greenhalgh, C. J., Rico-Bautista, E., Lorentzon, M., Thaus, A. L., Morgan, P. O., Willson, T. A., Zervoudakis, P., Metcalf, D., Street, I., Nicola, N. A. et al. (2005). SOCS2 negatively regulates growth hormone action in vitro and in vivo. J. Clin. Invest. 115, 397-406.[CrossRef][Medline]
Hekerman, P., Zeidler, J., Bamberg-Lemper, S., Knobelspies, H., Lavens, D., Tavernier, J., Joost, H. G. and Becker, W. (2005). Pleiotropy of leptin receptor signalling is defined by distinct roles of the intracellular tyrosines. FEBS J. 272, 109-119.[CrossRef][Medline]
Howard, J. K., Cave, B. J., Oksanen, L. J., Tzameli, I., Bjorbaek, C. and Flier, J. S. (2004). Enhanced leptin sensitivity and attenuation of diet-induced obesity in mice with haploinsufficiency of Socs3. Nat. Med. 10, 734-738.[CrossRef][Medline]
Kamura, T., Sato, S., Haque, D., Liu, L., Kaelin, W. G., Jr, Conaway, R. C. and Conaway, J. W. (1998). The Elongin BC complex interacts with the conserved SOCS-box motif present in members of the SOCS, ras, WD-40 repeat, and ankyrin repeat families. Genes Dev. 12, 3872-3881.
Kaszubska, W., Falls, H. D., Schaefer, V. G., Haasch, D., Frost, L., Hessler, P., Kroeger, P. E., White, D. W., Jirousek, M. R. and Trevillyan, J. M. (2002). Protein tyrosine phosphatase 1B negatively regulates leptin signaling in a hypothalamic cell line. Mol. Cell Endocrinol. 195, 109-118.[CrossRef][Medline]
Kile, B. T., Schulman, B. A., Alexander, W. S., Nicola, N. A., Martin, H. M. and Hilton, D. J. (2002). The SOCS box: a tale of destruction and degradation. Trends Biochem. Sci. 27, 235-241.[CrossRef][Medline]
Kim, Y. B., Uotani, S., Pierroz, D. D., Flier, J. S. and Kahn, B. B. (2000). In vivo administration of leptin activates signal transduction directly in insulin-sensitive tissues: overlapping but distinct pathways from insulin. Endocrinology 141, 2328-2339.
Kubo, M., Hanada, T. and Yoshimura, A. (2003). Suppressors of cytokine signaling and immunity. Nat. Immunol. 4, 1169-1176.[CrossRef][Medline]
Li, C. and Friedman, J. M. (1999). Leptin receptor activation of SH2 domain containing protein tyrosine phosphatase 2 modulates Ob receptor signal transduction. Proc. Natl. Acad. Sci. USA 96, 9677-9682.
Lord, G. M., Matarese, G., Howard, L. K., Baker, R. J., Bloom, S. R. and Lechler, R. I. (1998). Leptin modulates the T-cell immune response and reverses starvation-induced immunosuppression. Nature 394, 897-901.[CrossRef][Medline]
Matsumoto, A., Seki, Y., Kubo, M., Ohtsuka, S., Suzuki, A., Hayashi, I., Tsuji, K., Nakahata, T., Okabe, M., Yamada, S. et al. (1999). Suppression of STAT5 functions in liver, mammary glands, and T cells in cytokine-inducible SH2-containing protein 1 transgenic mice. Mol. Cell. Biol. 19, 6396-6407.
Metcalf, D., Greenhalgh, C. J., Viney, E., Willson, T. A., Starr, R., Nicola, N. A., Hilton, D. J. and Alexander, W. S. (2000). Gigantism in mice lacking suppressor of cytokine signalling-2. Nature 405, 1069-1073.[CrossRef][Medline]
Minokoshi, Y., Alquier, T., Furukawa, N., Kim, Y. B., Lee, A., Xue, B., Mu, J., Foufelle, F., Ferre, P., Birnbaum, M. J. et al. (2004). AMP-kinase regulates food intake by responding to hormonal and nutrient signals in the hypothalamus. Nature 428, 569-574.[CrossRef][Medline]
Montoye, T., Lemmens, I., Catteeuw, D., Eyckerman, S. and Tavernier, J. (2005). A systematic scan of interactions with tyrosine motifs in the erythropoietin receptor using a mammalian 2-hybrid approach. Blood 105, 4264-4271.
Mori, H., Hanada, R., Hanada, T., Aki, D., Mashima, R., Nishinakamura, H., Torisu, T., Chien, K. R., Yasukawa, H. and Yoshimura, A. (2004). Socs3 deficiency in the brain elevates leptin sensitivity and confers resistance to diet-induced obesity. Nat. Med. 10, 739-743.[CrossRef][Medline]
Niswender, K. D., Morton, G. J., Stearns, W. H., Rhodes, C. J., Myers, M. G., Jr and Schwartz, M. W. (2001). Intracellular signalling. Key enzyme in leptin-induced anorexia. Nature 413, 794-795.[Medline]
Pezet, A., Favre, H., Kelly, P. A. and Edery, M. (1999). Inhibition and restoration of prolactin signal transduction by suppressors of cytokine signaling. J. Biol. Chem. 274, 24497-24502.
Puig, O., Caspary, F., Rigaut, G., Rutz, B., Bouveret, E., Bragado-Nilsson, E., Wilm, M. and Seraphin, B. (2001). The tandem affinity purification (TAP) method: a general procedure of protein complex purification. Methods 24, 218-229.[CrossRef][Medline]
Ram, P. A. and Waxman, D. J. (1999). SOCS/CIS protein inhibition of growth hormone-stimulated STAT5 signaling by multiple mechanisms. J. Biol. Chem. 274, 35553-35561.
Ren, D., Li, M., Duan, C. and Rui, L. (2005). Identification of SH2-B as a key regulator of leptin sensitivity, energy balance, and body weight in mice. Cell Metab. 2, 95-104.[CrossRef][Medline]
Starr, R., Willson, T. A., Viney, E. M., Murray, L. J., Rayner, J. R., Jenkins, B. J., Gonda, T. J., Alexander, W. S., Metcalf, D., Nicola, N. A. et al. (1997). A family of cytokine-inducible inhibitors of signalling. Nature 387, 917-921.[CrossRef][Medline]
Tannahill, G. M., Elliott, J., Barry, A. C., Hibbert, L., Cacalano, N. A. and Johnston, J. A. (2005). SOCS2 can enhance interleukin-2 (IL-2) and IL-3 signaling by accelerating SOCS3 degradation. Mol. Cell. Biol. 25, 9115-9126.
Tartaglia, L. A., Dembski, M., Weng, X., Deng, N., Culpepper, J., Devos, R., Richards, G. J., Campfield, L. A., Clark, F. T., Deeds, J. et al. (1995). Identification and expression cloning of a leptin receptor, OB-R. Cell 83, 1263-1271.[CrossRef][Medline]
Vaisse, C., Halaas, J. L., Horvath, C. M., Darnell, J. E., Jr, Stoffel, M. and Friedman, J. M. (1996). Leptin activation of Stat3 in the hypothalamus of wild-type and ob/ob mice but not db/db mice. Nat. Genet. 14, 95-97.[CrossRef][Medline]
Zabeau, L., Lavens, D., Peelman, F., Eyckerman, S., Vandekerckhove, J. and Tavernier, J. (2003). The ins and outs of leptin receptor activation. FEBS Lett. 546, 45-50.[CrossRef][Medline]
Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L. and Friedman, J. M. (1994). Positional cloning of the mouse obese gene and its human homologue. Nature 372, 425-432.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
J. Wauman, A.-S. De Smet, D. Catteeuw, D. Belsham, and J. Tavernier Insulin Receptor Substrate 4 Couples the Leptin Receptor to Multiple Signaling Pathways Mol. Endocrinol., April 1, 2008; 22(4): 965 - 977. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-G. Li, G.-L. Ding, X.-J. Chen, X.-P. Lu, L.-J. Dong, M.-Y. Dong, X.-F. Yang, X.-E Lu, and H.-F. Huang Association of Serum and Follicular Fluid Leptin Concentrations with Granulosa Cell Phosphorylated Signal Transducer and Activator of Transcription 3 Expression in Fertile Patients with Polycystic Ovarian Syndrome J. Clin. Endocrinol. Metab., December 1, 2007; 92(12): 4771 - 4776. [Abstract] [Full Text] [PDF] |
||||
![]() |