|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 31 January 2006
doi: 10.1242/jcs.02775
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
1 Departments of Pharmacology, Cell and Molecular Physiology, Yale University, New Haven, CT 06520, USA
2 Neurosciences Institute of the Marine Biological Laboratory, Woods Hole, MA 02543, USA
* Author for correspondence (e-mail: barbara.ehrlich{at}yale.edu)
Accepted 1 November 2005
| Summary |
|---|
|
|
|---|
Key words: Androgens, Ca2+ signaling, Inositol, 1,4,5-trisphosphate receptor, Nongenomic response, Neurite outgrowth
| Introduction |
|---|
|
|
|---|
By altering the intracellular Ca2+ concentration in characteristic ways the cell can use the same signaling molecule to specifically regulate different cellular functions (Carafoli et al., 2001
). For example, the rapid turn on and off of Ca2+ signals often produces oscillations. The key quantifiable properties of oscillations are frequency and amplitude, and modulation of either property can control cellular processes (Aizman et al., 2001
; Dolmetsch et al., 1998
; Li et al., 1998
). Initial reports showed that the rapid, steroid-induced Ca2+ increases were single Ca2+ transients (Losel and Wehling, 2003
). More recently, it has been shown in skeletal muscle cells that testosterone induces intracellular Ca2+ oscillations (Estrada et al., 2005
; Estrada et al., 2003
; Estrada et al., 2000
), which may encode more precise information than alterations in the amplitude of a single Ca2+ transient.
An important component of the Ca2+ signaling toolkit which is essential for regulation of Ca2+ oscillations is the inositol 1,4,5-trisphosphate receptor [Ins(1,4,5)P3R], a Ca2+ permeable channel located in the membrane of the endoplasmic reticulum. The Ins(1,4,5)P3R has several properties that make it ideal for modulating oscillatory patterns: Ins(1,4,5)P3-gated channel activity can be regulated by Ca2+ with a bell-shaped dependence (Bezprozvanny et al., 1991
), by a number of Ca2+ binding proteins (Berridge et al., 2003
; Choe et al., 2004
) and by phosphorylation (Tang et al., 2003
). Interestingly, the Ins(1,4,5)P3R is also found inside the nucleus, associated with the nucleoplasmic reticulum (Echevarria et al., 2003
), and this Ins(1,4,5)P3R can release Ca2+ independently of cytoplasmic receptors (Echevarria et al., 2003
; Leite et al., 2003
; Pusl et al., 2002
). It has been suggested that Ca2+ levels in the nucleus are responsible for processes related to gene transcription and cell growth whereas changes in cytoplasmic Ca2+ are used for processes such as secretion and motility.
In this study we found a new pathway for testosterone activity that has a rapid onset and leads to the generation of long lasting Ca2+ oscillations. Within seconds after its addition, testosterone induces intracellular Ca2+ increases in neuroblastoma cells, which begin as Ca2+ transients initiated in the cytosol and propagate as waves of Ca2+ in the cytoplasm and nucleus. These complex Ca2+ signals depend on an interplay between Ins(1,4,5)P3-sensitive stores and influx from the extracellular medium. The Ca2+ transients develop into oscillatory patterns which have been shown to activate specific downstream pathways (Dolmetsch et al., 1998
; Li et al., 1998
). The Ca2+ signals are independent of the iAR and are mediated via a pertussis toxin-sensitive plasma membrane receptor. In addition, we found that testosterone enhanced the neurite outgrowth and an increase in cytosolic Ca2+ was shown to be required for this effect. These results demonstrate an important physiological mechanism for the action of testosterone in parallel, or prior, to androgen receptor-mediated genomic events in neurons.
| Results |
|---|
|
|
|---|
|
The specificity of the response to testosterone was investigated by applying several other steroids. Cortisol, progesterone, or dexamethasone (all at 100 nM) had no effect on intracellular Ca2+ levels (data not shown). Interestingly, 100 nM 17ß-estradiol (Fig. 1F, red line; n=58 of 86 cells, four independent cultures) produced Ca2+ transients whereas at the same concentration the biologically inactive isomer 17
-estradiol (Fig. 1F, green line; n=46 of 46 cells, three independent cultures) did not induce any changes in intracellular Ca2+ levels. To eliminate the possibility that the effects of testosterone were due to the activation of an estrogen receptor pathway, cells were pre-incubated with 1 mM tamoxifen, an antagonist of the estrogen receptor, prior to addition of testosterone. Under these conditions the testosterone-induced Ca2+ oscillations were the same as in the presence of testosterone alone (Fig. 1F, black line, n=28 of 37 cells, three independent cultures), indicating that a functional estrogen receptor is not needed.
Propagation of Ca2+ waves produced by testosterone
Typically the Ca2+ response was initiated in one discrete zone at the tip of the neurite. Then, the Ca2+ transient spread from the point of origin and propagated along the axis of the cell (Fig. 1A). To improve the time resolution of this signaling event we performed linescan experiments (Fig. 1G). The fluorescence intensity was recorded in different regions of the cytosol and nucleus (Fig. 1G). Transient rises in Ca2+ were observed along the dendrite, producing a cytosolic Ca2+ wave that propagated towards the nucleus, into the nucleus, and often to the tip of the opposite dendrite (Fig. 1G,H). The propagation rate of the Ca2+ wave was 11.2±1.8 µm/second (Fig. 1G). For comparison, the diffusion constant (D) of Ca2+ ions in cytosol is estimated to be 13 µm2/second and that for Ins(1,4,5)P3 is 280 µm2/second (Allbritton et al., 1992
).
Cytosolic and nuclear Ca2+ increases induced by testosterone
In order to determine the contribution of cytosolic and nuclear Ca2+ to the global Ca2+ response, Ca2+ was buffered in each compartment separately. To accomplish compartmentalized buffering, we heterologously expressed a fusion protein that contained the Ca2+ buffer parvalbumin (PV) tagged with a red fluorescent protein (DSR) and signal sequences which targeted the fusion protein either to the cytosol or nucleus (Pusl et al., 2002
). Cells were transfected with PV-DSR targeted to nucleus (PV-NLS-DSR), a Ca2+ insensitive form of PV-DSR targeted to nucleus (PV-NLS-CDEF-DSR), or PV-DSR targeted to cytosol (PV-NES-DSR). Western blot analysis of whole cell lysates show the increase in the amount of PV in all three conditions (Fig. 2A-C). The location of DSR and a nuclear stain was used to show that the fusion proteins were expressed in the expected subcellular location (Fig. 2D-F). Basal levels of Ca2+ were not changed in cells expressing PV-NLS-DSR or PV-NES-DSR, relative to control cells, as described previously (Pusl et al., 2002
). Transfection with an empty vector containing DRS did not modify the effects of testosterone (data not shown). Cells transfected with the PV-NLS-DSR did not exhibit any nuclear Ca2+ increase after testosterone exposure, but the cells showed normal cytosolic Ca2+ oscillations (Fig. 2G, n=21 of 21 cells, four independent cultures). To test whether the inhibition of the nuclear Ca2+ signal was due to the Ca2+-chelating properties of PV, cells were transfected with PV-NLS-CDEF-DSR, which has a double mutated EF-hand motif that prevents the protein from binding Ca2+ (Fig. 2H). In cells expressing PV-NLS-CDEF-DSR, the addition of testosterone induced cytosolic and nuclear Ca2+ oscillations (Fig. 2H, n=27 of 27 cells, four independent cultures), showing that the Ca2+-buffering capacity of the PV is required. By contrast, cells expressing PV-NES-DSR did not exhibit any Ca2+ increase in either the cytosol or nucleus (Fig. 2I; n=31 of 31, three independent cultures), indicating that the testosterone-induced Ca2+ increase began in the cytosol and then propagated into the nucleus.
|
Testosterone-induced Ca2+ signals are independent of the intracellular androgen receptor
The iAR is present in neuroblastoma cells suggesting that these cells are a target for the physiological action of testosterone (Maggi et al., 1998
; Yerramilli-Rao et al., 1995
). Using an antibody directed against the N-terminal domain of the human iAR, the iAR was found throughout the cell, but with highest expression in the nucleus (Fig. 3A). In some cells the highest expression of the iAR was at the extreme tip of the neurites (Fig. 3A, upper panel). Upon stimulation with testosterone, the cytosolic iAR translocated to the nucleus after 1 hour, showing that the system was functional (Fig. 3A, lower panel). To evaluate whether the rapid Ca2+ response seen after the addition of testosterone was independent of the iAR, we used both a pharmacological blocker and genetic knock-down of the iAR. Cells transfected with small interfering RNA for the iAR (iAR-siRNA) showed a significantly reduced protein expression. Western blot analysis revealed that iAR-siRNA downregulated the protein by 80% (Fig. 3B,C). Neither the knock-down (Fig. 3D, n=25 of 25 cells, five independent cultures) nor the treatment with the specific inhibitor of the iAR, cyproterone (Fig. 3E, n=29 of 35, four independent cultures), modified the ability of testosterone to induce intracellular Ca2+ oscillations. To evaluate whether the effect of the hormone was mediated by an extracellular membrane receptor, the effect of testosterone covalently bound to albumin (T-BSA) was tested. This compound does not cross the plasma membrane making it unable to act on iAR. The response was similar when cells were exposed to testosterone or T-BSA (100 nM; Fig. 3F, n=32 of 40 cells, four independent cultures). Albumin alone (0.1%) does not produce any change in the intracellular Ca2+ (data not shown). In addition, the peak frequencies calculated from spectral analysis of the Ca2+ oscillations in all three test conditions and untreated cells were similar. Taken together these results indicate that testosterone-induced intracellular Ca2+ oscillations were independent of the iAR-mediated genomic response.
|
Sources of Ca2+ involved in testosterone-induced Ca2+ oscillations
Experiments were done to determine whether the action of testosterone on intracellular Ca2+ was due to an influx of Ca2+ from the extracellular medium and/or mobilization of Ca2+ from intracellular stores. Pre-treatment of the cells with nifedipine (5 µM), a L-type voltage-dependent Ca2+ channel blocker, did not modify the ability of testosterone to induce Ca2+ oscillations (Fig. 4A, n=16 of 19 cells, three independent cultures). When cells were incubated in Ca2+-free medium for 5 minutes prior to testosterone stimulation, the hormone induced a single Ca2+ transient after a delay of 33±14 seconds (n=38 of 72 cells from 12 different cultures). No oscillations were produced under these conditions (Fig. 4B). The response in Ca2+-free medium resembled the first Ca2+ peak generated in Ca2+-containing medium with a similar delay and magnitude of response (compare Fig. 1C with Fig. 4B, 3.2±0.6 and 3.0±0.4 F/F0, Ca2+-containing or Ca2+-free medium, respectively). These results suggest that the testosterone-induced regenerative Ca2+ oscillations require both extracellular and intracellular Ca2+ mobilization. In control experiments, the basal levels of intracellular Ca2+ in cells not treated with the hormone were unaffected by the removal of extracellular Ca2+ during the time of data acquisition (data not shown). In addition, pre-incubation of the cells with Gd3+ (1 µM), a nonspecific plasma membrane Ca2+ channel blocker, in Ca2+ containing medium, suppressed the Ca2+ oscillations without affecting the first Ca2+ peak (Fig. 4C, n=28 of 35, four independent cultures). These results indicate that the extracellular Ca2+ influx was due to activation of plasma membrane Ca2+ channels that are distinct from the L-type voltage-dependent Ca2+ channels. More importantly, extracellular Ca2+ influx is necessary to maintain Ca2+ oscillations in response to testosterone.
|
Depletion of intracellular Ca2+ stores by pre-treating the cells with the endoplasmic reticulum Ca2+-ATPase inhibitor thapsigargin, completely blocked the hormone-triggered Ca2+ response (data not shown, n=25 of 25 cells) indicating that the Ca2+ increase produced by testosterone also required thapsigargin-sensitive intracellular Ca2+ stores. Pre-treatment of neuroblastoma cells with ryanodine, at 20 µM, a concentration known to inhibit the RyR channel (Ehrlich et al., 1994
), had no effect on testosterone-induced Ca2+ oscillations, suggesting that Ca2+ mobilization did not require the RyR (Fig. 4D, n=23 of 23, from four different cultures). By contrast, the testosterone-induced Ca2+ response was completely abolished by the phospholipase C (PLC) inhibitor, U-73122 (Fig. 4E, n=26 of 28, four independent cultures) showing that generation of Ins(1,4,5)P3 is necessary. The amount of Ca2+ in the intracellular stores was not affected by U-73122, as determined by the magnitude of the release after addition of thapsigargin (Fig. 4E). Cells pre-treated with 2-aminoethyl diphenylborate (2-APB; 10 µM), a plasma membrane permeable inhibitor of the Ins(1,4,5)P3R, did not respond to testosterone (data not shown, n=20). To confirm the participation of the Ins(1,4,5)P3R in the testosterone-induced Ca2+ oscillations, two additional types of experiments were done. First, 2-APB was added to testosterone-treated cells that were in the process of producing Ca2+ oscillations. Immediately after 2-APB was applied to the cells, the Ca2+ oscillations were abolished (Fig. 4F, n=12 of 16 cells, from three independent cultures). Second, the amount of Ins(1,4,5)P3R was knocked-down by transiently transfecting the cells with siRNA for the Ins(1,4,5)P3R type 1. This isoform was chosen because the cell line used in these studies (SH-SY5Y) expresses mainly the Ins(1,4,5)P3R type 1 (Wojcikiewicz, 1995
). There was a significant reduction in the imunosignal for the Ins(1,4,5)P3R type 1 in transfected cells (
80%, P<0.05; Fig. 5A,B). Interestingly, we observed two types of Ca2+ response to testosterone in the Ins(1,4,5)P3R type 1 knocked-down cells (Fig. 5C). In one sub-group (n=26 of 46 cells, from five different cultures), the testosterone response was completely abolished. In the other sub-group (n=20 of 46 cells), cells exhibited a fast and transient Ca2+ increase, similar to the peak Ca2+ increase observed in the Ca2+-free medium. However, this peak response was reduced by 68% (P<0.05 compared with the control), as compared with the initial Ca2+ peak in non-transfected cells (Fig. 5D). It is important to note that no Ca2+ oscillations were observed in Ins(1,4,5)P3R type 1 knock-down cells. These results suggest that the loss of functional Ins(1,4,5)P3R impedes the ability of the initial Ca2+ response to trigger a regenerative Ca2+ oscillation. Taken together, these results imply that testosterone-induced intracellular Ca2+ oscillations are the result of the coordinated actions of Ca2+ mobilization from Ins(1,4,5)P3-sensitive Ca2+ stores and Ca2+ influx through plasma membrane Ca2+ channels.
|
A pertussis toxin-sensitive G protein coupled receptor mediates the rapid Ca2+ response to testosterone
Activation of PLC at the plasma membrane could involve either tyrosine kinase or G-protein coupled receptors. To investigate the early events involved in generating the Ca2+ signals produced by addition of testosterone, cells were incubated with genistein (50 µM, 20 minutes), a tyrosine kinase receptor inhibitor. Genistein modified neither the initial intracellular Ca2+ increase nor the Ca2+ oscillations induced by testosterone (Fig. 6A, n=16 of 16, two independent cultures). To test for the involvement of a G-protein-coupled receptor, cells were permeabilized for 5 minutes with saponin in the presence of guanosine 5'-O-(2-thiodiphosphate) (GDPßS; 100 nM), a non-hydrolysable analog of GTP. Permeabilization did not modify testosterone-induced Ca2+ responses (Fig. 6B, dashed line; n=12 of 16 cells, two independent cultures), whereas GDPßS did suppress the Ca2+ increases (Fig. 6B, solid line; n=21 of 21; four different cultures). When cells were pre-incubated with pertussis toxin (PTX, 1 µg/ml, 6 hours) before the addition of testosterone there was no Ca2+ signal produced by the hormone (Fig. 6C n=38 of 38 cells; six different cultures). These results suggest that testosterone action requires PTX-sensitive G-protein coupled receptors to activate PLC and generate Ins(1,4,5)P3 to produce Ca2+ signals.
|
|
| Discussion |
|---|
|
|
|---|
Intracellular Ca2+ oscillations are a common signaling event observed in many cell types (Berridge et al., 2003
). These signaling cascades are not random events, but rather specific signals that depend on the stimuli and the cell type (Aizman et al., 2001
; Dolmetsch et al., 1998
; Estrada et al., 2005
). For example, in the cells we investigated, the initial Ca2+ release never began in the nucleus, implying that the signal needs to propagate through the cell to reach the nucleus. Ca2+ ions have been shown to travel slower than Ins(1,4,5)P3 and generally, Ca2+ does not diffuse more than 1 µm before it is sequestered in the cell (Allbritton et al., 1992
). The distance between the place where the Ca2+ transient began and the nucleus in these cells is approximately 10 µm and hence too long for Ca2+ to travel by simple diffusion. It is also unlikely that the propagated Ca2+ wave in testosterone-treated neuroblastoma cells can be explained purely by diffusion of Ins(1,4,5)P3 because the signal observed traveled 10 µm/second, which is considerably slower than the diffusion constant for Ins(1,4,5)P3 (280 µm2/second). These data suggest that the testosterone-induced Ca2+ wave observed in these experiments is a dynamic consequence of the diffusion of both Ca2+ and Ins(1,4,5)P3.
We found that the oscillatory pattern induced by testosterone exhibits a constant frequency of
20 mHz. The requirement for oscillations, rather than single Ca2+ transients or prolonged elevations in intracellular Ca2+, to encode information has been reported and specific frequencies were shown to activate specific genes (Dolmetsch et al., 1998
; Li et al., 1998
; Sneyd et al., 2004
). Basically, by exploiting the two key features of oscillatory signals - frequency and amplitude - the cell can use Ca2+ as a second messenger to generate a large variety of intracellular signals. This is an efficient way to use the same second messenger to activate many different processes. The testosterone-induced Ca2+ increase was evident in both cytosol and nucleus of neuroblastoma cells. Nuclear Ca2+ signals can directly modify gene expression, fertilization, meiosis and apoptosis (Hardingham et al., 1997
), representing a pivotal connection point between extracellular and intracellular stimuli. Several reports show that nuclear Ca2+ elevations are due to changes in the cytosolic Ca2+ concentration (Genka et al., 1999
) whereas other reports indicate that the nuclear Ca2+ changes can be regulated independently of cytosolic Ca2+ (Leite et al., 2003
). In order to choose between these possibilities we selectively inhibited the Ca2+ signaling in either the nucleus or cytosol by expressing location-specific Ca2+ buffer protein, parvalbumin. Although we cannot rule out testosterone-induced intranuclear Ca2+ release, our data suggests that the response to testosterone is initiated in the cytoplasm and that subsequent Ca2+ signals are generated by diffusion of Ca2+ and Ins(1,4,5)P3 in the cytoplasm and into the nucleus. In addition, aromatase, an enzyme that converts testosterone into the estrogen (17ß-estradiol) has been reported in the CNS and neuroblastoma cells (Wozniak et al., 1998
). We found that 17ß-estradiol but not 17
-estradiol induced Ca2+ signals. The estrogen-induced Ca2+ rises have a different temporal pattern than those measured after addition of testosterone. To rule out the possibility that testosterone acts via the estrogen pathway, experiments were done in the presence of tamoxifen, an antagonist of the intracellular estrogen receptor. As shown in Fig. 1F (black line), the inhibitor did not have any effect on the testosterone-induced Ca2+ oscillations, suggesting that the response was specific for a direct testosterone action and not due to its metabolization to estrogen.
Ca2+ oscillations induced by testosterone only occurred in the presence of extracellular Ca2+. Stimulation of cells in Ca2+-free conditions evoked a localized Ca2+ increase which did not propagate throughout the cell, but resembled the initial peak in Ca2+-containing conditions. Similar results were obtained when Ca2+ was blocked with Gd3+. These findings suggest that the initial Ca2+ rise requires mobilization from internal stores, but Ca2+ influx is required to generate a propagated Ca2+ wave and subsequent Ca2+ oscillations. In several cell models, Ca2+ oscillations have been reported to be initiated by Ins(1,4,5)P3-induced release of Ca2+ from intracellular Ca2+ stores (Aizman et al., 2001
; Berridge et al., 2003
; Estrada et al., 2005
). Maintenance of these waves, however, required Ca2+ influx through Ca2+ channels in the plasma membrane (Sneyd et al., 2004
).
Testosterone exerts its genomic effects through binding to, and activation of, a iAR which translocates to the nucleus and functions as a transcription factor (Beato, 1989
). The iAR translocation from the cytosol to nucleus upon hormone binding is necessary for its activation and subsequent action on transcriptional machinery (Lucas and Granner, 1992
). We found that testosterone-evoked Ca2+ oscillations were not blunted by cyproterone, an antagonist of the iAR, the membrane-impermeant testosterone conjugate (T-BSA) induced effects that were similar to the free hormone, and knock-down of the iAR did not modify the oscillatory pattern induced by testosterone. Taken together, these results suggest that the rapid effects of testosterone are mediated by a receptor restricted to the plasma membrane. Recently, several reports have shown that androgens can activate PTX-sensitive G proteins (Benten et al., 1999b
; Estrada et al., 2003
). We used a pharmacological approach to determine whether testosterone activated G proteins and found evidence to support the involvement of a plasma membrane receptor in this signaling event. The presence of membrane binding sites for androgens has been previously suggested (Estrada et al., 2003
; Lieberherr and Grosse, 1994
), even in macrophages, which lack a classical iAR (Benten et al., 1999b
). Our results expand this concept to a neuronal cell line. Thus, a transient increase in Ca2+ appears to be a response used by many cell types to directly alter cellular processes through a nongenomic pathway, without the need for slower, genomic processes.
A major question about the rapid effects of steroid hormones is whether there is a physiological role for these signals. In neurons, Ca2+ oscillations have been shown to be essential to migration (Spitzer et al., 2000
), differentiation and neurite outgrowth (Gomez and Spitzer, 1999
; Lautermilch and Spitzer, 2000
). Our observations are in agreement with previous studies showing the ability of androgens to increase neurite outgrowth in PC12 cells (Lustig, 1994
) and in motor neuron cells (Marron et al., 2005
). These effects were assumed to be a consequence of activation of the iAR, but the participation of second messenger cascades was not clear. Cytosolic kinase activity, such as PKA and PI 3-kinase, have been shown to be important for the initial steps of neurite elongation in SH-SY5Y cells directly stimulated by addition of a membrane permeable activator of PKA, cyclic AMP (Sanchez et al., 2001
). In addition, it has been reported that stimulation of ERK pathways regulates neuronal growth and survival (Bonni et al., 1999
). Interestingly, in neurons, these kinase pathways can be activated and modulated by intracellular Ca2+ signaling (Doherty et al., 2000
). Thus, Ca2+ oscillations induced by testosterone could represent an early key regulator of these events. To investigate this suggestion, we buffered intracellular Ca2+ signaling in specific locations in the cell. We found that the testosterone-induced elongations of the neurites were inhibited in cells in which the cytosolic Ca2+ was buffered, whereas buffering the nuclear Ca2+ pool inhibited the neurite outgrowth by only 40%. Our data strongly suggest that cytosolic and nuclear Ca2+ increases are critical mechanisms controlling the neurite outgrowth induced by testosterone. Androgens stimulate the differentiation of different neuronal cell types via the activation of the iAR and gene expression (Kelly et al., 1999
). We found that the magnitude of the neurite elongation was less in cells that had been modified to inactivate the iAR pathway than in cells stimulated with testosterone alone. In both cases the neurite elongation was significantly more than in cells that had not been treated with testosterone. These data show that the initial Ca2+ signaling as well as an intact iAR are required to maximize neurite elongation. Nongenomic actions can play a physiological role in events prior to iAR activation. At the cytosolic level, Ca2+ increases stimulate the binding of androgens to their receptors (Cabeza et al., 2004
). Moreover, androgens can activate Ca2+-dependent kinase pathways, such as ERK, PI 3-kinase or Src (Estrada et al., 2003
; Migliaccio et al., 2000
), which could phosphorylate the iAR and enhance its activity. It has also been suggested that both the temporal and spatial changes of the nuclear Ca2+ signal (Echevarria et al., 2003
; Leite et al., 2003
) and cytosolic Ca2+ signal (Dolmetsch et al., 1998
; Li et al., 1998
) are involved in the control of gene expression. Our results lead to the conclusion that the genomic and non-genomic pathways of testosterone action are inter-linked and that a concerted action is required for normal cell function.
In neurons, androgens can induce changes at the cellular level, which can lead to changes in behavior such as sleep, the reaction to stress, mood and memory (Kelly et al., 1999
). Although testosterone is an important neurotrophic and neuroprotective agent, which protects cells against death and injury, it also has its negative side. The concentration of testosterone used in this study (100 nM) is on the high end of the normal range measured in human males. However, a number of physiological circumstances including age, sex, or physical condition, can cause plasma levels to increase, reaching values similar to those studied here (Kelly et al., 1999
; Mooradian et al., 1987
). It is likely then, that the signals we report here correspond to normal responses of the neuronal cells to transient levels of these hormones that may be reached under some particular physiological condition. Testosterone increases aggressive behavior (Kelly et al., 1999
) and high levels have been linked to neuronal apoptosis and cell death (M.E. and B.E.E., unpublished observations). These negative effects of androgens are not limited to motor neurons but extend to many cell types. Surprisingly, these harmful effects of high levels of testosterone can occur rapidly, and may be initiated by a dysregulation of the Ca2+ signals described in this report. With a more global view, these effects of testosterone observed at the single cell level can be shown to have long-term effects at the organ level.
In this study, we found that testosterone induces rapid intracellular Ca2+ increases, which are characterized as propagated Ca2+ waves in the cytosol and nucleus generating oscillatory Ca2+ patterns. The oscillatory nature of the Ca2+ signals depends on a concerted action between the Ins(1,4,5)P3-sensitive intracellular Ca2+ stores and Ca2+ influx from the extracellular medium. Kinetic analysis and nuclear/cytosol-targeted parvalbumin fusion proteins showed that the Ca2+ rise is initiated in the cytosol, principally in the tip of the neurite, and then is propagated to the nucleus producing regenerative Ca2+ oscillations. Moreover, these effects were independent of the iAR and were mediated by a plasma membrane G protein-coupled receptor. The testosterone-induced neurite outgrowth required changes in intracellular Ca2+ signaling in the cytosol, presumably to initiate translocation of factors that activate nuclear events. These data support the conclusion that there is cross-talk in the pathways used for neuronal cell differentiation involving rapid non-genomic effects, such as Ca2+ oscillations, and the classical genomic actions of androgens, suggesting a novel role for testosterone.
| Materials and Methods |
|---|
|
|
|---|
Cell cultures and transfection
The human neuroblastoma cell line (SH-SY5Y; ATCC) was cultured in 1:1 DMEM:Ham's F12 medium supplemented with 10% (v/v) heat-inactivated fetal bovine serum, 5% non-essential amino acids, 100 IU penicillin and 50 µg/ml streptomycin, in a 95% air-5% CO2 humidified atmosphere in an incubator at 37°C. Cells were grown on 22-mm gelatin-coated glass coverslips for the Ca2+ measurements or 60-mm Petri dishes for biochemical assays. Cultured cells were washed once with PBS before stimulation with testosterone (from concentrated stocks made in ethanol). The final ethanol concentration (<0.01%) had no effect on intracellular Ca2+ concentration or biochemical determinations. For transient transfections, neuroblastoma cells were grown in 60-mm dishes to 60% confluence. Before transfection, the cells were washed to remove serum and were transiently transfected with empty vector: PV-NES-DSR, PV-NLS-DSR or PV-CDEF-DSR (2-4 µg) using Lipofectamine (Invitrogen) in Opti-MEM (Invitrogen) for 4 hours following the manufacturer's instructions. A single plate of transfected cells was then used to set-up the experimental cultures required for each assay, ensuring equal transfection efficiencies between different treatments, and cells were cultured for an additional 24 hours before treatment with testosterone.
Ca2+ imaging
Cells were loaded with 5 µM Fluo-4/AM at 37°C for 30 minutes in a standard solution (in mM): 135 NaCl, 5 KCl, 2 MgCl2, 2 CaCl2, 10 Hepes, 5.6 glucose, pH 7.4. After loading, cells were washed twice with the standard solution and placed on an inverted microscope connected to a laser scanning imaging system (LSM 510 META, Zeiss). Cells were stimulated with the hormone diluted in the standard solution. A 488 nm excitation wavelength focused through a 40x Neo-Fluor objective lens (NA 1.4; Zeiss) was provided by an argon laser. In order to identify the cells expressing the PV construct with the DSR protein, transfected cells were examined using fluorescence excitation at 568 nm. Regions of interest (ROI) were monitored within the nucleus and cytoplasm of the same cell; transfected and non-transfected cells in the same field were followed over time. Each experiment involved a single independent cell and whole cell fluorescence was measured. A given cell was considered to oscillate when at least three Ca2+ transients were recorded over the time monitored, usually 10 minutes. ROIs with the same pixel dimensions, were identified and analyzed using ImageJ software (NIH, Bethesda, MA, USA). The inhibitors were added during the dye incubation; times and concentrations are indicated in the Results. To assess the role of G proteins, cells were incubated either with 1 µg/ml PTX for 6 hours or in a permeabilization solution [100 mM KCl, 20 mM NaCl, 5 mM MgSO4, 1 mM NaH2PO4, 25 mM NaHCO3, 3 mM EGTA, 1 mM CaCl2, 20 mM Tris-HCl (pH 7.4), 0.1% BSA, 1 mM ATP, 0.1% glucose and 40 mg/ml saponin] for 5 minutes in the presence or absence of 100 nM GDPßS, a nonhydrolyzable analog of GDP. After permeabilization, but before hormone stimulation, the cells were incubated for 1 hour in the imaging solution buffer to re-stabilize the membrane integrity (Estrada et al., 2003
). Ca2+-induced fluorescence intensity ratio (F/Fo) was plotted as a function of time. For line scanning, a single line (shown in the cell images as a solid white line) was chosen from the entire confocal section and repeatedly scanned every 20 mseconds. The successive lines were stacked horizontally to compile an image where time increased from left to right, and the spatial dimension was preserved in the vertical axis. To perform power spectrum analysis, we used an algorithm written in MATLAB as described previously (Uhlen, 2004
).
siRNA
We used siRNA for Ins(1,4,5)P3R type 1 in order to reduce the levels of the receptor (provided by F. Leite, Federal University of Minas Gerais, Belo Horizonte, Brazil). The siRNA template was obtained from Ambion and the sequence was AAAGCACCAGCAGCTACAACTCCTGTCTC of the human Ins(1,4,5)P3R type 1. The siRNA for the androgen receptor was obtained from Santa Cruz Biotechnology (cat. # sc-29204). Transfection with siRNA was performed using RNAiFect (Qiagen) and down-regulation of either Ins(1,4,5)P3R or iAR was confirmed by immunofluorescence and western blot analysis.
Immunocytochemistry
Neuroblastoma cells grown on coverslips were fixed in ice-cold methanol for 15 minutes, blocked in PBS containing 1% BSA for 60 minutes, and incubated with primary antibodies at 4°C overnight. Primary antibody against androgen receptor (N-20; Santa Cruz Biotechnology) was used at 1:250. The cells were then washed five times with PBS/BSA and incubated with the appropriate Alexa-conjugated goat anti-rabbit secondary antibody (Molecular Probes) for 1 hour at room temperature (1:5000). After three washes, the coverslips were mounted in Prolong Antifade (Molecular Probes) to retard photo-bleaching. The samples were evaluated using confocal microscopy (LSM 510 META, Zeiss). To compare the confocal images of control and stimulated cells, the settings for the data acquisition and analysis were standardized.
Western blot
Cells lysates containing 40 µg of protein were separated by SDS-PAGE in a 4-20% linear gradient for Ins(1,4,5)P3R-1 and iAR or 10% gel for parvalbumin protein followed by electrophoretic transfer onto PVDF membranes for 2 hours at 400 mA. The following primary antibodies and their respective dilutions were used: anti-iAR (1:1000; Santa Cruz), anti-Ins(1,4,5)P3R type 1 (1:2000) (Choe et al., 2004
), anti-parvalbumin (1:1000; Sigma), anti-actin (1:1000; Santa Cruz). Membranes were incubated with primary antibodies overnight at 4°C. After incubation with horseradish peroxidase-conjugated secondary antibodies (1:5000) for 2 hours at room temperature, the bands were visualized by an enhanced chemiluminescence system (Pierce). Membranes were stripped and re-probed with ß-actin antibody in order to control the protein loaded. Blots were quantified by scanning densitometry.
Analysis of neurite outgrowth
Neuroblastoma cells were cultured in growth medium for 24 hours. Next, the medium was replaced with a medium supplemented with or without testosterone and cultured for an additional 3 days. To determine whether Ca2+ signaling was necessary for neurite outgrowth, cells were transfected with parvalbumin plasmids that were engineered to express either in the cytoplasm (PV-NES-DSR) or nucleus (PV-NLS-DSR or PV-NLS-DSR). Intracellular androgen receptor participation was determined using siRNA-AR, cyproterone and T-BSA, as described above. To quantify the morphological changes induced by testosterone, cells were incubated with the fluorescent dye Cell-Tracker (Molecular Probes) for 45 min. Cells were visualized by confocal microscopy (LSM 510 META, Zeiss), and the acquired fluorescence images were analyzed and compared with LSM Image Browser (Zeiss). For the analysis of neurite outgrowth, only cells with a neurite that was longer than the soma were included. To normalize for various cell size, neurite outgrowth was calculated as the ratio of the neurite length to soma length in the neurite projection.
Statistical analysis
Data are expressed as mean ± s.e.m. or as representative traces. Statistical analysis of the differences between groups was performed using ANOVA, followed by the Bonferroni post-test. P<0.05 was considered statistically significant.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Aizman, O., Uhlen, P., Lal, M., Brismar, H. and Aperia, A. (2001). Ouabain, a steroid hormone that signals with slow calcium oscillations. Proc. Natl. Acad. Sci. USA 98, 13420-13424.
Allbritton, N. L., Meyer, T. and Stryer, L. (1992). Range of messenger action of calcium ion and inositol 1,4,5-trisphosphate. Science 258, 1812-1815.
Ang, E. S., Jr, Haydar, T. F., Gluncic, V. and Rakic, P. (2003). Four-dimensional migratory coordinates of GABAergic interneurons in the developing mouse cortex. J. Neurosci. 23, 5805-5815.
Beato, M. (1989). Gene regulation by steroid hormones. Cell 56, 335-344.[CrossRef][Medline]
Benten, W. P., Lieberherr, M., Giese, G., Wrehlke, C., Stamm, O., Sekeris, C. E., Mossmann, H. and Wunderlich, F. (1999a). Functional testosterone receptors in plasma membranes of T cells. FASEB J. 13, 123-133.
Benten, W. P., Lieberherr, M., Stamm, O., Wrehlke, C., Guo, Z. and Wunderlich, F. (1999b). Testosterone signaling through internalizable surface receptors in androgen receptor-free macrophages. Mol. Biol. Cell 10, 3113-3123.
Berridge, M. J., Bootman, M. D. and Roderick, H. L. (2003). Calcium signalling: dynamics, homeostasis and remodelling. Nat. Rev. Mol. Cell. Biol. 4, 517-529.[CrossRef][Medline]
Bezprozvanny, I., Watras, J. and Ehrlich, B. E. (1991). Bell-shaped calcium-response curves of Ins(1,4,5)P3- and calcium-gated channels from endoplasmic reticulum of cerebellum. Nature 351, 751-754.[CrossRef][Medline]
Bonni, A., Brunet, A., West, A. E., Datta, S. R., Takasu, M. A. and Greenberg, M. E. (1999). Cell survival promoted by the Ras-MAPK signaling pathway by transcription-dependent and -independent mechanisms. Science 286, 1358-1362.
Cabeza, M., Flores, M., Bratoeff, E., de la Pena, A., Mendez, E. and Ceballos, G. (2004). Intracellular Ca2+ stimulates the binding to androgen receptors in platelets. Steroids 69, 767-772.[CrossRef][Medline]
Carafoli, E., Santella, L., Branca, D. and Brini, M. (2001). Generation, control, and processing of cellular calcium signals. Crit. Rev. Biochem. Mol. Biol. 36, 107-260.[CrossRef][Medline]
Choe, C. U., Harrison, K. D., Grant, W. and Ehrlich, B. E. (2004). Functional coupling of chromogranin with the inositol 1,4,5-trisphosphate receptor shapes calcium signaling. J. Biol. Chem. 279, 35551-35556.
Doherty, P., Williams, G. and Williams, E. J. (2000). CAMs and axonal growth: a critical evaluation of the role of calcium and the MAPK cascade. Mol. Cell Neurosci. 16, 283-295.[CrossRef][Medline]
Dolmetsch, R. E., Xu, K. and Lewis, R. S. (1998). Calcium oscillations increase the efficiency and specificity of gene expression. Nature 392, 933-936.[CrossRef][Medline]
Echevarria, W., Leite, M. F., Guerra, M. T., Zipfel, W. R. and Nathanson, M. H. (2003). Regulation of calcium signals in the nucleus by a nucleoplasmic reticulum. Nat. Cell Biol. 5, 440-446.[CrossRef][Medline]
Ehrlich, B. E., Kaftan, E., Bezprozvannaya, S. and Bezprozvanny, I. (1994). The pharmacology of intracellular Ca(2+)-release channels. Trends Pharmacol. Sci. 15, 145-149.[CrossRef][Medline]
Estrada, M., Liberona, J. L., Miranda, M. and Jaimovich, E. (2000). Aldosterone- and testosterone-mediated intracellular calcium response in skeletal muscle cell cultures. Am. J. Physiol. Endocrinol. Metab. 279, E132-E139.
Estrada, M., Espinosa, A., Muller, M. and Jaimovich, E. (2003). Testosterone stimulates intracellular calcium release and mitogen-activated protein kinases via a G protein-coupled receptor in skeletal muscle cells. Endocrinology 144, 3586-3597.
Estrada, M., Espinosa, A., Gibson, C. J., Uhlen, P. and Jaimovich, E. (2005). Capacitative calcium entry in testosterone-induced intracellular calcium oscillations in myotubes. J. Endocrinol. 184, 371-379.
Genka, C., Ishida, H., Ichimori, K., Hirota, Y., Tanaami, T. and Nakazawa, H. (1999). Visualization of biphasic Ca2+ diffusion from cytosol to nucleus in contracting adult rat cardiac myocytes with an ultra-fast confocal imaging system. Cell Calcium 25, 199-208.[CrossRef][Medline]
Gomez, T. M. and Spitzer, N. C. (1999). In vivo regulation of axon extension and pathfinding by growth-cone calcium transients. Nature 397, 350-355.[CrossRef][Medline]
Hardingham, G. E., Chawla, S., Johnson, C. M. and Bading, H. (1997). Distinct functions of nuclear and cytoplasmic calcium in the control of gene expression. Nature 385, 260-265.[CrossRef][Medline]
Kelly, S. J., Ostrowski, N. L. and Wilson, M. A. (1999). Gender differences in brain and behavior: hormonal and neural bases. Pharmacol. Biochem. Behav. 64, 655-664.[CrossRef][Medline]
Lautermilch, N. J. and Spitzer, N. C. (2000). Regulation of calcineurin by growth cone calcium waves controls neurite extension. J. Neurosci. 20, 315-325.
Leite, M. F., Thrower, E. C., Echevarria, W., Koulen, P., Hirata, K., Bennett, A. M., Ehrlich, B. E. and Nathanson, M. H. (2003). Nuclear and cytosolic calcium are regulated independently. Proc. Natl. Acad. Sci. USA 100, 2975-2980.
Li, W., Llopis, J., Whitney, M., Zlokarnik, G. and Tsien, R. Y. (1998). Cell-permeant caged InsP3 ester shows that Ca2+ spike frequency can optimize gene expression. Nature 392, 936-941.[CrossRef][Medline]
Lieberherr, M. and Grosse, B. (1994). Androgens increase intracellular calcium concentration and inositol 1,4,5-trisphosphate and diacylglycerol formation via a pertussis toxin-sensitive G-protein. J. Biol. Chem. 269, 7217-7223.
Losel, R. and Wehling, M. (2003). Nongenomic actions of steroid hormones. Nat. Rev. Mol. Cell. Biol. 4, 46-56.[CrossRef][Medline]
Lucas, P. C. and Granner, D. K. (1992). Hormone response domains in gene transcription. Annu. Rev. Biochem. 61, 1131-1173.[CrossRef][Medline]
Lustig, R. H. (1994). Sex hormone modulation of neural development in vitro. Horm. Behav. 28, 383-395.[CrossRef][Medline]
Maggi, R., Poletti, A., Casulari, L. A., Pimpinelli, F., Piva, F., Zanisi, M. R. and Martini, L. (1998). Effects and metabolism of steroid hormones in human neuroblastoma cells. Steroids 63, 257-262.[CrossRef][Medline]
Marron, T. U., Guerini, V., Rusmini, P., Sau, D., Brevini, T. A., Martini, L. and Poletti, A. (2005). Androgen-induced neurite outgrowth is mediated by neuritin in motor neurones. J. Neurochem. 92, 10-20.[CrossRef]
McEwen, B. S. (1991). Non-genomic and genomic effects of steroids on neural activity. Trends Pharmacol. Sci. 12, 141-147.[CrossRef][Medline]
Migliaccio, A., Castoria, G., Di Domenico, M., de Falco, A., Bilancio, A., Lombardi, M., Barone, M. V., Ametrano, D., Zannini, M. S., Abbondanza, C. et al. (2000). Steroid-induced androgen receptor-oestradiol receptor beta-Src complex triggers prostate cancer cell proliferation. EMBO J. 19, 5406-5417.[CrossRef][Medline]
Mooradian, A. D., Morley, J. E. and Korenman, S. G. (1987). Biological actions of androgens. Endocr. Rev. 8, 1-28.[Medline]
Naghdi, N. and Asadollahi, A. (2004). Genomic and nongenomic effects of intrahippocampal microinjection of testosterone on long-term memory in male adult rats. Behav. Brain Res. 153, 1-6.[CrossRef][Medline]
Pusl, T., Wu, J. J., Zimmerman, T. L., Zhang, L., Ehrlich, B. E., Berchtold, M. W., Hoek, J. B., Karpen, S. J., Nathanson, M. H. and Bennett, A. M. (2002). Epidermal growth factor-mediated activation of the ETS domain transcription factor Elk-1 requires nuclear calcium. J. Biol. Chem. 277, 27517-27527.
Sanchez, S., Sayas, C. L., Lim, F., Diaz-Nido, J., Avila, J. and Wandosell, F. (2001). The inhibition of phosphatidylinositol-3-kinase induces neurite retraction and activates GSK3. J. Neurochem. 78, 468-481.[CrossRef][Medline]
Sneyd, J., Tsaneva-Atanasova, K., Yule, D. I., Thompson, J. L. and Shuttleworth, T. J. (2004). Control of calcium oscillations by membrane fluxes. Proc. Natl. Acad. Sci. USA 101, 1392-1396.
Spitzer, N. C., Lautermilch, N. J., Smith, R. D. and Gomez, T. M. (2000). Coding of neuronal differentiation by calcium transients. BioEssays 22, 811-817.[CrossRef][Medline]
Tang, T. S., Tu, H., Wang, Z. and Bezprozvanny, I. (2003). Modulation of type 1 inositol (1,4,5)-trisphosphate receptor function by protein kinase a and protein phosphatase 1alpha. J. Neurosci. 23, 403-415.
Tovey, S. C., de Smet, P., Lipp, P., Thomas, D., Young, K. W., Missiaen, L., De Smedt, H., Parys, J. B., Berridge, M. J., Thuring, J. et al. (2001). Calcium puffs are generic InsP(3)-activated elementary calcium signals and are downregulated by prolonged hormonal stimulation to inhibit cellular calcium responses. J. Cell Sci. 114, 3979-3989.[Medline]
Uhlen, P. (2004). Spectral analysis of calcium oscillations. Sci. STKE 258, p l15.
Wojcikiewicz, R. J. (1995). Type I, II, and III inositol 1,4,5-trisphosphate receptors are unequally susceptible to down-regulation and are expressed in markedly different proportions in different cell types. J. Biol. Chem. 270, 11678-11683.
Wozniak, A., Hutchison, R. E., Morris, C. M. and Hutchison, J. B. (1998). Neuroblastoma and Alzheimer's disease brain cells contain aromatase activity. Steroids 63, 263-267.[CrossRef][Medline]
Yerramilli-Rao, P., Garofalo, O., Whatley, S., Leigh, P. N. and Gallo, J. M. (1995). Androgen-controlled specific gene expression in neuroblastoma cells. J. Neurol. Sci. 129, S131-S135.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
F. Altamirano, C. Oyarce, P. Silva, M. Toyos, C. Wilson, S. Lavandero, P. Uhlen, and M. Estrada Testosterone induces cardiomyocyte hypertrophy through mammalian target of rapamycin complex 1 pathway J. Endocrinol., August 1, 2009; 202(2): 299 - 307. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Boehmerle, K. Zhang, M. Sivula, F. M. Heidrich, Y. Lee, S.-E. Jordt, and B. E. Ehrlich Chronic exposure to paclitaxel diminishes phosphoinositide signaling by calpain-mediated neuronal calcium sensor-1 degradation PNAS, June 26, 2007; 104(26): 11103 - 11108. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Boehmerle, U. Splittgerber, M. B. Lazarus, K. M. McKenzie, D. G. Johnston, D. J. Austin, and B. E. Ehrlich Paclitaxel induces calcium oscillations via an inositol 1,4,5-trisphosphate receptor and neuronal calcium sensor 1-dependent mechanism PNAS, November 28, 2006; 103(48): 18356 - 18361. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||