|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 17 July 2006
doi: 10.1242/jcs.03059
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
1 Centre for Vascular Research, The University of New South Wales and Department of Haematology, The Prince of Wales Hospital
2 Inflammatory Diseases Research Unit, University of New South Wales, Sydney NSW 2052, Australia
* Author for correspondence (e-mail: L.Khachigian{at}unsw.edu.au)
Accepted 18 May 2006
| Summary |
|---|
|
|
|---|
Key words: JUN, siRNA, Gene targeting, Endothelial cells, Retinal neovascularisation
| Introduction |
|---|
|
|
|---|
Recent studies by our group using gene-specific catalytic DNA (DNAzymes) demonstrated a role for the basic region leucine zipper protein and immediate-early gene product, JUN in tumour angiogenesis (Zhang et al., 2004
). JUN, a member of the AP-1 superfamily, is activated by multiple angiogenic stimuli including vascular endothelial growth factor (Zhang et al., 2004
), (basic) fibroblast growth factor-2 (Viard et al., 1993
) and serum (Zhang et al., 2004
). JUN has been linked with neovascular disorders in humans. For example, JUN is expressed in the proliferative membranes of patients with proliferative diabetic retinopathy but not in patients with quiescent retinopathy (Ren et al., 2000
). JUN might also be one of the factors influenced by endostatin in its inhibition of angiogenesis (Abdollahi et al., 2004
).
Small interfering RNAs (siRNAs) provide a new approach to gain insight into the function(s) of the targeted gene in biological systems. siRNAs are RNA duplexes of 21-23 nucleotides (nt) in length that facilitate mRNA destruction in a RISC (RNA-induced silencing complex)-dependent manner (Elbashir et al., 2001
; Hamilton and Baulcombe, 1999
). In the present study, we evaluated the capacity of novel siRNA molecules targeting Jun mRNA to serve as inhibitors of JUN and JUN-dependent gene expression, microvascular endothelial cell proliferation, migration, tubule formation and retinal neovascularisation.
| Results |
|---|
|
|
|---|
|
We next examined the effect of siRNA on bEND-3 proliferation by quantifying cell numbers 2 days following serum stimulation of growth-quiescent cells. bEND-3 proliferation was strongly induced by serum (Fig. 2) and inhibited by the Jun siRNA, whereas siRNAscr did not inhibit at any concentration tested (Fig. 2). Cell counts in the scrambled siRNA cohort were not different from those in the mock-transfected group (Fig. 2). A second siRNA targeting Jun (siRNA2) also inhibited endothelial cell proliferation, whereas its own scrambled counterpart (siRNA2scr) failed to affect cell growth (Fig. 2).
|
|
|
50% (Fig. 5). By contrast, Jun siRNAscr possessed no inhibitory effect on new blood vessel formation within the plug (Fig. 5) indicating again, sequence-specific inhibition by Jun siRNA.
|
|
| Discussion |
|---|
|
|
|---|
JUN, like JUNB and JUND, is a member of the JUN sub-family of dimeric basic region leucine zipper (bZIP) proteins in AP-1. The AP-1 family regulates a plethora of cellular processes, including proliferation, differentiation, apoptosis and survival (Shaulian and Karin, 2002
). Gene transactivation by JUN is mediated by physical interactions with promoter recognition elements (5'-TGAG/CTCA-3'), which are also known as phorbol 12-O-tetradecanoate-13-acetate (TPA) response elements (Angel et al., 1987
) and/or interactions with other factors. JUN proteins are able to form dimers with bZIP proteins, such as for example, members of the CREB-ATF family of proteins and the oncogenic transcription factor Maf. JUN also dimerises with the p65 subunit of NF-
B, Sp1, CBP/p300 (CRE-binding-protein binding protein), SMAD-3 and -4, and retinoblastoma protein (Rb), among others (Chinenov and Kerppola, 2001
). JUN does not necessarily have to bind DNA to influence gene transcription, as has been observed in the human 12(S)-lipoxygenase promoter where Sp1 serves as an anchor protein (Chang and Chen, 2005
). The spectrum of genes influenced by JUN, directly and indirectly, is therefore impressive, and includes those regulating the cell cycle, growth, the extracellular matrix, membrane and cytoskeleton (Vogt, 2001
). The JUN siRNA inhibited gelatinolytic activity corresponding to 72 kDa, the size of pro-MMP-2. Our previous studies using DNAzymes have demonstrated that MMP-2 is a JUN-dependent gene (Zhang et al., 2004
). JUN proteins have been found to regulate MMP-2 transcription (Bergman et al., 2003
). Our inability to detect a smaller migrating species in vitro corresponding to the active form of MMP-2 (59-65 kDa) may reflect the limit of detection of zymography. It is also possible that although these cells produce pro-MMP-2, they may express insufficient levels or lack essential co-factor(s)/enzymes that activate MMP-2 in culture. These co-factor(s) are, nevertheless likely to be present during retinal neovascularisation which is inhibited by cis-9-octadecenoyl-N-hydroxylamide (Fig. 6A) and unlike the in vitro setting, involves a variety of cell types. Indeed, studies have demonstrated that MMP-2, MMP-9 and MT1-MMP are all upregulated in the retina of mice undergoing a neovascular response (Majka et al., 2001
). Previous studies have also demonstrated the appearance of a single band on a zymogram corresponding to the 72 kDa form of MMP-2 (Steinbrenner et al., 2003
). A limitation of this study is that of the plethora of genes JUN controls, the influence of the siRNA on the altered expression of just one metalloproteinase was investigated. Thus, JUN siRNA can inhibit endothelial cell growth and neovascularisation and this may involve suppression of MMP-2 production.
| Materials and Methods |
|---|
|
|
|---|
Western blot analysis
Serum-starved bEND-3 cells transfected twice with siRNA, siRNAscr or mock transfected with vehicle alone were incubated in 10% FBS for the indicated time. The cells were washed in phosphate-buffered saline (PBS), and then harvested into RIPA buffer containing 150 mM NaCl, 50 mM Tris-HCl (pH 7.5), 1% sodium deoxycholate, 0.1% sodium dodecyl sulphate (SDS), 1% Triton X-100, 5 mM EDTA, 1% aprotinin, 2 mM phenylmethyl sulphonyl fluoride (PMSF), followed by two freeze-thaw cycles and centrifugation at 8000 g in a microfuge (Sigma, Germany) for 10 minutes at 4°C to remove cell debris. 2 µg of protein was resolved on 12% polyacrylamide gels and transferred to polyvinylidene fluoride (PVDF) nylon membranes (Millipore, Bedford, MA). The membranes were then probed with rabbit polyclonal antibodies to JUN (1:1000 (0.2 µg/ml), Santa Cruz Biotechnology, CA), MMP-2 (1:1000 (0.2 µg/ml), Santa Cruz Biotechnology, CA) and Sp1 (1:1000 (0.2 µg/ml), Santa Cruz Biotech) in TPBS [0.05% Tween 20 in PBS (v/v)] and incubated with horseradish-peroxidase-conjugated swine-anti rabbit IgG (1:1000, DAKO, Denmark). The protein bands were visualised using the Western Lightning chemiluminescence kit (PerkinElmer Life Sciences, Boston, MA).
RT-PCR
Growth-quiescent bEND-3 cells in 100 mm Petri dishes were transfected with siRNA or siRNAscr and incubated in medium containing 10% serum for the times indicated. Total RNA was prepared using Trizol reagent (Invitrogen). cDNA was generated in 20 µl reactions containing 4 µg total RNA, 200 U Superscript II reverse transcriptase (Invitrogen), 500 µM of each dNTP and 0.5 µg oligo (dT)15 (Invitrogen). PCR analysis was performed in 20 µl reactions containing reverse-transcribed cDNA template, 1 U DNA polymerase (Promega, Annandale, Sydney, Australia), 100 µM of each dNTP, 30 mM MgCl2 (Invitrogen) and 0.1 µM of forward and reverse primer (for JUN: 25 cycles at 95°C 25 seconds, 61°C 30 seconds and 72°C 45 seconds; for MMP-2: 22 cycles of 95°C for 30 seconds, 57°C for 30 seconds and 72°C for 40 seconds). The volume of cDNA template required to achieve equivalent levels of GAPDH (452 bp product) between samples was to amplify JUN cDNA (514 bp amplicon), MMP-2 (445 bp amplicon) or GAPDH (452 bp amplicon). Primers were as follows: JUN (forward primer, 5'-GGAAACGACCTTCTACGACGATG-3'; reverse primer, 5'-GAAGTTGCTGAGGTTGGCGTAGA-3'); MMP-2 (forward primer, 5'-GGGACAAGAACCAGATCACATAC-3'; reverse primer, 5'-CTTCTCAAAGTTGTAGGTGGTGG-3'); GAPDH (forward primer, 5'-ACCACAGTCCATGCCATCAC-3'; reverse primer, 5'-TCCACCACCCTGTTGCTGTA-3').
JUN AP-1-dependent reporter gene expression
The pGL3-prom vector (Promega) was digested with SmaI and double-stranded oligonucleotides (Oligo JUN) (Zhang et al., 2004
) bearing JUN-AP-1 binding sites (GCTTGATGAGATCAGCCGGAAGCTTGATGAGATCAGCCGGAA) were subcloned upstream of the SV40 promoter driving Firefly luciferase. Transient transfections were performed at 70% confluence in 100 mm Petri dishes using FuGENE6 with 15 µg of the reporter construct and either 0.1 or 0.4 µM siRNA. Luciferase activity was determined 24 hours after transfection using the Luciferase assay system (Promega).
Gelatin zymography
Culture supernatants were collected from bEnd-3 cells transfected twice with siRNA as indicated or mock transfected with vehicle alone and resolved (equal amounts of protein per lane) at 4°C on a 10% polyacrylamide gels (with a 4% polyacrylamide stacking gel) containing 1 mg/ml bovine type B gelatin (Sigma). The gel was soaked in 2.5% Triton X-100 (Sigma) for 1 hour then incubated in substrate buffer (50 mM Tris-HCl, 10 mM CaCl2, 0.02% NaN3) overnight at 37°C. The gel was stained in 0.2% Coomassie Blue R-250 (Bio-Rad) in water, methanol and glacial acetic acid at volume ratio (5:4:1) for 1 hour, then destained in H2O:methanol:glacial acetic acid (5:4:1 vol) to reveal clear bands corresponding to protein bands with gelatinolytic activity.
Cell proliferation assay
bEND-3 cells seeded (3x103/well) in 96-well titre plates were rendered growth quiescent by incubation in serum-free medium for 24 hours then transfected with siRNA or siRNAscr and incubated in medium containing 10% serum for 2 days. The cells were harvested by trypsinisation and resuspended in Isoton II (Coulter Electronics, Brookvale, New South Wales, Australia). Cell suspensions were quantified using a Coulter counter (Z series; Coulter Electronics).
bEND-3 scratch-wound assay
Cells (3x104) were seeded into eight-well chambers (Nalgene Nunc International, Copenhagen, Denmark) and grown to 70-90% confluency. Cells were transfected (as indicated) and the monolayers were scraped using a P200 micropipette tip. Two days after wounding, the cells were washed twice in PBS, fixed in 10% paraformaldehyde (vol:vol) and stained in Haematoxylin-Eosin. Cells in the denuded zone (three random fields) were quantified by light microscopy under 100x magnification.
Endothelial tubule formation assay
Tubule formation was determined essentially as previously described (Fahmy et al., 2003
; Zhang et al., 2004
). Briefly, bEND-3 cells grown in 100-mm Petri dishes until 70% confluent were incubated in serum-free medium for 6 hours and transfected with siRNA or siRNAscr. 18 hours later, the cells were trypsinised and resuspended in medium containing 10% serum where 2.6x104 were seeded (in 200 µl) into 96-well plates each containing 100 µl Matrigel (BD Biosciences, MA). Total numbers of tubules per well were assessed at the times indicated by washing the cells with PBS, fixing in 10% paraformaldehyde and quantification under phase-contrast microscopy.
Matrigel plug assay
6- to 8-week-old female C57BL/6 mice were injected subcutaneously (right flanks) with 500 µl of Matrigel containing FGF-2 (0.5 µg) (Sigma, MI), 100 µg siRNA or siRNAscr or no siRNA, and FuGENE6 (2.5 µl) (n=5 mice per group). 14 days later, plugs were resected and fixed in 10% paraformaldehyde. 5 µm cross-sections were stained with Haematoxylin-Eosin. Erythrocyte-containing vessels in the plugs (whose identity as blood vessels was confirmed by immunostaining with CD31) was quantified by light microscopy under 100x magnification and expressed as the mean of three random fields. All animal experiments were approved by the University of New South Wales Animal Care and Ethics Committee.
Murine model of proliferative retinopathy
Postnatal day 6 (P6) C57BL/6 mice were exposed to hyperoxia (75% oxygen) for 4 days in Quantum-Air Maxi-Sealed cages (Hereford, UK) (Smith et al., 1994
). Following hyperoxic exposure, P10 mice were returned to normoxia, anaesthetised (17 mg/kg ketamine and 2.5 mg/kg xylazine) and a bolus intravitreal injection of 20 µg of either Jun siRNA or siRNAscr or no siRNA, in 2 µl saline containing 0.2 µl FuGENE6 (n=6-12 eyes per group) was administered using a 26-gauge bevelled needle attached to a micro-volume syringe (SGE international, Melbourne, Australia). The mice were left at room oxygen for a further 7 days before P17 pup eyes were enucleated and fixed in 10% formalin in PBS. Serial 6 µm cross-sections of whole eyes were cut sagittally, parallel to the optic nerve, and stained with Haematoxylin and Eosin. In experiments using recombinant human TGFß, the siRNA was co-administered with TGFß (0.08 µg) with or without cis-9-octadecenoyl-N-hydroxylamide (Calbiochem) (20 µM) in one bolus delivery. Blood vessels from each group were quantified blind under light microscopy (400x magnification) and expressed as the mean ± s.e.m.
Immunohistochemical analysis
Immunostaining was performed essentially as described (Khachigian et al., 2002
) with rabbit polyclonal MMP-2 and Sp1 antibodies purchased from Santa Cruz Biotechnology, CA.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Abdollahi, A., Hahnfeldt, P., Maercker, C., Grone, H. J., Debus, J., Ansorge, W., Folkman, J., Hlatky, L. and Huber, P. E. (2004). Endostatin's antiangiogenic signaling network. Mol. Cell 13, 649-663.[CrossRef][Medline]
Angel, P., Imagawa, M., Chiu, R., Stein, B., Imbra, R. J., Rahmsdorf, H. J., Jonat, C., Herrlich, P. and Karin, M. (1987). Phorbol ester-inducible genes contain a common cis element recognized by a TPA-modulated trans-acting factor. Cell 49, 729-739.[CrossRef][Medline]
Aye, M. M., Ma, C., Lin, H., Bower, K. A., Wiggins, R. C. and Luo, J. (2004). Ethanol induced in vitro invasion of breast cancer cells: contribution of MMP-2 by fibroblasts. Int. J. Cancer 112, 738-746.[CrossRef][Medline]
Bergman, M. R., Cheng, S., Honbo, N., Piacentini, L., Karliner, J. S. and Lovett, H. H. (2003). A functional activating protein 1 (AP-1) site regulates matrix metalloproteinase 2 (MMP-2) transcription by cardiac cells through interactions with JunB-Fra1 and JunB-FosB heterodimers. Biochem. J. 369, 485-496.[CrossRef][Medline]
Boudreau, N., Andrews, C., Srebrow, A., Ravanpay, A. and Cheresh, D. A. (1997). Induction of the angiogenic phenotype by Hox D3. J. Cell Biol. 139, 257-264.
Chang, W. C. and Chen, B. K. (2005). Transcription factor Sp1 functions as an anchor protein in gene transcription of human 12(S)-lipoxygenase. Biochem. Biophys. Res. Commun. 338, 117-121.[CrossRef][Medline]
Chen, J., Hicks, D., Brantley-Sieders, D., Cheng, N., McCollum, G. W., Qi-Werdich, X. and Penn, J. (2006). Inhibition of retinal neovascularization by soluble EphA2 receptor. Exp. Eye Res. 82, 664-673.[CrossRef][Medline]
Chinenov, Y. and Kerppola, T. K. (2001). Close encounters of many kinds: Fos-Jun interactions that mediate transcription regulatory specificity. Oncogene 20, 2438-2452.[CrossRef][Medline]
Davidson, N. E., Prestigiacomo, L. J. and Hahm, H. A. (1993). Induction of jun gene family members by transforming growth factor alpha but not 17 beta-estradiol in human breast cancer cells. Cancer Res. 53, 291-297.
Elbashir, S. M., Lendeckel, W. and Tuschl, T. (2001). RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev. 15, 188-200.
Emonard, H., Marcq, V., Mirand, C. and Hornebeck, W. (1999). Inhibition of gelatinase A by oleic acid. Ann. N. Y. Acad. Sci. 878, 647-649.
Eyetech (2002). Preclinical and phase 1A clinical evaluation of an anti-VEGF pegylated aptamer (EYE001) for the treatment of exudative age-related macular degeneration. Retina 22, 143-152.[CrossRef][Medline]
Fahmy, R. G., Dass, C. R., Sun, L. Q., Chesterman, C. N. and Khachigian, L. M. (2003). Transcription factor Egr-1 supports FGF-dependent angiogenesis during neovascularization and tumor growth. Nat. Med. 9, 1026-1032.[CrossRef][Medline]
Griggs, J., Skepper, J. N., Smith, G. A., Brindle, K. M., Metcalfe, J. C. and Hesketh, R. (2002). Inhibition of proliferative retinopathy by the anti-vascular agent combretastatin-A4. Am. J. Pathol. 160, 1097-1103.
Hamilton, A. J. and Baulcombe, D. C. (1999). A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286, 950-952.
Iwasaka, C., Tanaka, K., Abe, M. and Sato, Y. (1996). Ets-1 regulates angiogenesis by inducing the expression of urokinase-type plasminogen activator and matrix metalloproteinase-1 and the migration of vascular endothelial cells. J. Cell Physiol. 169, 522-531.[CrossRef][Medline]
Khachigian, L. M., Fahmy, R. G., Zhang, G., Bobryshev, Y. V. and Kaniaros, A. (2002). c-Jun regulates vascular smooth muscle cell growth and neointima formation after arterial injury: inhibition by a novel DNAzyme targeting c-Jun. J. Biol. Chem. 277, 22985-22991.
Kim, B., Tang, Q., Biswas, P. S., Xu, J., Schiffelers, R. M., Xie, F. Y., Ansari, A. M., Scaria, P. V., Woodle, M. C., Lu, P. et al. (2004). Inhibition of ocular angiogenesis by siRNA targeting vascular endothelial growth factor pathway genes: therapeutic strategy for herpetic stromal keratitis. Am. J. Pathol. 165, 2177-2185.
Liao, X., Thrasher, J. B., Pelling, J., Holzbeierlein, J., Sang, Q. X. and Li, B. (2003). Androgen stimulates matrix metalloproteinase-2 expression in human prostate cancer. Endocrinology 144, 1656-1663.
Majka, S., McGuire, P., Colombo, S. and Das, A. (2001). The balance between proteinases and inhibitors in a murine model of proliferative retinopathy. Invest. Ophthalmol. Vis. Sci. 42, 210-215.
Marconcini, L., Marchio, S., Morbidelli, L., Cartocci, E., Albini, A., Ziche, M., Bussolino, F. and Oliviero, S. (1999). c-fos-induced growth factor/vascular endothelial growth factor D induces angiogenesis in vivo and in vitro. Proc. Natl. Acad. Sci. USA 96, 9671-9676.
Ohno-Matsui, K., Uetama, T., Yoshida, T., Hayano, M., Itoh, T., Morita, I. and Mochizuki, M. (2003). Reduced retinal angiogenesis in MMP-2-deficient mice. Invest. Ophthalmol. Vis. Sci. 44, 5370-5375.
Pepper, M. S. (2001). Role of the matrix metalloproteinase and plasminogen activator-plasmin systems in angiogenesis. Arterioscler. Thromb. Vasc. Biol. 21, 1104-1117.
Reich, S. J., Fosnot, J., Kuroki, A., Tang, W., Yang, X., Maguire, A. M., Bennett, J. and Tolentino, M. J. (2003). Small interfering RNA (siRNA) targeting VEGF effectively inhibits ocular neovascularization in a mouse model. Mol. Vis. 9, 210-216.[Medline]
Ren, G., Fuse, N., Abe, T. and Tamai, M. (2000). mRNA expression of proto-oncogenes and platelet-derived growth factor in proliferative vitreoretinal diseases. Jpn. J. Ophthalmol. 44, 308-311.[CrossRef][Medline]
Robinson, G. S., Pierce, E. A., Rook, S. L., Foley, E., Webb, R. and Smith, L. E. (1996). Oligodeoxynucleotides inhibit retinal neovascularization in a murine model of proliferative retinopathy. Proc. Natl. Acad. Sci. USA 93, 4851-4856.
Shaulian, E. and Karin, M. (2002). AP-1 as a regulator of cell life and death. Nat. Cell Biol. 4, E131-E136.[CrossRef][Medline]
Shen, J., Samul, R., Silva, R. L., Akiyama, H., Liu, H., Saishin, Y., Hackett, S. F., Zinnen, S., Kossen, K., Fosnaugh, K. et al. (2006). Suppression of ocular neovascularization with siRNA targeting VEGF receptor 1. Gene Ther. 13, 225-234.[CrossRef][Medline]
Smith, L. E., Wesolowski, E., McLellan, A., Kostyk, S. K., D'Amato, R., Sullivan, R. and D'Amore, P. A. (1994). Oxygen-induced retinopathy in the mouse. Invest. Ophthalmol. Vis. Sci. 35, 101-111.
Steinbrenner, H., Ramos, M. C., Stuhlmann, D., Sies, H. and Brenneisen, P. (2003). UVA-mediated downregulation of MMP-2 and MMP-9 in human epidermal keratinocytes. Biochem. Biophys. Res. Commun. 308, 486-491.[CrossRef][Medline]
Tang, W., Yang, L., Yang, Y. C., Leng, S. X. and Elias, J. A. (1998). Transforming growth factor-beta stimulates interleukin-11 transcription via complex activating protein-1-dependent pathways. J. Biol. Chem. 273, 5506-5513.
Tolentino, M. J., Brucker, A. J., Fosnot, J., Ying, G. S., Wu, I. H., Malik, G., Wan, S. and Reich, S. J. (2004). Intravitreal injection of vascular endothelial growth factor small interfering RNA inhibits growth and leakage in a nonhuman primate, laser-induced model of choroidal neovascularization. Retina 24, 660.[CrossRef][Medline]
Viard, I., Jaillard, C. and Saez, J. M. (1993). Regulation by growth factors (IGF-I, b-FGF and TGF-beta) of proto-oncogene mRNA, growth and differentiation of bovine adrenocortical fasciculata cells. FEBS Lett. 328, 94-98.[CrossRef][Medline]
Vogt, P. K. (2001). Jun, the oncoprotein. Oncogene 20, 2365-2377.[CrossRef][Medline]
Zhang, G., Dass, C. R., Sumithran, E., Di Girolamo, N., Sun, L. Q. and Khachigian, L. M. (2004). Effect of deoxyribozymes targeting c-Jun on solid tumor growth and angiogenesis in rodents. J. Natl. Cancer Inst. 96, 683-696.
This article has been cited by other articles:
![]() |
N. Konishi, K. Shimada, M. Nakamura, E. Ishida, I. Ota, N. Tanaka, and K. Fujimoto Function of JunB in Transient Amplifying Cell Senescence and Progression of Human Prostate Cancer Clin. Cancer Res., July 15, 2008; 14(14): 4408 - 4416. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||