spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online June 20, 2006
doi: 10.1242/10.1242/jcs.02996


Journal of Cell Science 119, 2654-2666 (2006)
Published by The Company of Biologists 2006
This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Za, L.
Right arrow Articles by de Curtis, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Za, L.
Right arrow Articles by de Curtis, I.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Research Article

ßPIX controls cell motility and neurite extension by regulating the distribution of GIT1

Lorena Za1, Chiara Albertinazzi1,*, Simona Paris1, Mariacristina Gagliani2, Carlo Tacchetti2 and Ivan de Curtis1,{ddagger}

1 Cell Adhesion Unit, Department of Molecular Biology and Functional Genomics, San Raffaele Scientific Institute, Via Olgettina 58, 20132 Milano, Italy
2 MicroScoBio Research Center and IFOM Center for Cell Oncology and Ultrastructure, Department of Experimental Medicine, University of Genoa, Via deToni 14, 16132, Genoa, Italy

{ddagger} Author for correspondence (e-mail: decurtis.ivan{at}hsr.it)

Accepted 27 March 2006


    Summary
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Cell motility entails the reorganization of the cytoskeleton and membrane trafficking for effective protrusion. GIT1/p95-APP1 is a member of a family of GTPase-activating proteins for ARF GTPases that affect endocytosis, adhesion and migration. GIT1 associates with paxillin and a complex including the Rac/Cdc42 exchanging factors PIX/Cool and the kinase PAK. In this study, we show that overexpression of ßPIX induces the accumulation of endogenous and overexpressed GIT1 at large structures similar to those induced by an ArfGAP-defective mutant of GIT1 (p95-C2). Immunohistochemical analysis and immunoelectron microscopy reveal that these structures include the endogenous transferrin receptor. Time-lapse analysis during motogenic stimuli shows that the formation and perinuclear accumulation of the p95-C2-positive structures is paralleled by inhibition of lamellipodium formation and cell retraction. Both dimerization and a functional SH3 domain of ßPIX are required for the accumulation of GIT1 in fibroblasts, which is prevented by the monomeric PIX-PG-{Delta}LZ. This mutant also prevents the formation of endocytic aggregates and inhibition of neurite outgrowth in retinal neurons expressing p95-C2. Our results indicate that ßPIX is an important regulator of the subcellular distribution of GIT1, and suggest that alteration in the level of expression of the complex affects the endocytic compartment and cell motility.

Key words: ArfGAP, GTPases, Membrane traffic, Motility, Neuritogenesis


    Introduction
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Cell migration is driven by protrusive activity at the leading edge of the cell, where continuous remodelling of actin and adhesive sites are required. Experimental evidence indicates that membrane trafficking may contribute to the extension of the cell border required for protrusion (Hopkins et al., 1994Go; Bretscher and Aguado-Velasco, 1998Go), but the underlying mechanisms remain to be determined. GIT proteins are recently identified ADP-ribosylation factor (ARF) GTPase-activating proteins (GAPs) (Turner et al., 2001Go). Given the essential role of ARF GTPases in membrane trafficking (Nie et al., 2003Go), one hypothesis is that these proteins coordinate ARF-mediated membrane trafficking with cell adhesion and cytoskeletal organization during cell motility (de Curtis, 2001Go). The vertebrate GIT family includes two proteins of 95 kDa: GIT1, also called p95-APP1 or CAT1, and GIT2, also called PKL or CAT2 (Premont et al., 1998Go; Bagrodia et al., 1999Go; Turner et al., 1999Go; Di Cesare et al., 2000Go). Smaller splice variants of GIT2 have been identified (Premont et al., 2000Go). These ArfGAPs interact directly with a number of proteins including the PIX/Cool exchange factors for Rac1 and Cdc42 (Bagrodia et al., 1998Go; Manser et al., 1998Go), the focal adhesion protein paxillin (Turner et al., 1999Go), the focal adhesion kinase (FAK) (Zhao et al., 2000Go), and the synaptic adaptor proteins Piccolo and liprins (Kim et al., 2003Go; Ko et al., 2003Go). In vitro and in vivo studies suggest that GIT proteins specifically regulate the activity of Arf6 in cells (Albertinazzi et al., 2003Go; Vitale et al., 2000Go). Arf6 is a GTP-binding protein of the Arf family involved in membrane trafficking between the cell surface and endosomes (D'Souza-Schorey et al., 1995Go; Donaldson, 2003Go; Peters et al., 1995Go; Radhakrishna et al., 1996Go), which specifically colocalizes with GIT1/p95-APP1-derived constructs at the endocytic compartment of transfected fibroblasts (Di Cesare et al., 2000Go). Moreover, given the interaction of this protein with a complex including the Rac and Cdc42 exchange factor PIX and PAK, a serine threonine kinase acting downstream of Rac and Cdc42 (Bokoch, 2003Go), GIT1 has also been involved in the regulation of these small GTPases (Bagrodia et al., 1998Go; Manser et al., 1998Go). The role of the GIT proteins in regulating membrane trafficking during cell motility and the mechanisms regulating their subcellular localization remain to be determined. We have previously found that mutants of GIT1/p95-APP1 lacking a functional ArfGAP domain, but preserving the Spa2 homology domain (SHD) required for the interaction with PIX, accumulate at large cytoplasmic structures positive for the small GTP binding protein Rab11 (Matafora et al., 2001Go), a functional marker of perinuclear recycling endosomes. This accumulation correlates with the inhibition of neurite extension in cultures of primary neurons transfected with the ArfGAP mutants of GIT1/p95-APP1, thus implicating this ArfGAP in the coordination of membrane trafficking with cytoskeletal reorganization during growth cone motility (Albertinazzi et al., 2003Go).

In this study we show that altering the levels of ßPIX affects GIT1 localization in the cell, leading to accumulation of GIT1 at transferrin (Tf)-positive endocytic structures similar to those obtained by expression of ArfGAP-deficient mutants, including the SHD PIX-binding domain. We also found that these mutants interfere with the cellular response to motogenic stimuli. Analysis of several ßPIX mutants has allowed us to identify the requirements for ßPIX-induced accumulation of GIT1, and the possible involvement of PAK as an intermediate required for the accumulation of the ßPIX/GIT1 complex. Mutations affecting GIT1 accumulation are able to reverse the inhibition of neurite extension induced by ArfGAP mutants of GIT1. Altogether, our results show that ßPIX is an important regulator of GIT1 subcellular localization, and that alteration of GIT1 localization interferes with the endocytic compartment and cell motility.


    Results
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
PIX mediates the recruitment of GIT1 at intracellular structures
We previously showed that expression of ArfGAP-deficient mutants of GIT1/p95-APP1 induced the accumulation of these mutants at structures specifically positive for endogenous markers of the endocytic recycling compartment. By contrast, overexpressed full-length GIT1 was largely cytosolic. We also showed that the GIT1 mutants colocalize with other components of the GIT1 complex at these structures, as shown by colocalization of ßPIX, PAK and paxillin (Matafora et al., 2001Go). Since these results have shown that the PIX-binding SHD domain of GIT1 is required for the recruitment of the complex at the endocytic structures, we explored the role of ßPIX in the intracellular distribution of full length GIT1. We found a strong effect of the co-expression of ßPIX on the localization of GIT1 both in chicken embryo fibroblasts (CEFs) and COS7 cells (Fig. 1). In fact, whereas overexpression of either protein resulted in largely diffuse distribution of these proteins, co-expression of GIT1 and ßPIX induced accumulation of both proteins at large intracellular structures. These structures were very similar to those described when mutants of GIT1 with an affected (p95-K39) or deleted (p95-C2) ArfGAP domain are expressed in either fibroblasts or primary neurons (Matafora et al., 2001Go; Albertinazzi et al., 2003Go). Overexpression of proteins can induce the formation of proteinaceous structures called aggresomes that share some common features (Garcia-Mata et al., 2002Go). To test whether the structures induced by co-overexpression of GIT1 and ßPIX were classical aggresomes, we performed staining with anti-vimentin antibodies, to look at the organization of intermediate filaments in the transfected cells, which are usually heavily affected by aggresome formation (Garcia-Mata et al., 2002Go). Intermediate filaments appeared perfectly conserved in transfected cells when compared to non-transfected cells (Fig. 2A), indicating that the structures induced by co-expression of GIT1 and ßPIX are not aggresomes. Analysis of the distribution of endogenous TfR showed that this transmembrane endocytic protein was partially retained in the ßPIX/GIT1-positive structures (not shown), confirming previous findings in cells expressing ArfGAP mutants of GIT1 and showing alterations in the endocytic compartment (Matafora et al., 2001Go; Albertinazzi et al., 2003Go). Partial accumulation of endocytosed Tf was observed in the ßPIX/GIT1-positive structures after 1 hour of Tf uptake (Fig. 2B). Some labelled Tf remained trapped in these structures after 2 hours of chasing, whereas the rest of the cytoplasm was cleared of the internalized Tf that had undergone recycling (Fig. 2C). Intriguingly, overexpression of ßPIX alone inhibited Tf uptake, with no evident accumulation of Tf in the large cytoplasmic structures (Fig. 2D).


Figure 1
View larger version (34K):
[in this window]
[in a new window]
 
Fig. 1. ßPIX-induced recruitment of GIT1 at cytoplasmic structures. CEFs (A-D) and COS7 cells (E-H) were transfected to overexpress GIT1 (A,E), ßPIX (B,F), or both proteins (C,D,G,H), and analyzed by immunofluorescence. Same fields are shown in C,D, and in G,H. Co-expression of GIT1 and ßPIX enhanced the localization of both proteins at large structures (arrowheads). Bars, 20 µm.

 

Figure 2
View larger version (79K):
[in this window]
[in a new window]
 
Fig. 2. Effects of GIT1 and ßPIX overexpression. (A) Overexpression of GIT1 and ßPIX does not affect the organization of intermediate filaments. Confocal images were taken of COS7 cells cotransfected for GIT1 and ßPIX expression and immunostained for GIT1 (red) and vimentin (green). (B,C) Overexpression of GIT1 and ßPIX partially affects the recycling of transferrin (Tf). A431 cells cotransfected with GIT1 and ßPIX were incubated for 1 hour at 37°C with 60 µg/ml of Alexa Fluor 488-labelled human Tf (green, B), and chased for 2 hours at 37°C (C). Two different confocal planes along the z-axis are shown in B. (D) Overexpression of ßPIX prevented Tf internalization in A431 cells. Cells were fixed, permeabilized and immunostained with antibodies (red) for ßPIX (C,D) or GIT1 (B). Bars, 20 µm.

 

To test for the localization of the endogenous TfR, 200 nm ultrathin cryosections were prepared and processed for immunofluorescence. Accumulation of endogenous TfR and overexpressed GIT1 was observed confined within the same large structures in cells cotransfected for GIT1 and ßPIX (Fig. 3A-C). We then performed immunogold labelling on 60 nm ultrathin cryosections to further characterize these large structures. Using an anti-FLAG antibody to identify the transfected GIT1, we observed gold labelling at tubulovesicular endosomes (Fig. 3D), and electron dense structures (Fig. 3E-G). Double labelling of the sections with anti-FLAG antibodies (15 nm gold), in combination with anti-TfR (10 nm gold) showed an extensive colocalization of the two antigens within the electron dense structures (Fig. 3E-G). Observation at higher magnification revealed that the colocalization frequently occurred on membranes included within the electron dense structures (Fig. 3G). These data show that co-overexpression of GIT1 and ßPIX induced the specific aggregation of proteins with membranes from the TfR-positive endosomal compartment. The analysis, by immunoelectron microscopy, of cells transfected with the ArfGAP-depleted protein p95-C2 showed that the same type of structures were induced (data not shown). These data suggest that perturbation of the endogenous GIT1-ßPIX complexes can cause the alteration of the recycling compartment. This alteration is obtained either by increasing the levels of the complex by overexpressing both proteins, or by expressing an ArfGAP mutant able to interact with ßPIX. In fact, previous studies have shown that a point mutation inactivating the ArfGAP activity of GIT1 is also able to induce aggregates of the endocytic recycling compartment, whereas mutants lacking the SHD PIX-binding domain fail to cause membrane clustering (Matafora et al., 2001Go).


Figure 3
View larger version (131K):
[in this window]
[in a new window]
 
Fig. 3. GIT1 colocalizes with transferrin receptor (TfR) in endosome-derived structures. COS7 cells transfected for GIT1 and ßPIX. (A-C) Double immunofluorescence on ultrathin cryosections. GIT1 (A) and endogenous TfR (B) colocalize (arrows) within large intracellular structures present in the cytoplasm (C) (GIT1, green; TfR, red; nuclei, blue). (D-G) Immunogold labelling of ultrathin cryosection for GIT1, identified by antibodies to Flag, (FLAG, gold 15 nm), and TfR (gold 10 nm). GIT1 associates with tubulovesicular endosomes (D) and intracellular electron dense structures (E), often displaying bounding membranes (F,G arrows). GIT1 and endogenous TfR associate to the same electron dense structures (E-G), often within small vesicles (G). Bars, (D) 253 nm; (E) 212 nm; (F) 137 nm; (G) 57 nm.

 

Overexpression of either GIT1 or ßPIX results in the formation of structures similar to those obtained by co-expression of the two proteins in a smaller number of cells. The analysis of these cells by immunogold labelling has shown that either protein induced cytoplasmic structures similar to those observed in cotransfected cells (Fig. 4). In cells transfected with ßPIX, the electron-dense cytoplasmic structures showed intense labelling for ßPIX, whereas labelling of the same structures for the endogenous TfR was rare (Fig. 4A,B). By contrast, the electron-dense structures in GIT1-transfected cells were strongly labelled for both overexpressed GIT1 and endogenous TfR (Fig. 4C,D).


Figure 4
View larger version (104K):
[in this window]
[in a new window]
 
Fig. 4. COS7 cells transfected for ßPIX-HA (A,B) or GIT1-Flag (C,D). (A,B) Double immunogold labelling on ultrathin cryosections. ßPIX-HA (gold, 15 nm), identified by antibodies to HA, labels extensively large intracellular structures. ßPIX-HA (gold, 15 nm) and endogenous TfR (gold, 10 nm) scarcely colocalize within these structures (arrows in B). (C) Immunogold labelling of ultrathin cryosection for GIT1 (gold, 15 nm), identified by antibodies to Flag. GIT1 labels extensively large intracellular structures and endosomes (arrow). (D) Transferrin receptor (TfR, gold 10 nm) associates with similar electron dense structures. Bars, (A) 470 nm; (B) 180 nm; (C) 140 nm; (D) 57 nm.

 
ArfGAP-defective GIT1 interferes with the cellular response to motogenic stimuli
To assess possible effects of the perturbation of the intracellular localization of GIT1 with cell motility, we analyzed the effects of expression of ArfGAP-deleted p95-C2 on EGF-induced cell motility in A431 cells expressing high levels of EGF receptor. A431 cells were transfected to express each of different GFP-tagged constructs of GIT1 (Fig. 5A), and followed by time-lapse videomicroscopy before and during stimulation with EGF. A431 cells respond to EGF by extending membrane ruffles and lamellipodia, and the process is mediated by the activation of the GTPases Rac1 and Cdc42 (Kurokawa et al., 2004Go). In A431-transfected cells, EGF induced a strong recruitment of ArfGAP-defective p95-C2-GFP at cytoplasmic structures that appeared to form at the cell periphery (Fig. 5B, arrowheads) and concentrated with time in the perinuclear region of the cells (Fig. 5B). As a control, we used the p95-C-GFP mutant that differs from p95-C2-GFP in the lack of the SHD domain (Fig. 5A). By contrast to cells expressing p95-C2-GFP, EGF treatment did not induce formation of p95-C-GFP-positive structures in A431 (Fig. 5C,E), whereas EGF stimulation in cells expressing the full length p95-GFP induced only a weak accumulation of GFP-positive structures in a smaller fraction of transfected cells (Fig. 5E). These results indicate that the clustering of endocytic membranes was strongly potentiated by the lack of the ArfGAP domain, and required the presence of the SHD ßPIX-binding domain. In cells transfected with the ArfGAP-deleted p95-C2 mutant, these structures were formed by the fusion of smaller cytoplasmic structures appearing soon after stimulation with EGF (Fig. 5D). Similar results were observed in normal fibroblasts stimulated with platelet-derived growth factor (data not shown).


Figure 5
View larger version (48K):
[in this window]
[in a new window]
 
Fig. 5. EGF stimulation induces vesicle accumulation in cells expressing an ArfGAP mutant of GIT1. (A) Schematic representation of the GFP-tagged GIT1 constructs utilized in this study: p95-GFP including the full length GIT1; p95-C2-GFP including residues 229-740 of GIT1; p95-C-GFP, including residues 346-740 of GIT1, and GFP alone. ANK, ankyrin repeats; SHD, Spa2 homology domain; LZ, leucine zipper; PBS, paxillin binding subdomain. (B,C) A431 cells were stimulated for the indicated times with 100-200 ng/ml of EGF: representative frames from time-lapse observation of cells expressing p95-C2-GFP (B) and p95-C-GFP (C); Bar, 10 µm. Arrowheads in B indicate newly formed GFP-positive structures following EGF stimulation. Arrows in C indicates growth factor-induced lamellipodial extensions. Bar, 10 µm. (D) Frames from time-lapse observation of cells expressing p95-C2-GFP. Arrowheads and arrows indicate two examples of fusion between GFP-positive structures during stimulation with EGF. Bar, 5 µm. (E) Cells expressing p95-C2-GFP (n=24 with EGF; n=21 without EGF), p95-C-GFP (n=18), p95-GFP (n=24), or GFP alone (n=24) were analyzed by time-lapse digital analysis, and scored after 40 minutes for the formation of GFP-labelled vesicle during stimulation with EGF. Bars represent the percentages of cells with EGF-induced vesicles.

 

Accumulation of endocytic structures in p95-C2-GFP-transfected cells correlated with the inhibition of EGF-induced extension of lamellipodia and ruffles (Fig. 6A), and with strong cell retraction, that became evident 10-20 minutes after EGF addition (Fig. 6C). Inhibition of EGF-induced membrane protrusion and retraction (Fig. 6B,D, respectively) were not obvious in cells overexpressing either the full length GIT1 protein, or the p95-C mutant lacking the PIX-binding domain. p95-C-GFP-expressing cells showed lamellipodia formation following EGF stimulation (Fig. 5C). These results indicate that the ArfGAP mutant p95-C2 maintained the ability to accumulate at endocytic structures via the PIX binding domain. The observed effects on ruffling and cell retraction may be explained by the fact that the formation of these structures sequesters endocytic membranes (Fig. 2B,C and Fig. 3), and may therefore interfere with membrane recycling under conditions of acute stimulation of membrane internalization by EGF (Haigler et al., 1979Go). Stimulation of p95-C2 expressing cells with EGF could induce retraction also in the presence of Y-27632, an inhibitor of the kinase ROCK that mediates RhoA-induced contractility (Fig. 6E,F). Therefore, the results indicate that Rho-mediated contractility is not involved in the EGF-induced retraction of p95-C2 expressing cells.


Figure 6
View larger version (74K):
[in this window]
[in a new window]
 
Fig. 6. EGF stimulation induces retraction in cells expressing an ArfGAP mutant of GIT1. A431 cells were stimulated for the indicated times with 100-200 ng/ml of EGF. (A) EGF-induced lamellipodia protrusion is inhibited in a cell expressing the ArfGAP defective p95-C2-GFP protein (asterisk), whereas large lamellipodia are formed (arrowheads) in two neighbouring non-transfected cells (white dots). Same fields are shown in the frames of the upper and lower rows, respectively. Bar, 10 µm. (B) Cells with contact-free edges expressing p95-C2-GFP (n=23), p95-GFP (n=20), p95-C-GFP (n=18), or GFP (n=18) were analyzed by time-lapse digital analysis, and scored during the first 15 minutes of stimulation with EGF for formation of ruffles. Bars represent the percentages of cells showing inhibition of EGF-induced ruffling. (C) Retraction of two cells expressing p95-C2-GFP (asterisks) during EGF stimulation. No strong retraction was evident in the non-transfected cell. Bar, 20 µm. (D) Retraction was scored 30 minutes after stimulation with EGF in cells with contact-free edges expressing p95-C2-GFP (n=24 with EGF; n=20 no EGF), p95-GFP (n=23), p95-C-GFP (n=18), or GFP (n=22). Bars represent the percentages of retracted cells. (E) A431 cells were treated with 10 µM Y-27632 for 45 minutes before stimulation with 200 ng/ml EGF for the indicated times. The asterisk indicates a transfected cell; arrows indicate retractions. No strong retraction (arrowheads) was evident in the non-transfected cells. Bar, 20 µm. (F) Cells with contact-free edges expressing p95-C2-GFP treated with Y-27632 (30 cells), with EGF (23 cells), or with Y-27632 followed by EGF (25 cells) were analyzed by time-lapse digital analysis. Retraction was scored 30 minutes after EGF (or mock) stimulation. Bars represent the percentage of retracted cells. In B,D,F the standard error of the percentages is shown. Statistical significance was assessed by the {chi}2 test, incorporating Yates' correction for continuity, with P<0.05 considered significant. In B and D the values obtained from cells transfected with each of the GIT1 constructs were compared with that from cells transfected with GFP alone. *P<0.001; **P<0.0005. In F there was no significant difference in terms of retraction after EGF stimulation between Y-27632 treated and untreated cells.

 
These data indicate that binding to ßPIX was required for the recruitment of GIT1 at vesicles, since the lack of the SHD domain from p95-C-GFP resulted in a diffuse cytoplasmic distribution of the protein (Fig. 5C).

Requirements for ßPIX-mediated intracellular localization of GIT1
One intriguing result from the previous set of experiments is that EGF stimulation resulted in weaker accumulation of full length p95-GFP-positive structures when compared to the truncated p95-C2 construct (Fig. 5E). The difference is even more striking when considering that in the p95-GFP-transfected cells showing formation of cytoplasmic structures, these were generally much less evident than in p95-C2-GFP transfected cells. This finding was somehow surprising, since both proteins contain the SHD PIX-binding domain. One possible explanation is that the full length GIT1 protein is in a conformational state that can be modified either by PIX binding, or by truncation of the protein amino-terminal region. This hypothesis is supported by the data showing that overexpression of GIT1 alone in CEFs results in the moderate formation of GIT1-positive structures in a minor fraction of cells compared to cells cotransfected with GIT1 and ßPIX (Fig. 7E). The hypothesis of a conformational switch between an inactive and active form of GIT1 is supported also by previous data showing PIX-dependent stimulation of paxillin binding to GIT1 (Zhao et al., 2000Go).


Figure 7
View larger version (47K):
[in this window]
[in a new window]
 
Fig. 7. Dimerization and the SH3 domain of ßPIX are required for the recruitment of GIT1 at large cytoplasmic structures. (A) Schematic diagram of the PIX constructs used in this study; SH3, Src homology 3 domain; DH, Dbl homology region; PH, pleckstrin homology domain; ABD, ArfGAP binding domain; LZ, leucine zipper. (B-D) Effects of ßPIX expression on GIT1 localization. CEFs were transfected with either GIT1 or PIX (B), cotransfected with both proteins (C), or cotransfected with full length GIT1 and the monomeric SH3 mutant ßPIX-PG{Delta}LZ (D). Bar, 20 µm. (E) Quantification of the localization of GIT1 at large cytoplasmic structures in CEFs transfected with GIT1 alone (n=300); cotransfected with GIT1 together with each of the following ßPIX constructs: full length PIX (n=385), PIX-PG{Delta}LZ (n=200), PIX{Delta}LZ (228), PIX-PG (200), or cotransfected with the monomeric mutant of GIT1 (p95-LZ) and full length PIX (n=200). Error bars represent the s.d. from at least two independent experiments. Statistical significance was assessed by the Student's t-test (P<0.05 considered significant). The values from cells transfected with GIT1 alone or cotransfected with GIT1 and each of the indicated ßPIX mutants were compared to the values from cells cotransfected with GIT1 and wild-type ßPIX. *P<0.005; **P<0.0005. (F) Overexpression of either PIX{Delta}LZ or PIX-PG{Delta}LZ alone did not induce the formation of large structures. Bar, 20 µm. (G) Immunoprecipitation with anti-FLAG from lysates of COS7 cells transfected with FLAG-GIT1 and one of the following monomeric mutants of ßPIX: ßPIX-PG{Delta}LZ (IP1), ßPIX-C{Delta}LZ (IP2), ßPIX-{Delta}LZ (IP3), ßPIX-{Delta}PH{Delta}LZ (IP4) and ßPIXwt (IP5). 50 µg of each lysate (Lys) were also loaded. Portions of the same filters were immunoblotted for PIX and GIT1, as indicated.

 
Based on these observations, we further explored the mechanisms of PIX-mediated recruitment of GIT1 at endocytic structures. As mentioned earlier, co-expression of ßPIX with full length GIT1 markedly enhanced the recruitment of both proteins at endocytic structures compared to cells overexpressing either protein (Fig. 7B,C). Several ßPIX mutants were tested to look for the region(s) of ßPIX required to recruit the ßPIX/GIT1 complex to the cytoplasmic structures (Fig. 7A). All the PIX mutants used for this analysis preserved the ability to interact with GIT1 (Fig. 7G). In the ßPIX-PG-{Delta}LZ mutant, the combined mutation of the SH3 domain and the deletion of the carboxy-terminal leucine zipper required for ßPIX dimerization strongly prevented the accumulation of GIT1 (Fig. 7D). Mutation of the SH3 domain alone was not sufficient to prevent the localization of the complex at the cytoplasmic structures, whereas monomeric ßPIX with a normal SH3 domain only partially affected the formation of these structures (Fig. 7E). On top of their ability to interact with each other, PIX and GIT proteins can form homodimers (Kim et al., 2001Go; Kim et al., 2003Go; Paris et al., 2003Go; Feng et al., 2004Go). Therefore, larger complexes between the two proteins can be formed. Large endogenous complexes containing both GIT1 and PIX have been identified (Paris et al., 2003Go). Moreover, it has been shown that large complexes between GIT1 and ßPIX can be induced by overexpression of the two full length proteins, whereas large complexes are prevented by co-expression of GIT1 with the ßPIX-PG-{Delta}LZ monomeric mutant, although this mutant can be co-immunoprecipitated with GIT1 (de Curtis and Paris, 2005Go). Based on these results, we propose that ßPIX regulates the intracellular localization of GIT at intracellular membranes by the assembly of large oligomeric complexes.

PAK-Pbd inhibits recruitment of the ßPIX/GIT1 complex at intracellular structures
PAK kinases act as downstream effectors for Rac and Cdc42 and are implicated in actin reorganization. The amino-terminal portion of PAK1 contains a proline-rich region (amino acid 184-204, the PIX binding domain; Pbd) that binds the SH3 domain of PIX (Manser et al., 1998Go). We prepared a PAK-Pbd construct (amino acid 150-250 of PAK1; Fig. 8A) to test whether PAK binding to PIX is involved in the formation of ßPIX and GIT1-containing endocytic structures. PAK-Pbd competed for the binding of endogenous PAK to ßPIX (Fig. 8B). PAK-Pbd appeared to have only a minor effect on the interaction between ßPIX with GIT1, as determined by quantification of the bands of GIT and PIX coprecipitating with either PAK or PAK-Pbd: there was a less than 20% decrease in the ratio between coprecipitating GIT/PIX in co-IPs from PAK-Pbd-expressing cells (Fig. 8C). In triple-transfected CEFs, whereas wild-type PAK colocalized with the endocytic structures induced by ßPIX and GIT1 (Fig. 8D,E,H), co-expression of PAK-Pbd with GIT1 and ßPIX prevented the formation of these structures (Fig. 8F-H). These results indicate that PAK-Pbd prevents clustering of endocytic membranes by preventing binding of endogenous PAK to ßPIX, and suggest that PAK is involved in the recruitment of the GIT complex at endocytic vesicles. According to this hypothesis, overexpression of PAK1 and ßPIX induced the formation of the endocytic structures, where endogenous GIT1 was recruited (Fig. 8I).


Figure 8
View larger version (58K):
[in this window]
[in a new window]
 
Fig. 8. PAK-Pbd interferes with the recruitment of the PIX/GIT1 complex at large cytoplasmic structures. (A) Scheme of PAK1 and of the PAK-Pbd construct. 1-4 indicate the four proline-rich regions in the amino-terminal portion of PAK1; region 4 (asterisk) is the one involved in binding to the SH3 domain of PIX. (B) Immunoprecipitation from lysates of COS7 cells transfected with ßPIX (IP1) or ßPIX and PAK-Pbd (IP2). Unbound fractions (Ub) and lysates (Lys) from the two samples were also loaded. Portions of the same filters were immunoblotted for PIX (PIXtr), endogenous PAK (PAKe), or PAK-Pbd, as indicated. (C) Immunoprecipitation with anti-Myc antibodies from lysates of COS7 cells transfected with FLAG-GIT1, HA-ßPIX and Myc-PAK (Lys1) or Myc-PAK-Pbd (Lys2). 50 µg of each lysate were also loaded. Portions of the same filters were immunoblotted for GIT1, PIX or PAK, as indicated. (D-G) Effects of PAK expression on the distribution of PIX and GIT1. CEFs were triple transfected with PAK, ßPIX and GIT1 (D,E), or with PAK-Pbd, PIX and GIT1 (F,G). Bar, 20 µm. (H) Quantification of the effects of PAK-Pbd expression on the localization of GIT1 and PIX at large cytoplasmic structures in CEFs cotransfected with GIT1 and ßPIX (n=385), triple transfected with PAK, PIX and GIT1 (n=200), or with PAK-Pbd, PIX and GIT1 (n=200). Error bars represent the s.d. from at least two independent experiments. Statistical significance was assessed by the Student's t-test (P<0.05 considered significant). The values from cells triple transfected with GIT1, ßPIX and PAK-Pbd were compared to those from cells triple transfected with GIT1, ßPIX and wild-type PAK. *P<0.005. (I) A431 cells were cotransfected with PIX and PAK. Endogenous GIT proteins (GITe, green) colocalized with transfected PIX (red) at cytoplasmic structures. Bar, 25 µm.

 

ßPIX is involved in p95-C2-induced neurite inhibition
Our results indicate that binding of ßPIX to GIT1 is required for the recruitment of the complex to TfR-positive structures (Fig. 3). A role of the GIT1 complex in growth cone motility has recently been demonstrated in primary retinal neurons. Expression of p95-C2 induces inhibition of neurite extension and accumulation of the GIT1 complex at Rab11-positive structures (Albertinazzi et al., 2003Go). Similar results were obtained by expressing the monomeric p95-C2-LZ mutant (Fig. 10J). Here, we have used retinal neurons to further explore the role of ßPIX and GIT1 in neurite extension. Expression of dimeric or monomeric ßPIX mutants per se did not affect the formation of long neurites (Fig. 9). We then analyzed the effects of the co-expression of the ßPIX constructs with either dimeric or monomeric p95-C2 on neurites and on the subcellular localization of the ßPIX/GIT1 complexes (Fig. 10). When co-expressed with dimeric p95-C2, all ßPIX mutants colocalized with p95-C2 at the endocytic structures (Fig. 10A-C,F,H), and resulted in inhibition of neurite extension (Fig. 10J). We then tested the co-expression of ßPIX mutants with monomeric p95-C2-LZ. Interestingly, monomeric PIX-PG-{Delta}LZ (with mutated SH3/PAK-binding site) and p95-C2-LZ showed a diffuse distribution, and resulted in neurons with normal neurites (Fig. 10D,J). The ability of monomeric ßPIX-PG-{Delta}LZ to prevent p95-C2-LZ-induced neurite inhibition and the formation of endocytic structures was specific, since co-expression of other monomeric ßPIX mutants such as ßPIX-{Delta}PH-{Delta}LZ (Fig. 10I,J) and ßPIX-{Delta}LZ (not shown) with monomeric p95-C2-LZ resulted in the formation of endocytic structures, and strong neurite inhibition. These findings suggest that heterodimers formed by monomeric ßPIX and p95-C2 partners are still able to induce the large structures when an intact SH3 domain is present in ßPIX. Therefore, the SH3 domain of ßPIX and ßPIX-mediated hetero-oligomerization may be implicated in the regulation of GIT1 localization and function during neuritogenesis. ßPIX-PG-{Delta}LZ, unable to bind PAK, binds monomeric p95-C2-LZ and would act as a dominant negative mutant on the formation of the endocytic structures. Accordingly, also monomeric ßPIX-C-{Delta}LZ prevented p95-C2-LZ-induced formation of cytoplasmic structures and neurite inhibition (Fig. 10G,J). This construct included just the region of ßPIX required for GIT1 binding (Fig. 7A), and could act as a dominant negative, similar to ßPIX-PG-{Delta}LZ.


Figure 10
View larger version (50K):
[in this window]
[in a new window]
 
Fig. 10. Co-expression of ßPIX and GIT1-derived constructs in retinal neurons. (A-I) Retinal neurons were fixed 1 day after transfection or cotransfection, and the indicated transfected constructs were detected by immunofluorescence. Bars, 5 µm. (J) Transfected neurons were utilized to quantify the effects on neurite extension. Each bar represents the average percentage obtained from two experiments for each condition; 50 neurons were analyzed in each experiments (total of 100 neurons per condition). (K) Evaluation of the percentages of neurons with long neurites and of neurons with large cytoplasmic structures in neurons transfected with the indicated constructs: 100 neurons per condition were evaluated.

 

Figure 9
View larger version (35K):
[in this window]
[in a new window]
 
Fig. 9. Expression of ßPIX constructs in retinal neurons. (A) Immunofluorescence for overexpressed ßPIX on E6 retinal neurons transfected with different ßPIX mutants. Bar, 5 µm. (B) Quantification of the effects of the expression of different ßPIX constructs in retinal neurons. Each bar represents the average percentage obtained from two experiments for each condition; 50 neurons were analyzed in each experiments (total of 100 neurons per condition).

 

The correlation between the formation of endocytic structures and neurite inhibition (Fig. 10K) supports the hypothesis that blocking membrane recycling by mutant ßPIX/GIT1 complexes directly affects neurite extension.


    Discussion
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
In this study we have shown the inhibitory effects of an ArfGAP-deficient mutant on growth factor-induced motogenic responses. Growth factors such as EGF and PDGF provide motogenic stimuli, by enhancing the ruffling activity and lamellipodia formation at the periphery of the cell (Ullrich and Schlessinger, 1990Go). In A431 cells stimulated by EGF, actin dynamics at the cell periphery is mediated by the activation of Rho family GTPases. Rac and Cdc42 (Kurokawa et al., 2004Go), and is accompanied by massive membrane internalization (Haigler et al., 1979Go). Membrane recycling back to the cell surface must accompany EGF-induced membrane internalization to avoid rounding up of the cell. The observed accumulation upon EGF stimulation of endocytic structures in the perinuclear region of cells expressing an ArfGAP-deficient GIT1 is consistent with the hypothesis that this mutant interferes with the recycling of membranes back to the cell surface. According to this hypothesis, we observed inhibition of lamellipodia formation and cell retraction in transfected cells accumulating perinuclear vesicles in response to EGF. Given the proposed role of GIT1 as an Arf6 GAP in vivo (Albertinazzi et al., 2003Go; Vitale et al., 2000Go), we would like to speculate that the observed accumulation of internalized membranes upon EGF stimulation in cells expressing the ArfGAP-deficient GIT1 mutant could be a consequence of hindering the Arf6-mediated trafficking between the endosomal compartment and the plasma membrane (Peters et al., 1995Go; Radhakrishna et al., 1996Go).

The results indicate that a protein binding to the SHD domain of GIT1 is required for the formation of the endocytic structures upon EGF stimulation. Three proteins have so far been identified as binding partners of the SHD domain of GIT proteins: the exchange factor PIX (Bagrodia et al., 1999Go; Turner et al., 1999Go), the tyrosine kinase FAK (Zhao et al., 2000Go), and the presynaptic cytomatrix protein Piccolo (Kim et al., 2003Go). Piccolo is unlikely to be involved in the observed effects, since it is expressed in the nervous system, and is involved in the organization of synaptic sites (Cases-Langhoff et al., 1996Go; Fenster et al., 2000Go). Moreover, we have not been able to reproduce the interaction between FAK and GIT1 in our system (data not shown). Therefore, PIX remains the most likely known candidate for the regulation of GIT1 recruitment at membranes in our system. This hypothesis is supported by the finding that most of the endogenous PIX is found in complex with the endogenous GIT in COS7 cells (Botrugno et al., 2006Go).

The role of ßPIX in the recruitment of GIT1 at membranes is indicated by the induction of association of GIT1 at endocytic structures induced by overexpression of ßPIX. Both the SH3 domain and dimerization of ßPIX are involved in the formation of the large cytoplasmic structures. Inhibition of the formation of these structures by the PAK-Pbd polypeptide interfering with binding of endogenous proteins to the ßPIX SH3 domain suggests that PAK is required in the process, although the involvement of other PIX-SH3 binding partners can not be ruled out at this point (Feng et al., 2004Go).

Multimeric complexes, including dimeric GIT1 and ßPIX, have been previously reported (Kim et al., 2003Go; Paris et al., 2003Go; Premont et al., 2004Go). The role of these complexes is not clear. Since GIT1 is a regulator of Arf6 and has been found to specifically localize at endocytic structures derived from the recycling compartment, one hypothesis is that it is part of a protein coat assembled at endocytic membranes to regulate Arf6-mediated membrane recycling. In this respect, the large cytoplasmic structures induced by overexpression of GIT1 and ßPIX are probably caused by the dysregulation of the cellular levels of the two proteins, leading to overproduction of multimeric components that would artifactually, but specifically, sequester membranes with endogenous transferrin receptors.

Interestingly, immunoelectron microscopy analysis has shown here that the alteration of the levels of endogenous ßPIX/GIT1 complexes leads to the formation of electron-dense aggregates including both GIT1 and the transmembrane endogenous TfR. This finding, together with our recent finding that most endogenous ßPIX is found stably associated with membranes together with endogenous GIT1 in cells (Botrugno et al., 2006Go) suggests that levels of the ßPIX/GIT1 complexes need to be finely regulated in the cell, and that alterations in this direction may lead to clustering that may compromise cell function. Accordingly, it has recently been shown that GIT1 interacts with huntingtin and enhances huntingtin aggregation by recruitment of the protein into membranous structures (Goehler et al., 2004Go). Interestingly, GIT1 was localized to neuronal inclusions in Huntington disease patients. Moreover, biochemical analysis has shown that a carboxy-terminal fragment of GIT1 is selectively accumulated in brains of patients with Huntington disease, and this may be a significant factor in the pathogenesis of the disease.


    Materials and Methods
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Plasmid constructs, cell culture and cell transfection
Plasmids pFLAG–p95 (full length avian GIT1), pFLAG–p95-N, pFLAG–p95-C, pFLAG–p95-C2 and pFLAG-LacZ (Di Cesare et al., 2000Go), pFLAG-p95-C2-LZ, pXJ40-HA-ßPIX-C and PXJ40-HA-ßPIX-C-LZ (Paris et al., 2003Go), pXJ40-HA-ßPIX-PG, pXJ40-HA-ßPIX-PG{Delta}LZ (de Curtis and Paris, 2005Go), pCMV6m–Pak1 encoding Myc-tagged Pak1 (Bokoch et al., 1998Go), and pXJ40–HA–ßPIX encoding haemagglutinin (HA)-tagged ßPIX polypeptide (Manser et al., 1998Go) were obtained as previously described. ßPIX mutants were derived from pXJ40-HA-ßPIX. The pXJ40-HA-ßPIX-{Delta}LZ plasmid was prepared by digesting pXJ40-HA-ßPIX with HindIII and BglII, and by ligation of the paired oligonucleotides deltaLZ1 (AGCTTACTGCACAAGTGCAAAGACGAGGCAGACCCTGAACTCAAGTTCACGCAAAGAGTCTGCTCCACAAGTGCCCGGGTAGA) and deltaLZ2 (GATCTCTACCCGGGCACTTGTGGAGCAGACTCTTTGCGTGAACTTGAGTTCAGGGTCTGCCTCGTCTTTGCACTTGTGCAGTA) to introduce a stop codon. The procedure to obtain plasmid pXJ40-HA-ßPIX-{Delta}PH-{Delta}LZ, was the same as the one described to obtain pXJ40-HA-ßPIX-{Delta}LZ, but starting from pXJ40-HA-ßPIX-{Delta}PH. The pXJ40-HA-ßPIX-{Delta}PH plasmid was obtained by PCR on pXJ40-HA-ßPIX with the oligonucleotides PIX{Delta}PH5 (GGGGTACCTCTGTGAGCAACCCCACC) and PIX{Delta}PH3 (GGGGTACCACTGCCCAACGTCTTTATG). The pCMV6M-MYC-PAK-Pbd plasmid coding for amino acid 150-250 of PAK1 was obtained by PCR with primers PIXbd5 (CGGGATCCGCTGAGGATTACAATTCTTCTAATG) and PIXbd3 (CGGAATTCCTAAGACATTTTAGGCTTCTTCTTCTGC), and insertion of the PCR fragment into the pCMV6M-MYC vector digested with BamHI and EcoRI. GFP (green fluorescent protein)-labelled constructs p95-GFP, p95-C2-GFP and p95-C-GFP were obtained by cloning the full length avian GIT1, the carboxy-terminal fragments p95-C2 (amino acid 229-740) and p95-C (amino acids 347-740) into the pEGFP-N1 vector (BD-Biosciences-Clontech, Rookville, MD).

A431 and COS7 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) with 10% foetal bovine serum (Hyclone, Logan, UT). Chicken embryo fibroblasts (CEFs) from E10 chick embryos were cultured in DMEM with 5% foetal bovine serum, 1% chicken serum. CEFs and COS7 cells were transfected with Dosper (Roche, Mannheim, Germany) and lipofectamine (Invitrogen AG, Basel, Switzerland), respectively; A431 cells were transfected with FuGENE 6 (Roche, Mannheim, Germany).

Culture and transfection of primary neurons
Neural retinal cells were prepared from E6 chick neural retinas and cultured on 0.2 mg/ml poly-D-lysine and 40 µg/ml laminin-1 (Albertinazzi et al., 1998Go). For transfection by electroporation, retinal cells were resuspended in cytomix pH 7.6 (120 mM KCl, 0.15 mM CaCl2, 10 mM K2HPO4/KH2PO4, 25 mM HEPES, 2 mM EGTA, 5 mM MgCl2) to a final concentration of 65x106 cells per ml. 200 µl cell suspension were placed in a Gene Pulser Cuvette (Bio-Rad) and 50 µg of plasmid were added (40 µg of each plasmid in cotransfection experiments). After an incubation on ice for 5 minutes, cuvettes were subjected to two sequential pulses at 0.4 KV and 125 µF, resuspended in 10 ml serum-free retinal growth medium, and plated on poly-L-lysine- and laminin-coated coverslips. Cells were cultured for 20-24 hours at 37°C, 5% CO2, and fixed for immunofluorescence staining. Quantification of the effects of the overexpression of the constructs in retinal neurons was made by examining transfected, neurofilament-positive neurons, or cotransfected neurons. For each type of transfection, at least 50 neurons were examined morphologically from at least two distinct experiments (total of 100 neurons/experimental condition). Long neurites were equal to or longer than three cell body diameters, short neurites were shorter than three cell body diameters.

Antibodies and reagents
Antibodies used in this study included: polyclonal antibodies anti-FLAG (Sigma Aldrich, St Louis, MO), anti-HA-11 (BabCO, Richmond, CA); monoclonal antibodies anti-FLAG M5 (Sigma Aldrich), anti-HA 12CA5, anti-Myc 9E10 (Primm, Milano, Italy), anti-PKL/GIT1 (BD Transduction Laboratories), anti-transferrin receptor (TfR) (Zymed), anti-vimentin (clone V9, Sigma Aldrich). The polyclonal anti-PIX antibody was raised against the amino-terminal portion of ßPIX. A cDNA fragment corresponding to amino acid residues 1-391 of rat ßPIX was obtained by PCR, and cloned into the pGEX4T3 vector (Amersham Biosciences AB, Uppsala, Sweden). The fusion protein between glutathione S-transferase (GST) and residues 1-391 of rat ßPIX was expressed in E. coli and purified for injection into rabbits. The antibody specifically recognized endogenous PIX and overexpressed ßPIX, as detected by western blotting and immunoprecipitation (data not shown). Holo-Tf and Y-27632 were from Sigma-Aldrich. EGF was from Upstate Biotechnology, NY.

Immunoprecipitation, western blotting and protein determination
Cells were lysed in lysis buffer (20 mM Tris-HCl at pH 7.5, 150 mM NaCl, 0.5% Triton X-100, 0.5 mM PMSF, 1 mM sodium orthovanadate, 10 mM sodium fluoride) for 15 minutes on ice. For immunoprecipitation, equal amounts of protein were incubated for 2-3 hours at 4°C with the indicated antibodies coupled to protein A-Sepharose (Amersham Biosciences, Piscataway, NJ). After washing with lysis buffer with 0.1% Triton X-100, samples were boiled in sample buffer, blotted onto nitrocellulose membranes (Schleicher & Schuell BioScience, Dassel, Germany) and probed with the indicated antibodies. Proteins were visualized with 125I-coupled secondary antibodies or protein A, and exposed to Amersham Hyperfilm-MP (Amersham). Protein determination was by Bio-Rad Protein Assay (Bio-Rad, Munich, Germany).

Immunofluorescence, confocal microscopy and quantification
Transfected cells cultured on glass coverslips (BDH) were fixed with 3% paraformaldehyde, permeabilized with 0.1% Triton X-100, and processed for immunofluorescence. For vimentin staining, cells were fixed with methanol at –20°C. Fluorescent images were collected using the Image-Pro® Plus software package (Media Cybernetics, L.P., Silver Spring, MD). Confocal microscopy was performed on the Leica TCS SP2. For multichannel imaging, fluorescent dyes were imaged sequentially in frame-interlace mode to eliminate cross talk between the channels. FITC and Alexa Fluor 488 were excited with a 488-nm ArKr laser line, TRITC, Alexa Fluor 568 and Alexa Fluor 546 were excited with a 543-nm HeNe laser line. Secondary antibodies for immunofluorescence were from Molecular Probes (Eugene, OR), and Jackson Immunoresearch Laboratories (West Grove, PA). Images were processed using AdobePhotoshop® 6 (Adobe Systems Incorporated, Seattle, WA). For quantification of the GIT1-positive structures, at least 200 cells were examined for each experimental condition. Values given are the means from two to four different experiments.

Electron microscopy and immunofluorescence on thin sections
For immunogold labelling, COS7 cells transfected with pFLAG–p95 and/or pXJ40-HA-ßPIX were fixed 48-72 hours after transfection with 2% paraformaldehyde/1% acroleine in PBS, for 2 hours at room temperature, and processed for ultrathin cryosectioning as previously described (Confalonieri et al., 2000Go). Single and double immunogold labelling was performed on 60 nm thick ultrathin cryosections as described previously (Slot et al., 1991Go), using polyclonal antibodies to FLAG (Sigma Aldrich, St Louis, MO) either alone, or in combination with mAbs to TfR (Zymed Laboratories, San Francisco, CA). Alternatively, 200 nm thick cryosections were placed on glass slides and double labelled for FLAG and TfR by immunofluorescence, and counterstained with DAPI to identify nuclei.

Internalization of fluorescently labelled transferrin
A431 cells grown on glass coverslips were serum starved for 2-3 hours, briefly washed with buffer A (137 mM NaCl, 3 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 20 mM Hepes-NaOH, pH 7.4, freshly added 20 mM glucose and 2 mg/ml bovine serum albumin), and incubated for 1 hour with 60 µg/ml of Alexa Fluor 488-labelled Tf (Molecular Probes) in buffer A. Cells were cooled on ice, and excess Tf was removed by washing with ice-cold PBS and low-pH buffer (150 mM sodium chloride, 10 mM acetic acid, pH 3.5). The two washes were repeated twice. The cells were then either fixed or chased at 37°C for 2 hours in buffer A with 6 mg/ml holo-Tf. After the chase, cells were washed twice with ice-cold PBS and fixed. After fixation with 3% paraformaldehyde, cells were processed for indirect immunofluorescence, and permeabilized with 0.05% saponin during the incubation with antibodies.

Time-lapse videomicroscopy
To analyse the behaviour of transfected cells upon stimulation with epithelial growth factor (EGF), A431 cells were cultured on glass coverlips for 24 hours and transfected for 18 hours with pEGFP-GIT1, pEGFP-p95-C2, pEGFP-p95-C, or pEGFP plasmids. Cells were serum starved for 4-8 hours before Y-27632 and/or EGF stimulation. For time-lapse videomicroscopy, each coverslip was observed with a Zeiss Axiovert 135 TV microscope equipped with an Orca II CCD digital camera (Hamamatsu, Hamamatsu City, Japan), or with a Olympus IX 70 Deltavision equipped with a Cool SNAP HQ digital camera (Photometrix, Kew, Australia). Photographs were taken at 10- to 120-second intervals, both before and after the addition of 100-200 ng/ml of EGF and/or 10 µM Y-27632 in buffer A. Images were analysed by the Image Pro Plus software (Media Cybernetics, Silver Spring, MD).


    Acknowledgments
 
The financial support of Telethon-Italy (grant no. GGP05051), FIRB (grant no. RBNE01WY7P), and of the European Union (MAIN Network of Excellence, FP6-502935) to I.dC., and of MIUR (Minister for University and Research) to C.T. is gratefully acknowledged. We thank Barbara Sporchia for helping in the preparation of the plasmids for the PIX mutants, and Cesare Covino and Mariacarla Panzeri (ALEMBIC, Universita' Vita e Salute San Raffaele, Milano) for help with time-lapse experiments and electron microscopy, respectively. Electron microscopy studies were also performed at the Telethon Facility for EM, Genova, Italy (Grant GTF03001 to C.T.).


    Footnotes
 
* Present address: Department of Neuroscience, S. Raffaele Scientific Institute, Milan, Italy Back


    References
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 

Albertinazzi, C., Gilardelli, D., Paris, S., Longhi, R. and de Curtis, I. (1998). Overexpression of a neural-specific rho family GTPase, cRac1B, selectively induces enhanced neuritogenesis and neurite branching in primary neurons. J. Cell Biol. 142, 815 -825.[Abstract/Free Full Text]

Albertinazzi, C., Za, L., Paris, S. and de Curtis, I. (2003). ARF-6 and a functional PIX/p95-APP1 complex are required for Rac1B-mediated neurite outgrowth from retinal neurons. Mol. Biol. Cell 14, 1295-1307.[Abstract/Free Full Text]

Bagrodia, S., Taylor, S. J., Jordan, K. A., Van Aelst, L. and Cerione, R. A. (1998). A novel regulator of p21-activated kinases. J. Biol. Chem. 273, 23633-23636.[Abstract/Free Full Text]

Bagrodia, S., Bailey, D., Lenard, Z., Hart, M., Guan, J. L., Premont, R. T., Taylor, S. J. and Cerione, R. A. (1999). A tyrosine-phosphorylated protein that binds to an important regulatory region on the cool family of p21-activated kinase-binding proteins. J. Biol. Chem. 274, 22393-22400.[Abstract/Free Full Text]

Botrugno, O. A., Paris, S., Za, L., Gualdoni, S., Cattaneo, A., Bachi, A. and de Curtis, I. (2006). Characterization of the endogenous GIT1-ßPIX complex, and identification of its association to membranes. Eur. J. Cell Biol. 85, 35-46.[CrossRef][Medline]

Bretscher, M. S. and Aguado-Velasco, C. (1998). EGF induces recycling membrane to form ruffles. Curr. Biol. 8, 721-724.[CrossRef][Medline]

Bokoch, G. M. (2003). Biology of the p21-activated kinases. Annu. Rev. Biochem. 72, 743-781.[CrossRef][Medline]

Bokoch, G. M., Reilly, A. M., Daniels, R. H., King, C. C., Olivera, A., Spiegel, S. and Knaus, U. G. (1998). A GTPase-independent mechanism of p21-activated kinase activation. Regulation by sphingosine and other biologically active lipids. J. Biol. Chem. 273, 8137-8144.[Abstract/Free Full Text]

Cases-Langhoff, C., Voss, B., Garner, A. M., Appeltauer, U., Takei, K., Kindler, S., Veh, R. W., De Camilli, P., Gundelfinger, E. D. and Garner, C. C. (1996). Piccolo, a novel 420 kDa protein associated with the presynaptic cytomatrix. Eur. J. Cell Biol. 69, 214-223.[Medline]

Confalonieri, S., Salcini, A. E., Puri, C., Tacchetti, C. and Di Fiore, P. P. (2000). Tyrosine phosphorylation of Eps15 is required for ligand-regulated, but not constitutive, endocytosis. J. Cell Biol. 150, 905-912.[Abstract/Free Full Text]

D'Souza-Schorey, C., Li, G., Colombo, M. I. and Stahl, P. D. (1995). A regulatory role for ARF6 in receptor-mediated endocytosis. Science 267, 1175-1178.[Abstract/Free Full Text]

de Curtis, I. (2001). Cell migration: GAPs between membrane traffic and the cytoskeleton. EMBO Rep. 2, 277-281.[CrossRef][Medline]

de Curtis, I. and Paris, S. (2005). Assay and properties of the GIT1/p95-APP1 ArfGAP. Methods Enzymol. 404, 267-278.[Medline]

Di Cesare, A., Paris, S., Albertinazzi, C., Dariozzi, S., Andersen, J., Mann, M., Longhi, R. and de Curtis, I. (2000). p95-APP1 links membrane transport to Rac-mediated reorganization of actin. Nat. Cell Biol. 2, 521-530.[CrossRef][Medline]

Donaldson, J. G. (2003). Multiple roles for ARF6: sorting, structuring, and signaling at the plasma membrane. J. Biol. Chem. 278, 41573-41576.[Free Full Text]

Feng, Q., Baird, D. and Cerione, R. A. (2004). Novel regulatory mechanisms for the Dbl family guanine nucleotide exchange factor Cool-2/alpha-Pix. EMBO J. 23, 3492-3504.[CrossRef][Medline]

Fenster, S. D., Chung, W. J., Zhai, R., Cases-Langhoff, C., Voss, B., Garner, A. M., Kaempf, U., Kindler, S., Gundelfinger, E. D. and Garner, C. C. (2000). Piccolo, a presynaptic zinc finger protein structurally related to bassoon. Neuron 25, 203-214.[CrossRef][Medline]

Garcia-Mata, R., Gao, Y. S. and Sztul, E. (2002). Hassles with taking out the garbage: aggravating aggresomes. Traffic 3, 388-396.[CrossRef][Medline]

Goehler, H., Lalowski, M., Stelzl, U., Waelter, S., Stroedicke, M., Worm, U., Droege, A., Lindenberg, K. S., Knoblich, M., Haenig, C. et al. (2004). A protein interaction network links GIT1, an enhancer of huntingtin aggregation, to Huntington's disease. Mol. Cell 15, 853-865.[CrossRef][Medline]

Haigler, H. T., McKanna, J. A. and Cohen, S. (1979). Rapid stimulation of pinocytosis in human carcinoma cells A-431 by epidermal growth factor. J. Cell Biol. 83, 82-90.[Abstract/Free Full Text]

Hopkins, C. R., Gibson, A., Shipman, M., Strickland, D. K. and Trowbridge, I. S. (1994). In migrating fibroblasts, recycling receptors are concentrated in narrow tubules in the pericentriolar area, and then routed to the plasma membrane of the leading lamella. J. Cell Biol. 125, 1265-1274.[Abstract/Free Full Text]

Kim, S., Lee, S. H. and Park, D. (2001). Leucine zipper-mediated homodimerization of the p21-activated kinase-interacting factor, ßPIX. Implication for a role in cytoskeletal reorganization. J. Biol. Chem. 276, 10581-10584.[Abstract/Free Full Text]

Kim, S., Ko, J., Shin, H., Lee, J. R., Lim, C., Han, J. H., Altrock, W. D., Garner, C. C., Gundelfinger, E. D., Premont, R. T. et al. (2003). The GIT family of proteins forms multimers and associates with the presynaptic cytomatrix protein piccolo. J. Biol. Chem. 278, 6291-6300.[Abstract/Free Full Text]

Ko, J., Kim, S., Valtschanoff, J. G., Shin, H., Lee, J. R., Sheng, M., Premont, R. T., Weinberg, R. J. and Kim, E. (2003). Interaction between Liprin-{alpha} and GIT1 is required for AMPA receptor targeting. J. Neurosci. 23, 1667-1677.[Abstract/Free Full Text]

Kurokawa, K., Itoh, R. E., Yoshizaki, H., Nakamura, Y. O. and Matsuda, M. (2004). Coactivation of Rac1 and Cdc42 at lamellipodia and membrane ruffles induced by epidermal growth factor. Mol. Biol. Cell 15, 1003-1010.[Abstract/Free Full Text]

Manser, E., Loo, T. H., Koh, C. G., Zhao, Z. S., Chen, X. Q., Tan, L., Tan, I., Leung, T. and Lim, L. (1998). PAK kinases are directly coupled to the PIX family of nucleotide exchange factors. Mol. Cell 1, 183-192.[CrossRef][Medline]

Matafora, V., Parism, S., Dariozzi, S. and de Curtis, I. (2001). Molecular mechanisms regulating the subcellular localization of p95-APP1 between the endosomal recycling compartment and sites of actin organization at the cell surface. J. Cell Sci. 114, 4509-4520.[Medline]

Nie, Z., Hirsch, D. S. and Randazzo, P. A. (2003). ARF and its many interactors. Curr. Opin. Cell Biol. 15, 396-404.[CrossRef][Medline]

Paris, S., Longhi, R., Santambrogio, P. and de Curtis, I. (2003). Leucine-zipper-mediated homo- and hetero-dimerization of GIT family p95-ARF GTPase-activating protein, PIX-, paxillin-interacting proteins 1 and 2. Biochem. J. 372, 391-398.[CrossRef][Medline]

Peters, P. J., Hsu, V. W., Ooi, C. E., Finazzi, D., Teal, S. B., Oorschot, V., Donaldson, J. G. and Klausner, R. D. (1995). Overexpression of wild-type and mutant ARF1 and ARF6: distinct perturbations of nonoverlapping membrane compartments. J. Cell Biol. 128, 1003-1017.[Abstract/Free Full Text]

Premont, R. T., Claing, A., Vitale, N., Freeman, J. L., Pitcher, J. A., Patton, W. A., Moss, J., Vaughan, M. and Lefkowitz, R. J. (1998). Beta2-Adrenergic receptor regulation by GIT1, a G protein-coupled receptor kinase-associated ADP ribosylation factor GTPase-activating protein. Proc. Natl. Acad. Sci. USA 95, 14082-14087.[Abstract/Free Full Text]

Premont, R. T., Claing, A., Vitale, N., Perry, S. J. and Lefkowitz, R. J. (2000). The GIT family of ADP-ribosylation factor GTPase-activating proteins. Functional diversity of GIT2 through alternative splicing. J. Biol. Chem. 275, 22373-22380.[Abstract/Free Full Text]

Premont, R. T., Perry, S. J., Schmalzigaug, R., Roseman, J. T., Xing, Y. and Claing, A. (2004). The GIT/PIX complex: an oligomeric assembly of GIT family ARF GTPase-activating proteins and PIX family Rac1/Cdc42 guanine nucleotide exchange factors. Cell. Signal. 16, 1001-1011.[Medline]

Radhakrishna, H., Klausner, R. D. and Donaldson, J. G. (1996). Aluminum fluoride stimulates surface protrusions in cells overexpressing the ARF6 GTPase. J. Cell Biol. 134, 935-947.[Abstract/Free Full Text]

Slot, J. W., Geuze, H. J., Gigengack, S., James, D. E. and Lienhard, G. E. (1991). Translocation of the glucose transporter GLUT4 in cardiac myocytes of the rat. Proc. Natl. Acad. Sci. USA 88, 7815-7819.[Abstract/Free Full Text]

Turner, C. E., Brown, M. C., Perrotta, J. A., Riedy, M. C., Nikolopoulos, S. N., McDonald, A. R., Bagrodia, S., Thomas, S. and Leventhal, P. S. (1999). Paxillin LD4 motif binds PAK and PIX through a novel 95-kD ankyrin repeat, ArfGAP protein: a role in cytoskeletal remodeling. J. Cell Biol. 145, 851-863.[Abstract/Free Full Text]

Turner, C. E., West, K. A. and Brown, M. C. (2001). Paxillin-ARF GAP signaling and the cytoskeleton. Curr. Opin. Cell Biol. 13, 593-599.[CrossRef][Medline]

Ullrich, A. and Schlessinger, J. (1990). Signal transduction by receptors with tyrosine kinase activity. Cell 61, 203-212.[CrossRef][Medline]

Vitale, N., Patton, W. A., Moss, J., Vaughan, M., Lefkowitz, R. J. and Premont, R. T. (2000). GIT proteins, a novel family of phosphatidylinositol 3,4,5-trisphosphate-stimulated GTPase-activating proteins for ARF6. J. Biol. Chem. 275, 13901-13906.[Abstract/Free Full Text]

Zhao, Z.-S., Manser, E., Loo, T.-H. and Lim, L. (2000). Coupling of PAK-interacting exchange factor PIX to GIT1 promotes focal complex disassembly. Mol. Cell. Biol. 20, 6354-6363.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
K. Missy, B. Hu, K. Schilling, A. Harenberg, V. Sakk, K. Kuchenbecker, K. Kutsche, and K.-D. Fischer
{alpha}PIX Rho GTPase Guanine Nucleotide Exchange Factor Regulates Lymphocyte Functions and Antigen Receptor Signaling
Mol. Cell. Biol., June 1, 2008; 28(11): 3776 - 3789.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
A. Totaro, S. Paris, C. Asperti, and I. de Curtis
Identification of an Intramolecular Interaction Important for the Regulation of GIT1 Functions
Mol. Biol. Cell, December 1, 2007; 18(12): 5124 - 5138.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Za, L.
Right arrow Articles by de Curtis, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Za, L.
Right arrow Articles by de Curtis, I.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?