|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 30 May 2006
doi: 10.1242/jcs.02985
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
1 Children's Cancer Centre, Royal Children's Hospital, Parkville 3052, Australia
2 Murdoch Children's Research Institute, Royal Children's Hospital, Parkville 3052, Australia
3 Department of Paediatrics, University of Melbourne, Parkville 3010, Australia
4 Walter and Eliza Hall Institute, Royal Melbourne Hospital, Parkville 3050, Australia
5 Department of Biochemistry and Molecular Biology, University of Melbourne, Parkville 3010, Australia
6 Department of Biochemistry, La Trobe University, Bundoora 3086, Australia
7 Department of Neonatology, Royal Children's Hospital, Parkville 3052, Australia
* Author for correspondence (e-mail: c.hawkins{at}latrobe.edu.au)
Accepted 21 March 2006
| Summary |
|---|
|
|
|---|
Key words: Apoptosis, Caspase, Ced-9, Programmed Cell Death, Saccharomyces Cerevisiae
| Introduction |
|---|
|
|
|---|
Analyses of cell death in the nematode worm Caenorhabditis elegans have highlighted the evolutionary conservation of cell death pathway components and have provided valuable clues into the more complex mammalian apoptosis machinery. In addition to their comparative genetic simplicity (Aravind et al., 2001
), nematodes offer considerable advantages in the study of apoptosis because developmental cell death is programmed. Indeed, of the 1090 somatic cells generated during C. elegans development, 131 cells are fated to die (Sulston et al., 1983
).
An essential component of the nematode cell death machinery is a cysteine aspartyl protease (caspase) designated CED-3 (Yuan et al., 1993
). Oligomerisation of an adaptor molecule, CED-4, promotes the proteolytic activation of CED-3 (Chinnaiyan et al., 1997a
; Chinnaiyan et al., 1997b
; Irmler et al., 1997
; Seshagiri and Miller, 1997
; Wu et al., 1997a
; Yang et al., 1998
). The tail-anchored membrane protein CED-9 inhibits cell death by directly interacting with CED-4 (Chinnaiyan et al., 1997b
; Spector et al., 1997
; Wu et al., 1997a
; Wu et al., 1997b
; Yan et al., 2005
) and is required for the survival of the majority of nematode cells during development (Hengartner et al., 1992
). Transcriptionally controlled expression of EGL-1 is necessary for death of the 131 cells developmentally destined to die (Conradt and Horvitz, 1999
). EGL-1 exerts its pro-apoptotic activity by binding to CED-9, thus releasing CED-4 to activate CED-3 (Conradt and Horvitz, 1998
; del Peso et al., 1998
; Fairlie et al., 2006
; Kim et al., 2004
; Yan et al., 2005
; Yan et al., 2004
).
Counterparts of these C. elegans proteins exist in mammalian cells. Relatives of CED-3 comprise the human caspase family (reviewed by Salvesen, 2002
). Apaf-1 is the only known mammalian equivalent of CED-4. In conjunction with cytosolic cytochrome c and dATP, Apaf-1 can activate caspase-9. This in turn triggers caspase-3 activation and cell death (reviewed by Ferraro et al., 2003
). CED-9 has a similar structure to Bcl-2, bearing all four so-called Bcl-2 homology (BH) domains (BH1-BH4) and a C-terminal membrane anchor (Hengartner and Horvitz, 1994
). EGL-1 only has a BH3 domain, like the mammalian `BH3-only' pro-apoptotic family members Bim, Bad, Noxa and Puma (reviewed by Marsden and Strasser, 2003
). EGL-1 antagonises CED-9 in the same manner as the mammalian BH3-only proteins antagonise pro-survival Bcl-2 family members (Chittenden et al., 1995
; Letai et al., 2002
; Wang et al., 1996
).
The conservation of cell death pathways was highlighted by the ability of the mammalian CED-9 homologue Bcl-2 to inhibit PCD during nematode development (Hengartner and Horvitz, 1994
; Vaux et al., 1992
). This indicated that Bcl-2 could functionally interact with at least one C. elegans apoptosis pathway component. Given the similarity between Bcl-2 and CED-9, CED-4 seemed to be the most likely target for inhibition by Bcl-2. Consistent with this theory, Bcl-2 could also suppress the excessive cell death in worms homozygous for a ced-9 loss-of-function mutation (Hengartner and Horvitz, 1994
). This supported the notion that Bcl-2 interacted with the nematode apoptosis machinery downstream of CED-9, and probably with CED-4. However, as those experiments were performed at an early developmental stage, maternal CED-9 may have persisted (Hengartner et al., 1992
), so the possibility of Bcl-2 acting at or upstream of CED-9 could not be excluded.
In this study, we explored potential nematode targets of Bcl-2 inhibition, using a yeast-based functional system, two-hybrid assays, and by direct protein binding in vitro. Our findings indicate that, unlike CED-9, Bcl-2 cannot interact with CED-4, inhibit its activity, or affect its localisation in yeast. However, Bcl-2 was able to bind to the BH3-only protein EGL-1 and alter its localisation in yeast, raising the possibility that this interaction might account for the ability of Bcl-2 to inhibit PCD in C. elegans.
| Results |
|---|
|
|
|---|
|
Expression of CED-9 inhibited yeast death caused by CED-3 and CED-4 co-expression (lane 7). With the aim of reconstituting the entire nematode core apoptotic pathway, we next tested the effect of EGL-1 expression in yeast expressing CED-3, CED-4 and CED-9. EGL-1 was able to antagonise the protective activity of CED-9, leading to yeast death (lane 8). This effect was specific, as EGL-1 expression did not affect yeast survival when expressed alone or in combination with CED-3, CED-4, CED-9, CED-3 plus CED-9, or CED-4 plus CED-9 (lanes 9-14). To allow visualisation of CED-4 within the yeast, it was C-terminally tagged with GFP. CED-9 and EGL-1 were N-terminally FLAG-tagged and myc-tagged, respectively. Neither CED-4, CED-9 nor EGL-1 activity was altered by the addition of the tags (Fig. 1B).
Bcl-2 inhibits Bax-dependent but not CED-4-dependent yeast toxicity
We used this reconstituted core nematode apoptosis pathway to test directly whether Bcl-2 could functionally substitute for CED-9. CED-9 was able to inhibit CED-4-dependent yeast killing when its expression was directed by the constitutively active ADH promoter (Fig. 2A, compare lanes 2 and 3). A C-terminal truncation mutant (CED-91-251) was also protective (lane 4). Conversely, Bcl-2 was unable to inhibit this CED-4-dependent lethality when expressed under the control of either the ADH promoter (lane 5) or the stronger GAL1/10 (GALL) promoter (lane 6). Fusion of the N-terminus of CED-9 to Bcl-2 (CED-91-80-Bcl-2) had been previously demonstrated to confer increased protection against nematode developmental cell death, compared with wild-type Bcl-2 (Xue and Horvitz, 1997
). However, the addition of this N-terminal portion of CED-9 to Bcl-2 did not enable it to inhibit CED-4-dependent yeast killing (lane 7).
|
To test whether Bcl-2 was capable of inhibiting lower levels of CED-4, CED-4 expression was reduced using a methionine-repressible promoter (Fig. 2B). The addition of methionine decreased the degree of CED-4-dependent lethality; however, even in this context, high levels of Bcl-2 (expressed using the GAL1/10 promoter) failed to relieve CED-4-dependent yeast toxicity (Fig. 2B, lane 5).
Bcl-2 fails to interact with CED-4 directly
The data presented above suggested that Bcl-2 does not directly inhibit CED-4, contrary to a model in which Bcl-2 functions analogously to CED-9. To determine whether this lack of inhibitory capability reflected an inability of Bcl-2 to interact with CED-4, a yeast two-hybrid method was employed. Yeast co-expressing CED-4 and CED-9 (as fusions to Gal4 domains) were able to grow on plates lacking histidine, indicating interaction between these two proteins (Fig. 2C, lane 5). By contrast, growth of yeast co-expressing CED-4 and Bcl-2 (fused to Gal4 domains) was histidine dependent, demonstrating that these proteins failed to interact (lane 6).
CED-9 relocalises CED-4 in yeast cells, but Bcl-2 does not
Previous work has shown that CED-9 alters the subcellular localisation of CED-4 in nematode cells (Chen et al., 2000
). We investigated whether CED-9 could affect CED-4 localisation in our yeast system and, if so, whether Bcl-2 could act similarly. We expressed these proteins in yeast as GFP fusion proteins. Confocal microscopy was then used to determine their localisation relative to the endoplasmic reticulum protein Kar2p (Rose et al., 1989
), MitoTracker (which stains mitochondria) and 4'-6-diamidino-2-phenylindole (DAPI; which stains DNA). Fusion to GFP did not affect the abilities of CED-9 and Bcl-2 to inhibit CED-4-dependent or Bax-dependent yeast death, respectively (data not shown).
When expressed without other nematode proteins, CED-4-GFP was detected in the perinuclear region of S. cerevisiae cells (Fig. 3), similar to its localisation in nematode and insect cells (Chen et al., 2000
; Seiffert et al., 2002
), but contrasting with its cytosolic localisation in mammalian cells (Wu et al., 1997b
). GFP-CED-9 fluorescence was detected in yeast transformants both in the perinuclear area (co-localising with Kar2p) and around the cortex of the cell (co-localising with MitoTracker and Kar2p). In approximately half of the cells, some perivacuolar localisation was also observed (Fig. 3). A similar distribution was seen in yeast co-expressing CED-4 (Fig. S1, supplementary material). A previous analysis of CED-9 distribution within nematode cells revealed colocalisation with MitoTracker (the endoplasmic reticulum was not visualised in the study) (Chen et al., 2000
). FLAG-CED-9 co-expression changed the distribution of CED-4-GFP in most yeast cells, targeting it to the perinuclear region and cell periphery (Fig. 3). GFP-Bcl-2 was detected throughout the endoplasmic reticulum of yeast transformants (Fig. 3), whether or not CED-4 was co-expressed (Fig. S1, supplementary material). Consistent with our data indicating that Bcl-2 could not bind to CED-4, co-expression of Bcl-2 did not alter CED-4-GFP localisation (Fig. 3).
|
|
|
To confirm this observation, in vitro translated [35S]methionine-labelled FLAG-Tab-1, [35S]methionine-labelled CED-9 or [35S]methionine-labelled Bcl-2 were incubated with bacterial lysates containing recombinant HIS-tagged p35, HIS-tagged EGL-1 or HIS-tagged CED-4. The protein complexes that formed were then isolated by binding to nickel-agarose beads. CED-9 bound to CED-4 (Fig. 5B, lane 8), but the FLAG-Tab-1 negative control did not (lane 5). Validating our results from the yeast systems, radiolabelled Bcl-2 did not interact with CED-4 (lane 11). Both CED-9 and Bcl-2 could bind EGL-1, but FLAG-Tab-1 could not (lanes 9, 12 and 6 respectively). Neither CED-9, Bcl-2 nor FLAG-Tab-1 interacted with the p35 negative control (lanes 4, 7 and 10).
We took advantage of the ability of Bcl-2 to suppress Bax-mediated yeast death, to monitor the capacity of Bcl-2 to interact functionally with EGL-1. Yeast co-expressing Bax and Bcl-2 were protected from Bax-mediated yeast death (Fig. 5C, lane 3). This protection could be antagonised by either the mammalian BH3-only protein Bim (lane 4) or the nematode protein EGL-1 (lane 5).
CED-9 and Bcl-2 relocalise EGL-1 in yeast cells
We expressed GFP-tagged EGL-1 in yeast and used confocal microscopy to investigate its subcellular localisation, either in isolation or when co-expressed with CED-9 or Bcl-2. The tag did not alter the ability of EGL-1 to antagonise CED-9 in yeast (data not shown). GFP-EGL-1 was detected at low levels in the cytoplasm and the nucleus when expressed alone in yeast (Fig. 6). Co-expression of either CED-9 or Bcl-2 yielded a stronger GFP-EGL-1 signal, which was concentrated in the perinuclear region and cell periphery (Fig. 6). These distributions resembled those of GFP-CED-9 and GFP-Bcl-2 (Fig. 3), suggesting that each protein can bind to, and relocalise, EGL-1.
|
| Discussion |
|---|
|
|
|---|
|
An alternative hypothesis is that Bcl-2 might block apoptosis of mammalian cells by inhibiting a CED-4-like protein (such as Apaf-1). This idea emerged from investigations of the effect of transgenic Bcl-2 expression on nematode cell death. Transgenic overexpression of Bcl-2 reduced cell death during development both in wild-type and ced-9 mutant worms (Hengartner and Horvitz, 1994
; Vaux et al., 1992
). The simplest explanation for these results is that Bcl-2 can functionally replace CED-9 to suppress cell death in worms, presumably by inhibiting CED-4 (Fig. 7B). Supporting this notion, subsequent studies indicated that a close relative of Bcl-2, Bcl-xL, was able to bind CED-4 (Chinnaiyan et al., 1997b
; Huang et al., 1998
), and that Bcl-2 and Bcl-xL could partially inhibit mammalian cell death induced by overexpression of CED-3 and CED-4 (Chinnaiyan et al., 1997b
; Huang et al., 1998
). Some experiments suggested that Bcl-xL might directly inhibit the mammalian counterpart of CED-4, Apaf-1 (Hu et al., 1998
; Inohara et al., 1998
; Pan et al., 1998
; Song et al., 1999
), however subsequent studies refuted this (Conus et al., 2000
; Hausmann et al., 2000
; Moriishi et al., 1999
).
Using yeast two-hybrid and pull-down experiments, we found that Bcl-2 was unable to bind CED-4. We also observed that, unlike CED-9, Bcl-2 could not inhibit CED-4-dependent yeast death nor influence the subcellular localisation of CED-4. Together, these results demonstrate that suppression of C. elegans developmental cell death by Bcl-2 could not be a result of its direct inhibition of CED-4. These data imply that the protection conferred by Bcl-2 against mammalian cell death stimulated by enforced expression of CED-3 and CED-4 (Chinnaiyan et al., 1997b
; Huang et al., 1998
) was most probably indirect. The mechanism by which co-expression of CED-3 and CED-4 induces apoptosis in mammalian tissue culture cells is not known, but this death could result from indirect triggering of the intrinsic (mitochondrial) pathway in response to the expression of the nematode proteins. As Bcl-2 effectively inhibits the intrinsic pathway, this might account for its ability to protect mammalian cells from death triggered by co-expression of CED-3 and CED-4.
A third model for the mechanism of action of Bcl-2 relates to its ability to regulate the activity of other family members through heterodimeric interactions. Bcl-2 can bind to a subset of BH3-only proteins with varying affinities (Chen et al., 2005
). Bcl-2 binds strongly to the BH3-only protein Bim (Chen et al., 2005
; Hsu et al., 1998
; O'Connor et al., 1998
), and this interaction was confirmed in our yeast system because Bim was able to antagonise Bcl-2-mediated Bax inhibition. Our data demonstrate that EGL-1 can bind Bcl-2, and Bcl-2 can alter the subcellular localisation of EGL-1 in yeast. These data lead us to speculate that Bcl-2 might suppress PCD in C. elegans by reversing the antagonism by EGL-1 of CED-9. Consistent with this notion, data have recently been published indicating that some mammalian anti-apoptotic Bcl-2 family members might promote survival by opposing the proapoptotic activity of mammalian BH3-only proteins (Kuwana et al., 2005
).
Our model would readily account for the ability of Bcl-2 to inhibit developmental cell death in wild-type worms (Hengartner and Horvitz, 1994
; Vaux et al., 1992
), as exogenous Bcl-2 would antagonise the EGL-1 protein expressed in the 131 cells normally destined to die, thus permitting their survival. Bcl-2 was also observed to suppress cell death in homozygous ced-9 loss-of-function worms (Hengartner and Horvitz, 1994
). If CED-9 were completely absent, CED-4 would be expected to be able to activate CED-3 whether EGL-1 was bound to Bcl-2 or not. However, it is important to note that, whereas the genotype of the worms was homozygous ced-9 loss-of-function, substantial maternally derived CED-9 might persist in neurons at the late L3 larval stage when the experiments were performed (Hengartner et al., 1992
). We therefore propose the following model to reconcile these apparently discordant data (Fig. 7C). At the late L3 stage, the ventral nerve cord cells might express low levels of EGL-1 that are insufficient to displace enough CED-9 from CED-4 to activate CED-3, therefore permitting the survival of the ventral nerve cord cells. However, in ced-9 loss-of-function worms bearing only maternally derived CED-9, total CED-9 levels would be lower. In this context, the putative small amounts of EGL-1 protein would be sufficient to release the maternally derived CED-9 from CED-4, which could then activate CED-3. In this model, overexpression of Bcl-2 would sequester EGL-1, thus allowing the maternal CED-9 to prevent CED-4 from activating CED-3, and protecting the cells from apoptosis.
Although EGL-1 is the best-studied nematode BH3-only protein, two others have also been reported: ceBNIP3 and CED-13. Unlike EGL-1, CED-13 deficiency had no impact on developmental cell death in C. elegans (Schumacher et al., 2004
). It therefore seems unlikely that CED-13 would account for the ability of Bcl-2 to suppress nematode developmental apoptosis, even if CED-13 could bind Bcl-2. To date, ceBNIP3 has only been studied in mammalian over-expression systems (Cizeau et al., 2000
; Yasuda et al., 1998
). Further studies will be needed to determine whether the predicted ceBNIP3 protein exists in C. elegans and, if so, whether it plays a role in PCD and might therefore represent another target of Bcl-2 inhibition.
In summary, our data demonstrate that Bcl-2 cannot bind or inhibit CED-4. This indicates that the pro-survival activity of Bcl-2 must occur through a distinct mechanism from that of CED-9. However, Bcl-2 can interact with the BH3-only protein EGL-1, suggesting a model in which sequestration of EGL-1 accounts for the ability of Bcl-2 to inhibit PCD in C. elegans. Although the yeast-based system described here permits extremely robust analyses of pathways comprising up to four exogenous components (CED-3, CED-4, CED-9, EGL-1), extension of this system to express five transgenes (CED-3, CED-4, CED-9, EGL-1, Bcl-2), yielded a dramatic increase in intra-class variability when independent transformants were assayed. Unfortunately, this irreproducibility associated with the five-component system prevented us from directly testing the hypothesis that Bcl-2 can prevent EGL-1-mediated antagonism of CED-9. Experiments with transgenic nematodes might be one approach to evaluate the validity of this model. We would predict that, if Bcl-2 acts in worms by preventing EGL-1 from antagonising CED-9, transgenic expression of Bcl-2 would offer no protection from PCD in nematodes bearing loss-of-function mutations in both CED-9 and EGL-1. If this model of Bcl-2 activity is verified and extends to the mammalian system, the ability of Bcl-2 to dimerise with proapoptotic BH3-only family members would be expected to contribute significantly to the pro-survival activity of Bcl-2.
| Materials and Methods |
|---|
|
|
|---|
was amplified by PCR using oligonucleotides 19 and 20, the PCR product was digested with BglII and XbaI and cloned into pGALS-(LEU2) cut with BamHI and XbaI to give pGALS-(LEU2)-Bax.
Bacterial expression constructs
pET23a-p35 has been previously reported (Jabbour et al., 2004
). EGL-1 was amplified using oligonucleotides 21 and 22. The PCR product was digested with NdeI and NotI and ligated into pET23a cut with NdeI and NotI to give pET23a-EGL-1. CED-4 was subcloned into pET23a by first linearising pADH-(HIS3)-CED-4-GFP with SpeI and pET23a with NdeI. The resulting SpeI and NdeI sites were blunted using T4 DNA polymerase (BioLabs) and dNTPs. Both products were then cut with NotI and CED-4 product was ligated into dephosphorylated pET23a to give pET23a-CED-4.
In vitro transcription/translation constructs
FLAG-tagged Tab-1 was amplified using primers 25 and 2, cut with BglII and XbaI and inserted into pBluescript II SK+ (Stratagene) to give pBS-FLAG-Tab-1. CED-9 was subcloned from pADH-(TRP1)-CED-9 into pBluescript II SK+ digested with EcoRI and NotI to give pBS-CED-9. The construction of pBS-Bcl-2 is described above.
Yeast two-hybrid constructs
An EcoRI-SalI fragment excised from pGALL-(HIS3)-CED-4, encoding the C-terminal portion of CED-4 was cloned into pGBT-9 cut with EcoRI and SalI, yielding pGBT9-CED-4-C. The N-terminal CED-4 EcoRI-EcoRI fragment from pGALL-(HIS3)-CED-4 was then inserted into pGBT9-CED-4-C to give pGBT9-CED-4. The coding region of EGL-1 was amplified from pADH-(URA3)-EGL-1 using primers 26 and 27. The product was cut with EcoRI and ligated into EcoRI-cut pGBT9. CED-9 was subcloned into pACT3-1 first by excising the CED-9 fragment from pGAD-CED-9 (a kind gift from D. Huang) with EcoRI and then ligating into EcoRI-digested pACT3-1 vector. Bcl-2 cut with EcoRI and SalI was ligated into pACT3-1 plasmid digested with EcoRI and XhoI.
Oligonucleotides
The following oligonucleotides were used: (1) CTGGATCCGGAAGATCAGTAATTGCATC; (2) CTTTATTATTTTTATTTTATTGAGAGGGTGG; (3) GTGGATCCATGCTCTGCGAAATCGAATG; (4) GAGCGGCCGCTTAACAGCATGCAAAATTTTTGAGGG; (5) GTGAATTCATGCTCTGCGAAATCGAATGC; (6) GGAATTCATGGGTAAAGGAGAAGAACTTTTC; (7) GGAATTCTTTGTATAGTTCATCCATGCCATG; (8) GGAATTCATGGCGCACGCTGGGAGAACAGG; (9) CAGCCGGGGTCTGCAGCGGCGAGG; (10) GCACACCTGGATCCAGGATAACGG; (11) GCTCTAGACTACTTGTGGCCCAGATAGGCAC; (12) GTTTCCTCGTCATTGTTCTCGTTCCC; (13) GCGAATTCATCAAGCCTTGGCTCTTCCCAATC; (14) GCGGATCCATGGAGCAGAAATTAATCAGCGAAGAGGACCTCATGTC; CAACGTTTTTGACGTTC; (15) GGGATCCATGGGTAAAGGAGAAGAACTTTTC; (16) GGGATCCTTTGTATAGTTCATCCATGCCATG; (17) GGAATTCGGATCCGCCATGGCCAAGCAACCTTCTG; (18) CCCTCGAGTCTAGACTAATGCCTTCTCCATACC; (19) GCAGATCTATGGACGGGTCCGGGGAGCAG; (20) GATCTAGACTAGCCCATCTTCTTCCAGATGGTG; (21) GGAATTCCATATGTCCAACGTTTTTGACGTTC; (22) ATAAGAATGCGGCCGCAAAAGCGAAAAAGTCCAGAAG; (23) GCGAGATCTCCGCCATGGACTACAAGGACGACGATGACAAGGGATCCATGGCGGCGCAGAGGAGGAGC; (24) GAGTCACTTTAAAATTTGTATACAC.
Yeast two-hybrid assay
Yeast (HF7c) were transformed with desired plasmids as described previously (Hawkins et al., 2000a
). In this strain, HIS3 expression is induced by a reconstituted Gal4 transcription factor. Genes cloned into pGBT9 are translated as fusion proteins to the Gal4 DNA binding domain. Genes cloned into pACT3-1 are translated as fusion proteins to the Gal4 activation domain. Protein interaction was detected on medium lacking histidine (and containing 2 mM 3-amino-triazole in Fig. 5A).
Yeast transformations and death assays
The Saccharomyces cerevisiae strain W303
was used to perform yeast death assays, as previously described (Hawkins et al., 2000a
).
Immunoblotting and SDS-PAGE staining
Yeast were prepared for immunoblotting as previously described (Hawkins et al., 2000a
). Lysates were also subjected to SDS-PAGE and stained with Coomassie Brilliant Blue (BioRad) to visualise protein loading. Antibodies used for immunoblotting in this study were anti-FLAG (clone M2; Sigma), anti-myc (clone 9B11; Cell Signaling), anti-GFP (Jabbour et al., 2004
), anti-Bcl-2
(clone 8C8; Oncogene Research Products), anti-Bax (Upstate), anti-His (Invitrogen), anti-rabbit-HRP (Amersham) and anti-mouse-HRP (Sigma).
Confocal analyses of yeast cells
Yeast were transformed with the appropriate plasmids and transformants were grown to stationary phase in liquid repressing minimal media. For galactose-inducible expression, the yeast were then incubated in 0.2% peptone, 0.1% yeast extract, 2% galactose. Yeast were then either stained to label mitochondria or nucleic acid as described below. Microscopy was undertaken with a Leica TCS4 SP2 spectral confocal scanner or an Olympus Fluoview 300 confocal laser scanning microscope.
Yeast mitochondrial staining
Yeast mitochondria were stained using MitoTracker CMH2-X-Ros (Molecular Probes) as per the manufacturer's instructions. Briefly, 1 µM MitoTracker CMH2-X-Ros was added to the yeast, which were then incubated in the dark at 30°C for 30 minutes, with shaking. They were then washed and resuspended in distilled water, then mounted on coverslips 1:1 with 1% low-melt agarose.
Yeast nucleic acid staining
Yeast were fixed by adding a final concentration of 3.7% (vol/vol) formaldehyde to yeast in complete medium, then incubated for 30 minutes with occasional mixing before being washed three times in PBS. Yeast were placed on a slide treated with poly-L-lysine (Sigma) and adhered for 20 minutes before being washed twice with PBS. A drop of 300 nM DAPI (Sigma) was added to the yeast and incubated for 15 minutes. Excess DAPI was removed by washing the slide three times with PBS and ensuring that the final wash was completely aspirated, before two drops of 1% low-melt agarose were added.
Immunofluorescence
Yeast were washed with phos/sorb (0.1 M KH2PO4, 1.2 M sorbitol pH 6.5) then incubated with zymolase 20T (from ICN; 600 µg/ml in phos/sorb) for 45 minutes at 30°C, flicking every 10 minutes. The yeast were pelleted at 350 g for 5 minutes, then washed twice with phos/sorb and resuspended in phos/sorb. Formaldehyde (3.7% final concentration) was added to the cells, which were incubated for 30 minutes, gently flicking every 10 minutes to mix. The yeast were pelleted (350 g, 5 minutes), washed three times, then permeabilised by incubation for 1-2 minutes with Triton X-100 (1% in phos/sorb) and washed twice. They were then resuspended in primary antibody rabbit anti-Kar2p (a kind gift from L. Miller, University of California, Berkeley, CA) 1:50 in phos/sorb and adhered to poly-L-lysine-coated slides overnight at 4°C. After three phos/sorb washes, the adhered yeast were then incubated with anti-rabbit-Alexa-633 (Molecular Probes) 1:50 for 2-3 hours at room temperature (protected from light), then washed three times with phos/sorb. The cells were then immobilised by addition of a drop of 1% low melt-agarose.
Purification of recombinant proteins
pET23a plasmids were transformed into BL21(DE3)pLysS bacteria (Novagen). Transformants were grown overnight at 37°C and then expanded 1:5 (p35) or 1:8 (CED-4 and EGL-1) in fresh media containing 1 mM IPTG. Bacterial protein expression was induced at 30°C for 4 hours (p35) or 8 hours (CED-4 and EGL-1). The bacteria were harvested, lysed in an immunoprecipitation buffer [50 mM HEPES, 150 mM NaCl, 1% NP40, 5 mM imidazole, protease inhibitor cocktail (Set 1, Calbiochem)] and incubated with in vitro translated proteins that were generated using an in vitro transcription/translation kit (Promega). After incubation at 4°C for 1 hour (rotating), protein complexes were isolated by binding to NiNTA beads at 4°C for 30 minutes, with rotation. After binding, beads were washed three times in immunoprecipitation buffer, then proteins were eluted by boiling in sample buffer for SDS-PAGE, prior to autoradiography and immunoblotting.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Aravind, L., Dixit, V. M. and Koonin, E. V. (2001). Apoptotic molecular machinery: vastly increased complexity in vertebrates revealed by genome comparisons. Science 291, 1279-1284.
Chen, F., Hersh, B. M., Conradt, B., Zhou, Z., Riemer, D., Gruenbaum, Y. and Horvitz, H. R. (2000). Translocation of C. elegans CED-4 to nuclear membranes during programmed cell death. Science 287, 1485-1489.
Chen, L., Willis, S. N., Wei, A., Smith, B. J., Fletcher, J. I., Hinds, M. G., Colman, P. M., Day, C. L., Adams, J. M. and Huang, D. C. S. (2005). Differential targeting of pro-survival Bcl-2 proteins by their BH3-only ligands allows complementary apoptotic function. Mol. Cell 17, 393-403.[CrossRef][Medline]
Chinnaiyan, A. M., Chaudhary, D., O'Rourke, K., Koonin, E. V. and Dixit, V. M. (1997a). Role of CED-4 in the activation of CED-3. Nature 388, 728-729.[CrossRef][Medline]
Chinnaiyan, A. M., Orourke, K., Lane, B. R. and Dixit, V. M. (1997b). Interaction of CED-4 with CED-3 and CED-9 - a molecular framework for cell death. Science 275, 1122-1126.
Chittenden, T., Flemington, C., Houghton, A. B., Ebb, R. G., Gallo, G. J., Elangovan, B., Chinnadurai, G. and Lutz, R. J. (1995). A conserved domain in Bak, distinct from BH1 and BH2, mediates cell death and protein binding functions. EMBO J. 14, 5589-5596.[Medline]
Cizeau, J., Ray, R., Chen, G., Gietz, R. D. and Greenberg, A. H. (2000). The C. elegans orthologue ceBNIP3 interacts with CED-9 and CED-3 but kills through a BH3- and caspase-independent mechanism. Oncogene 19, 5453-5463.[CrossRef][Medline]
Conradt, B. and Horvitz, H. R. (1998). The C. elegans protein EGL-1 is required for programmed cell death and interacts with the Bcl-2-like protein CED-9. Cell 93, 519-529.[CrossRef][Medline]
Conradt, B. and Horvitz, H. R. (1999). The TRA-1A sex determination protein of C. elegans regulates sexually dimorphic cell deaths by repressing the egl-1 cell death activator gene. Cell 98, 317-327.[CrossRef][Medline]
Conus, S., Rosse, T. and Borner, C. (2000). Failure of Bcl-2 family members to interact with Apaf-1 in normal and apoptotic cells. Cell Death Differ. 7, 947-954.[CrossRef][Medline]
del Peso, L., Gonzalez, V. M. and Nunez, G. (1998). Caenorhabditis elegans EGL-1 disrupts the interaction of CED-9 with CED-4 and promotes CED-3 activation. J. Biol. Chem. 273, 33495-33500.
Desagher, S. and Martinou, J. C. (2000). Mitochondria as the central control point of apoptosis. Trends Cell Biol. 10, 369-377.[CrossRef][Medline]
Du, C., Fang, M., Li, Y., Li, L. and Wang, X. (2000). Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition. Cell 102, 33-42.[CrossRef][Medline]
Fairlie, W. D., Perugini, M. A., Kvansakul, M., Chen, L., Huang, D. C. and Colman, P. M. (2006). CED-4 forms a 2,2 heterotetrameric complex with CED-9 until specifically displaced by EGL-1 or CED-13. Cell Death Differ. 13, 426-434.[CrossRef][Medline]
Ferraro, E., Corvaro, M. and Cecconi, F. (2003). Physiological and pathological roles of Apaf1 and the apoptosome. J. Cell. Mol. Med. 7, 21-34.[Medline]
Hanada, M., Aimesempe, C., Sato, T. and Reed, J. C. (1995). Structure-function analysis of Bcl-2 protein identification of conserved domains important for homodimerization with Bcl-2 and heterodimerization with Bax. J. Biol. Chem. 270, 11962-11969.
Hausmann, G., O'Reilly, L. A., van Driel, R., Beaumont, J. G., Strasser, A., Adams, J. M. and Huang, D. C. (2000). Pro-apoptotic apoptosis protease-activating factor 1 (Apaf-1) has a cytoplasmic localization distinct from Bcl-2 or Bcl-x(L). J. Cell Biol. 149, 623-634.
Hawkins, C. J., Wang, S. L. and Hay, B. A. (1999). A cloning method to identify caspases and their regulators in yeast: identification of Drosophila IAP1 as an inhibitor of the Drosophila caspase DCP-1. Proc. Natl. Acad. Sci. USA 96, 2885-2890.
Hawkins, C. J., Wang, S. L. and Hay, B. A. (2000a). Monitoring activity of caspases and their regulators in yeast Saccharomyces cerevisiae. Methods Enzymol. 322, 162-174.[Medline]
Hawkins, C. J., Yoo, S. J., Petersen, E. P., Wang, S. L., Vernooy, S. Y. and Hay, B. A. (2000b). The Drosophila caspase DRONC cleaves following glutamate or aspartate and is regulated by DIAP1, HID, and GRIM. J. Biol. Chem. 275, 27084-27093.
Hawkins, C. J., Silke, J., Verhagen, A. M., Foster, R., Ekert, P. G. and Ashley, D. M. (2001). Analysis of candidate antagonists of IAP-mediated caspase inhibition using yeast reconstituted with the mammalian Apaf-1-activated apoptosis mechanism. Apoptosis 6, 331-338.[CrossRef][Medline]
Hengartner, M. O. (2000). The biochemistry of apoptosis. Nature 407, 770-776.[CrossRef][Medline]
Hengartner, M. O. and Horvitz, H. R. (1994). C. elegans cell survival gene ced-9 encodes a functional homolog of the mammalian proto-oncogene bcl-2. Cell 76, 665-676.[CrossRef][Medline]
Hengartner, M. O., Ellis, R. E. and Horvitz, H. R. (1992). Caenorhabditis elegans gene ced-9 protects cells from programmed cell death. Nature 356, 494-499.[CrossRef][Medline]
Hsu, S. Y., Lin, P. and Hsueh, A. J. (1998). BOD (Bcl-2-related ovarian death gene) is an ovarian BH3 domain-containing proapoptotic Bcl-2 protein capable of dimerization with diverse antiapoptotic Bcl-2 members. Mol. Endocrinol. 12, 1432-1440.
Hu, Y., Benedict, M., Wu, D., Inohara, N. and Nunez, G. (1998). Bcl-XL interacts with Apaf-1 and inhibits Apaf-1-dependent caspase-9 activation. Proc. Natl. Acad. Sci. USA 95, 4386-4391.
Huang, D. C., Adams, J. M. and Cory, S. (1998). The conserved N-terminal BH4 domain of Bcl-2 homologues is essential for inhibition of apoptosis and interaction with CED-4. EMBO J. 17, 1029-1039.[CrossRef][Medline]
Inohara, N., Gourley, T., Carrio, R., Muniz, M., Merino, J., Garcia, I., Koseki, T., Hu, Y., Chen, S. and Nunez, G. (1998). Diva, a Bcl-2 homologue that binds directly to Apaf-1 and induces BH3-independent cell death. J. Biol. Chem. 273, 32479-32486.
Irmler, M., Hofmann, K., Vaux, D. and Tschopp, J. (1997). Direct physical interaction between the Caenorhabditis elegans death proteins CED-3 and CED-4. FEBS Lett. 406, 189-190.[CrossRef][Medline]
Jabbour, A. M., Ekert, P. G., Coulson, E. J., Knight, M. J., Ashley, D. M. and Hawkins, C. J. (2002). The p35 relative, p49, inhibits mammalian and Drosophila caspases including DRONC and protects against apoptosis. Cell Death Differ. 9, 1311-1320.[CrossRef][Medline]
Jabbour, A. M., Ho, P.-K., Puryer, M. A., Ashley, D. M., Ekert, P. G. and Hawkins, C. J. (2004). The Caenorhabditis elegans CED-9 protein does not directly inhibit the caspase CED-3, in vitro nor in yeast. Cell Death Differ. 11, 1309-1316.[CrossRef][Medline]
Kang, J., Schaber, M., Srinivasula, S., Alnemri, E., Litwack, G., Hall, D. and Bjornsti, M. (1999). Cascades of mammalian caspase activation in the yeast Saccharomyces cerevisiae. J. Biol. Chem. 274, 3189-3198.
Kim, K. J., Kim, H. E., Lee, K. H., Han, W., Yi, M. J., Jeong, J. and Oh, B. H. (2004). Two-promoter vector is highly efficient for overproduction of protein complexes. Protein Sci. 13, 1698-1703.[CrossRef][Medline]
Kluck, R. M., Bossywetzel, E., Green, D. R. and Newmeyer, D. D. (1997). The release of cytochrome c from mitochondria - a primary site for Bcl-2 regulation of apoptosis. Science 275, 1132-1136.
Kuwana, T., Bouchier-Hayes, L., Chipuk, J. E., Bonzon, C., Sullivan, B. A., Green, D. R. and Newmeyer, D. D. (2005). BH3 domains of BH3-only proteins differentially regulate Bax-mediated mitochondrial membrane permeabilization both directly and indirectly. Mol. Cell 17, 525-535.[CrossRef][Medline]
Letai, A., Bassik, M., Walensky, L., Sorcinelli, M., Weiler, S. and Korsmeyer, S. (2002). Distinct BH3 domains either sensitize or activate mitochondrial apoptosis, serving as prototype cancer therapeutics. Cancer Cell 2, 183-192.[CrossRef][Medline]
Madeo, F., Herker, E., Maldener, C., Wissing, S., Lachelt, S., Herlan, M., Fehr, M., Lauber, K., Sigrist, S. J., Wesselborg, S. et al. (2002). A caspase-related protease regulates apoptosis in yeast. Mol. Cell 9, 911-917.[CrossRef][Medline]
Marsden, V. S. and Strasser, A. (2003). Control of apoptosis in the immune system: Bcl-2, BH3-only proteins and more. Annu. Rev. Immunol. 21, 71-105.[CrossRef][Medline]
Moriishi, K., Huang, D., Cory, S. and Adams, J. (1999). Bcl-2 family members do not inhibit apoptosis by binding the caspase activator Apaf-1. Proc. Natl. Acad. Sci. USA 96, 9683-9688.
O'Connor, L., Strasser, A., O'Reilly, L. A., Hausmann, G., Adams, J. M., Cory, S. and Huang, D. C. (1998). Bim: a novel member of the Bcl-2 family that promotes apoptosis. EMBO J. 17, 384-395.[CrossRef][Medline]
Pan, G., O'Rourke, K. and Dixit, V. (1998). Caspase-9, Bcl-XL, and Apaf-1 form a ternary complex. J. Biol. Chem. 273, 5841-5845.
Puryer, M. A. and Hawkins, C. J. (2006). Human, insect and nematode caspases kill Saccharomyces cerevisiae independently of YCA1 and Aif1p. Apoptosis 11, 509-517.[CrossRef][Medline]
Rose, M. D., Misra, L. M. and Vogel, J. P. (1989). KAR2, a karyogamy gene, is the yeast homolog of the mammalian BiP/GRP78 gene. Cell 57, 1211-1221.[CrossRef][Medline]
Salvesen, G. S. (2002). Caspases and apoptosis. Essays Biochem. 38, 9-19.[Medline]
Saraste, M., Sibbald, P. R. and Wittinghofer, A. (1990). The P-loop - a common motif in ATP- and GTP-binding proteins. Trends Biochem. Sci. 15, 430-434.[CrossRef][Medline]
Schumacher, B., Schertel, C., Wittenburg, N., Tuck, S., Mitani, S., Gartner, A., Conradt, B. and Shaham, S. (2004). C. elegans ced-13 can promote apoptosis and is induced in response to DNA damage. Cell Death Differ. 12, 153-161.
Seiffert, B. M., Vier, J. and Hacker, G. (2002). Subcellular localization, oligomerization, and ATP-binding of Caenorhabditis elegans CED-4. Biochem. Biophys. Res. Commun. 290, 359-365.[CrossRef][Medline]
Seshagiri, S. and Miller, L. K. (1997). Caenorhabditis elegans CED-4 stimulates CED-3 processing and CED-3-induced apoptosis. Curr. Biol. 7, 455-460.[CrossRef][Medline]
Sikorski, R. and Hieter, P. (1989). A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 19-27.
Song, Q., Kuang, Y., Dixit, V. and Vincenz, C. (1999). Boo, a novel negative regulator of cell death, interacts with Apaf-1. EMBO J. 18, 167-178.[CrossRef][Medline]
Spector, M. S., Desnoyers, S., Hoeppner, D. J. and Hengartner, M. O. (1997). Interaction between the C. elegans cell-death regulators CED-9 and CED-4. Nature 385, 653-656.[CrossRef][Medline]
Strasser, A., Harris, A. W., Huang, D., Krammer, P. H. and Cory, S. (1995). Bcl-2 and Fas/Apo-1 regulate distinct pathways to lymphocyte apoptosis. EMBO J. 14, 6136-6147.[Medline]
Sulston, J. E., Schierenberg, E., White, J. G. and Thomson, J. N. (1983). The embryonic cell lineage of the nematode Caenorhabditis elegans. Dev. Biol. 100, 64-119.[CrossRef][Medline]
Tao, W. K., Kurschner, C. and Morgan, J. I. (1997). Modulation of cell death in yeast by the Bcl-2 family of proteins. J. Biol. Chem. 272, 15547-15552.
Vaux, D. L., Cory, S. and Adams, J. M. (1988). Bcl-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre-B cells. Nature 335, 440-442.[CrossRef][Medline]
Vaux, D. L., Weissman, I. L. and Kim, S. K. (1992). Prevention of programmed cell death in Caenorhabditis elegans by human Bcl-2. Science 258, 1955-1957.
Verhagen, A. M., Ekert, P. G., Pakusch, M., Silke, J., Connolly, L. M., Reid, G. E., Moritz, R. L., Simpson, R. J. and Vaux, D. L. (2000). Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins. Cell 102, 43-53.[CrossRef][Medline]
Wang, K., Yin, X. M., Chao, D. T., Milliman, C. L. and Korsmeyer, S. J. (1996). Bid - a novel BH3 domain-only death agonist. Genes Dev. 10, 2859-2869.
Wang, S. L., Hawkins, C. J., Yoo, S. J., Muller, H. A. and Hay, B. A. (1999). The Drosophila caspase inhibitor DIAP1 is essential for cell survival and is negatively regulated by REAPER, HID and GRIM, which disrupt DIAP1-caspase interactions. Cell 98, 453-463.[CrossRef][Medline]
Wissing, S., Ludovico, P., Herker, E., Buttner, S., Engelhardt, S. M., Decker, T., Link, A., Proksch, A., Rodrigues, F., Corte-Real, M. et al. (2004). An AIF orthologue regulates apoptosis in yeast. J. Cell Biol. 166, 969-974.
Wu, D., Wallen, H., Inohara, N. and Nunez, G. (1997a). Interaction and regulation of the Caenorhabditis elegans death protease CED-3 by CED-4 and CED-9. J. Biol. Chem. 272, 21449-21454.
Wu, D. Y., Wallen, H. D. and Nunez, G. (1997b). Interaction and regulation of subcellular localization of CED-4 by CED-9. Science 275, 1126-1129.
Xue, D. and Horvitz, H. R. (1997). Caenorhabditis elegans CED-9 protein is a bifunctional cell-death inhibitor. Nature 390, 305-308.[CrossRef][Medline]
Yan, N., Gu, L., Kokel, D., Chai, J., Li, W., Han, A., Chen, L., Xue, D. and Shi, Y. (2004). Structural, biochemical, and functional analyses of CED-9 recognition by the proapoptotic proteins EGL-1 and CED-4. Mol. Cell 15, 999-1006.[CrossRef][Medline]
Yan, N., Chai, J., Lee, E. S., Gu, L., Liu, Q., He, J., Wu, J. W., Kokel, D., Li, H., Hao, Q. et al. (2005). Structure of the CED-4-CED-9 complex provides insights into programmed cell death in Caenorhabditis elegans. Nature 437, 831-837.[CrossRef][Medline]
Yang, X., Chang, H. Y. and Baltimore, D. (1998). Essential role of CED-4 oligomerization in CED-3 activation and apoptosis. Science 281, 1355-1357.
Yasuda, M., D'Sa-Eipper, C., Gong, X. L. and Chinnadurai, G. (1998). Regulation of apoptosis by a Caenorhabditis elegans BNIP3 homolog. Oncogene 17, 2525-2530.[CrossRef][Medline]
Yuan, J. Y., Shaham, S., Ledoux, S., Ellis, H. M. and Horvitz, H. R. (1993). The C. elegans cell death gene ced 3 encodes a protein similar to mammalian interleukin-1-beta-converting enzyme. Cell 75, 641-652.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||