|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 29 May 2007
doi: 10.1242/jcs.006247
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
v-integrin in regulation of epithelial morphogenesis
1 Department of Morphoregulation, Institute for Frontier Medical Sciences, Kyoto University, 53 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan
2 Life Sciences Division, Lawrence Berkeley National Laboratory, 1 Cyclotron Road, MS 977, Berkeley, CA 94720, USA
3 Mayo Clinic Cancer Center, 4500 San Pablo Road, Jacksonville, FL 32224, USA
4 Mayo Clinic Proteomics Research Center, 200 First St. SW, Rochester, MN 55905, USA
* Author for correspondence (e-mail: hirai-yohei{at}frontier.kyoto-u.ac.jp)
Accepted 17 April 2007
| Summary |
|---|
|
|
|---|
v-integrin-containing receptors on target epithelial cells, leading to activation of specific downstream signaling pathways and induction of epithelial morphogenesis. These findings provide key insight into how epimorphin functions as an epithelial morphogen.
Key words: Epimorphin, Integrin, Morphogenesis, Membrane translocation, t-SNARE
| Introduction |
|---|
|
|
|---|
Epimorphin is distinct from many other proteins that undergo non-classical secretion in that it has a well-defined intracellular function. It is a member of the t-SNARE protein family that mediates vesicle targeting and fusion (Bennett et al., 1993
; Pelham, 1993
; Sieber et al., 2006
). Epimorphin (syntaxin 2) is highly similar to syntaxin 1A, which consists of a three-helical N-terminal bundle (3-Hlx) connected by a flexible linker to a C-terminal sequence containing the SNARE and transmembrane (TM) domains (Chen and Scheller, 2001
). Deletion analyses of epimorphin have revealed that the morphogenic and vesicle-fusion functions are separable: the the C-terminal SNARE and TM domains are essential for syntaxin-mediated vesicular fusion (Chen and Scheller, 2001
; Giraudo et al., 2006
) but they are dispensable for epimorphin-mediated morphogenic activity (Hirai et al., 2001
). Despite these differences and the many studies in a diverse range of tissues in which extracellularly presented epimorphin has been shown to regulate developmental processes (Bascom et al., 2005
; Fritsch et al., 2002
; Hirai et al., 1998
; Hirai et al., 2001
; Hirai et al., 1992
; Lehnert et al., 2001
; Oka and Hirai, 1996
; Oka et al., 2006
; Qin et al., 2005
; Radisky et al., 2003
; Takebe et al., 2003
; Tulachan et al., 2006
; Yoshino et al., 2006
), the extracellular action of epimorphin as a morphogen has remained controversial because the specific molecular mechanism by which epimorphin becomes secreted from the cell has not been defined and the extracellular receptor that mediates the morphogenic action of epimorphin has not been identified.
In this study, we determine the motif responsible for the membrane translocation of epimorphin, and define the processing site and the critical amino acid residue for its subsequent secretion. We find that the key elements for epimorphin secretion are similar to those defined for non-classical export of FGF1 and interleukin 1 beta (IL1B). We also identify the cell surface receptor responsible for controlling morphogenesis induced by secreted epimorphin. These results not only elucidate how epimorphin can act as an extracellular morphogen, but also shed light on a new morphoregulatory mechanism, in which a protein with a defined intracellular function can become externalized and processed as a morphogen for signaling to target cells.
| Results |
|---|
|
|
|---|
|
S) and chimeric molecules in which the 3-Hlx domains of epimorphin and syntaxin 1A were fused to the C-terminal SNARE/TM domains of the other (TES, TSE; Fig. 2A). All five protein products (TE, TS, TE
S, TES, TSE) were found in the lysates of transfected cells, but only TE, TS, TES, and TSE reacted with membrane-impermeant biotinylation reagents (Fig. 2B); these results demonstrated that the presence of the SNARE/TM domain from either epimorphin or syntaxin 1A was sufficient to direct extracellular presentation. However, only constructs containing the SNARE and TM domains of epimorphin were secreted from the cell surface into the extracellular medium (Fig. 2C), demonstrating that solubilization of epimorphin is defined by distinct signaling elements not present in syntaxin 1A. Whereas the amount of protein secreted varied between transfection experiments, we typically observed 5-20% secretion of the total TE and TSE. These results were also obtained in other cultured fibroblast cell lines, including mouse embryonic NIH 3T3, 10T1/2 and mammary g6 cells (K.T. and Y.H., unpublished data). The size of the secreted form and the maintenance of its N-terminal epitope tag suggested that release from the cell surface is accomplished through proteolytic cleavage within the SNARE domain. Mass spectrometric analysis of the tryptic fragments of secreted 30 kDa epimorphin identified only sequences contained within the N-terminal domain, with the most C-terminal peptide ending with glutamic acid at position 245 (E245). This result suggested that E245 is the C-terminus of secreted epimorphin (Fig. 2D). Consistent with this result, antibodies against the C-terminal part of epimorphin SNARE that react with cellular 34 kDa epimorphin failed to recognize the secreted 30 kDa form (see supplementary material Fig. S1).
|
Determination of the critical amino acid residue involved in epimorphin release
The sequences of epimorphin and syntaxin 1A are highly conserved, especially within the SNARE domain; however, only epimorphin is cleaved and secreted. Comparison of the amino acid residues adjacent to the cleavage site of different syntaxin molecules revealed a histidine residue at position 246 (H246) in epimorphin from mouse, human, quail and sheep. However, in mouse and human syntaxin 1A, as well as mouse syntaxin 3 and syntaxin 4, this position is occupied by an arginine (R246) (Fig. 3A). Moreover, also conserved in epimorphin from all four species examined is a KEE sequence at positions 248-250 that is not present in syntaxin 1A, syntaxin 3 and syntaxin 4 (these syntaxin isoforms contain a VSD sequence instead; Fig. 3A). The release of epimorphin from the cell surface is dramatically reduced upon a H246R mutation, whereas mutation of KEE to VSD did not reduce release into the supernatant (Fig. 3B). Conversely, after a R246H mutation in syntaxin 1A, the resultant protein was released as a 30 kDa soluble form, demonstrating the importance of H246 (Fig. 3B). However, it is noteworthy that mutation of the syntaxin 1A sequence VSD to KEE resulted in the limited release of this molecule into the supernatant (Fig. 3B), suggesting that this sequence may play a secondary role.
|
|
Secreted epimorphin binds to target cells and activates focal adhesion kinase
To define how secreted epimorphin elicits a morphological response, we next investigated the association of secreted epimorphin with target epithelial cells. We performed quantitative cell adhesion assays using the non-tumorgenic murine mammary epithelial SCp2 cell line that does not endogenously express epimorphin (Hirai et al., 1998
; Hirai et al., 2001
). We tested the association between SCp2 cells and the secreted protein complex containing 30 kDa epimorphin, 40 kDa synaptotagmin and annexin II. The cells bound and spread onto the intact protein complex (Fig. 5A); this effect was blocked by antibodies against epimorphin but not by antibodies against synaptotagmin or annexin II, suggesting that a specific association with epimorphin is responsible for cell adhesion (Fig. 5A). As this adhesion and spreading onto epimorphin was reminiscent of interactions with ECM proteins, we measured phosphorylation of focal adhesion kinase (FAK), a direct downstream signaling molecule of integrin ECM receptors (Kumar, 1998
). Binding to epimorphin activated FAK, which was blocked by anti-epimorphin antibodies, suggesting that cells bind epimorphin via integrin receptors (Fig. 5A). When purified recombinant epimorphin, corresponding to the secreted form of epimorphin (r-Epm30), was added to the medium it immediately bound the cell surface and induced FAK phosphorylation (Fig. 5B). A similar cell-surface-binding effect has been observed with recombinant epimorphin lacking the entire SNARE domain (r-Epm) that has been demonstrated to be functionally substitutive for full-length epimorphin (Hirai et al., 2001
). No cellular binding was detected with the recombinant form of the SNARE domain (r-SNARE). We also detected the phosphorylation of extracellular signal-regulated kinases 1 and 2 (ERK1/2), downstream effectors of FAK but not of epidermal growth factor receptor (EGFR) (Fig. 5B, right). These observations indicate that secreted epimorphin binds to integrins on the cell surface and activates FAK and ERK.
|
v-integrin complex as epimorphin receptor
v-integrin and β1-integrin selectively inhibit epimorphin association, whereas a function-stimulating antibody against β1-integrin substantially enhanced this association, suggesting that
v- and β1-integrins mediate cell-epimorphin interactions (Fig. 6A). Antibodies against EGFR that block epimorphin function on intestinal cells did not influence cell-epimorphin interaction in this adhesion assay (Y.H., unpublished). As shown using SCp2 cells, association of HMECs with epimorphin induced FAK phosphorylation, and this effect was blocked by antibodies against
v- or β1-integrin (Fig. 6B). We found that epimorphin-immobilized beads selectively pulled down 120-kDa to 140-kDa proteins from cell-surface components in HMECs, which contained β1- and
v-integrin subunits (Fig. 6C), suggesting that epimorphin either directly or indirectly interacts with the integrins. We also found that antibodies against the cytoplasmic domains of
v–and β1-integrins selectively co-precipitate r-EPM from the lysates of SCp2 cells cultured on r-Epm (see supplementary material Fig. S2). Thus,
v- and β1-integrins, most likely the
vβ1 subset, are involved in cell-epimorphin interaction for both of these normal mammary epithelial cells. Experiments assessing other cell types confirmed that
v-integrins are always involved in binding to epimorphin, but that the β-integrin subtype varied. We tested epimorphin association using human skin carcinoma (HSC-5), lung carcinoma (A549) and human breast adenocarcinoma (MCF7) cell lines, and human umbilical vein endothelial cells (HUVECs) and found that antibodies against
v-integrins blocked epimorphin binding of all these cell types, whereas antibodies against β1-integrin specifically blocked binding of HSC-5 cells and HUVECs and those against
vβ5-integrin blocked binding of MCF7 and A549 cells (Fig. 6D). The importance of
v-integrin in cell-epimorphin interaction was further confirmed using human mammary epithelial cells (HMECs), in which this
subunit was transiently silenced with missionTM shRNA knockdown constructs (Fig. 6E). Although
vβ1- and
vβ5-integrins are known to function as receptors for fibronectin, epimorphin-integrin complexes did not co-precipitate with this ECM component, indicating that the interaction between epimorphin and integrin may not be mediated by ECM molecules (Fig. 6C). To test whether epimorphin interacts directly with
v-integrin, we incubated epimorphin-immobilized beads with purified
vβ5-integrin, which is the only commercially available integrin with an epimorphin-binding potential. Purified
vβ5- and not
1β1-integrin bound to epimorphin-coated beads; this binding was not attenuated by RGD-containing peptide, indicating that epimorphin directly associates with
v-integrin and that possible impurities containing the canonical integrin-binding RGD motif are not involved in this protein-protein interaction (Fig. 6F).
|
Interaction between epimorphin and
v-integrin is crucial for 3D morphogenesis
We next evaluated whether association of epimorphin with
v-integrin was responsible for regulation of epithelial morphogenesis. Our previous investigations showed that mouse mammary epithelial cell lines cultured in collagen I gels undergo distinct types of morphogenic processes depending on the orientation of the presented epimorphin: exposure to epimorphin only on the outer surface of cell clusters (polar presentation) stimulated branching morphogenesis, whereas exposure to all the cells throughout the cell cluster (apolar presentation) stimulated luminal morphogenesis (Hirai et al., 1998
). To evaluate the role of
v-integrins in epimorphin-mediated morphogenesis, we developed a streamlined version of the assay, which involved exposure of cell clusters to adenovirus carrying constructs of epimorphin fused to the signal peptide of interleukin 2 (IL2) (Av-SE). The IL-2 signal peptide has been shown to efficiently direct the entire population of exogenously expressed epimorphin to the cell surface via the normal secretory pathway (Fig. 7A) (Hirai et al., 1998
; Oka et al., 2006
). Intriguingly, this method of secretion results in a glycosylated 37 kDa form of cell surface epimorphin that appears not to be released into the medium, providing a tool to more precisely control the mode of epimorphin presentation (see supplementary material Fig. S3 and Discussion). In 3D collagen gels, HMEC clusters with polar presentation of epimorphin underwent branching morphogenesis, whereas those with apolar presentation generated cysts with large central lumina (Fig. 7A). We found that addition of antibodies against
v-integrin or epimorphin substantially inhibited both branching and luminal morphogenesis, suggesting that the interaction between epimorphin and
v-integrin is required for its activity as a morphogen (Fig. 7B). Taken together, these results suggest a model for extracellular epimorphin function, in which epimorphin is secreted by non-classical pathways through specific interactions with the SNARE/TM domain, and mediates morphogenesis by binding to
v-integrins (Fig. 8).
|
|
| Discussion |
|---|
|
|
|---|
Our identification of synaptotagmin 1 in the epimorphin secretory complex is consistent with our finding that the synaptotagmin-binding SNARE domain is a crucial domain for epimorphin secretion. Synaptotagmin 1 has been indicated as a neuronal-specific protein, however, NIH 3T3 cells are known to express this molecule (Tarantini et al., 1998
) and we confirmed its expression in our NIH 3T3-cell-derived PT67 packaging cell line by RT-PCR (Y.H., unpublished). It is also noteworthy that we observed extracellular presentation of a subpopulation of syntaxin 1A in transiently transfected cells (Fig. 2B, Fig. 3B). Whereas most studies on syntaxin 1A have focused on its intracellular functions, several reports suggested that it can adopt an extracellular localization as well (Brimhall et al., 1999
; Smirnova et al., 1993a
; Smirnova et al., 1993b
).
Altough epimorphin and syntaxin 1A both can be localized to the cell surface, only epimorphin is secreted from the cell (Fig. 2C, Fig. 3B). We identified H246 as the crucial residue for the processing of epimorphin and determined E245 as the C-terminus of secreted epimorphin (Fig. 2D, Fig. 3A,B). Epimorphin from mouse, human, quail and sheep all contain a H246, and a R246H mutation in syntaxin 1A generates a mutant molecule that releases from the cell (Fig. 3B). As R246 is conservered in other syntaxins, and a H246R mutation in epimorphin prevents its release from the cell (Fig. 3B), it is likely that this residue is the key determinant to render epimorphin a soluble morphogen, distinct from other syntaxin isoforms. Generation of soluble epimorphin by cleavage at its membrane-proximal domain might be necessary for its function as a morphogen, because the basement membrane prevents direct contact between epimorphin-producing stromal cells and target epithelial cells (Gurdon and Bourillot, 2001
; Hirai et al., 1992
). It is possible, however, that syntaxins that are not released as soluble molecules still play a role in juxtacrine cell signaling processes. For example, extracellular syntaxin 1A could function at pre- and postsynaptic junctions or neuron-glia interfaces where no physical barrier exists between the syntaxin-1A-producing cells and the target cells. Surprisingly, we were unable to detect epimorphin secretion when the molecule was directed to the cell surface after fusing it to the IL-2 signal peptide (see supplementary material Fig. S4). It might be that glycosylation within the ER-Golgi pathway prevents proteolytic processing of epimorphin; another possibility is that epimorphin processing takes place in association with the synaptotagmin–annexin-II release complex.
We defined
v-integrin as the core component of the epimorphin receptor using cell adhesion assays, pulldown assays, immunoprecipitation analysis and the 3D morphogenesis assay, whereas recent work also implicated involvement of EGF receptors in the cell-epimorphin interaction in intestinal epithelia (Iizuka et al., 2007
).
v-Integrin and its downstream effectors FAK and ERK (which also acts as an effector of EGFR family members) are known to play important roles in the developmental processes of many organ systems (Bader et al., 1998
; Bayless et al., 2000
; Eliceiri and Cheresh, 2000
). In addition to key roles in morphogenesis,
v-integrins have anti-apoptotic functions in both normal and pathogenic developmental processes (Bao and Stromblad, 2004
; Kumar, 1998
). Iizuka et al. recently reported that extracellular supplementation of epimorphin prolongs the lifetime of nutrient-deprived intestinal cells and also attenuates apoptosis induced by cytotoxic reagents (Iizuka et al., 2007
). Consistent with this, we found that exposure to soluble extracellular epimorphin was sufficient to confer apoptosis resistance in HMECs that were maintained in unsupplemented medium, even after 4 weeks (see supplementary material Fig. S5), suggesting that epimorphin–
v-integrin–FAK signaling is involved in cell survival pathways and that epimorphin secreted from the damaged cells can, in turn, protect epimorphin-receiving cells from environmental insult. A general pathway by which stressed and apoptotic cells can release epimorphin may provide insight into why dramatic morphogenesis is often accompanied by apoptotic cell death, and how tissue repairing processes can be stimulated in injured tissues. Our identification that alterations in Ca2+ levels can stimulate extracellular secretion of epimorphin suggests a new link between Ca2+-dependent signaling and morphogenesis (Webb and Miller, 2003
). Investigation of the role of Ca2+ signaling in the dramatic morphological and functional differentiations triggered by epimorphin is now underway.
Finally, our study clearly provides evidences that a subpopulation of an intracellular vesicular docking mediator can translocate across the membrane, get processed to be secreted and exert new extracellular function as epimorphin. Elucidation of the functional link between these intracellular and extracellular functions, and the regulation mechanism for the spatiotemporal export of epimorphin may identify a new type of signaling pathway for sophisticated tissue morphogenesis.
| Materials and Methods |
|---|
|
|
|---|
Expression constructs
To prepare expression plasmids for epimorphin and the derivatives tagged with T7 peptide, cDNA of mouse epimorphin (D10475), mouse syntaxin 1A (BC047133) or their chimeric molecules fused to the T7 peptide sequence at the N-terminus were generated using PCR and introduced into expression vectors containing either CMV or SR
promoters; both promoters produced similar results. The vectors were p-QCXIN (Clontech), p-TARGET (Promega) and SR
296 (Takebe et al., 1988
). To introduce amino acid mutations in expression plasmids for epimorphin and syntaxin 1A, standard site-directed mutagenesis with Pfu polymerase and restriction enzyme DpnI (Stratagene) was carried out following the manufacturer's protocol. H246 (AGG) at aa position 246 or the following KEE aa sequence (AAGGAAGAG) in epimorphin were mutated to R(CAT) or VSD(GTGTCAGAC), respectively, and the corresponding R(CAT) or VSD(GTGTCAGAC) in syntaxin 1A was mutated to H(AGG) or KEE(AAGGAAGAG), respectively. For the transient expression of the transgene products, subconfluent cells were transfected with the expression plasmids using lipofectamine or lipofectamine 2000 (Invitrogen) and analyzed 3 days after transfection. To generate stable cells expressing T7-tagged epimorphin, PT67 cells were transfected with the T7-epimorphin cDNA cloned in an expression plasmid p-TARGET or p-QCXIN and selected in the presence of 400 µg/ml of G418. Three independent clones TE-3, TE-4 and TE_5 displayed similar properties in terms of epimorphin expression, although we used the TE-5 clone for the results presented here. Adenovirus for extracellular epimorphin was generated using AdenoX expression system (Clontech), according to manufacturer's protocols, using an expression construct in which the IL2 signal peptide was fused with the cDNA-encoding ORF of mouse epimorphin (Hirai et al., 2001
). The lentivirus for silencing
v-integrin subunit were prepared using Mission RNAi constructs HE4 and HE5 (Sigma) and the Invitrogen ViraPower Lentiviral Expression System (Invitrogen), according to the manufacturer's protocols. The hairpin insert of the constructs are: CCGGCTCTGTTGTATATCCTTCATTCTCGAGAATGAAGGATATACAACAGAGTTTTT (HE4) and CCGGGACTGAGCTAATCTTGAGAATCTCGAGATTCTCAAGATTAGCTCAGTCTTTTT (HE5).
Cell adhesion assays
Adhesion assays were carried out essentially as previously described (Hirai et al., 1998
). To prepare surfaces displaying intact secretory complex containing 30 kDa epimorphin, 48-well plates (non-cell culture; Iwaki) were coated with monoclonal antibody against the T7-tag (Novagen) t 2 µg/cm2, followed by a 3-hour incubation with supernatant from TE5 cells treated with cycloheximide for 3 days. As the control, supernatant from PT67 cells that had been transfected with the empty vector was used. Other proteins used to coat dishes were recombinant epimorphin lacking the SNARE and TM domains (r-Epm, aa 1-188) (Hirai et al., 2001
), recombinant epimorphin with the SNARE domain only (without the TM domain) (r-SNARE, aa 189-265) (Hirai, 1994
), green fluorescent protein (GFP) generated in bacteria (r-GFP) and collagen type I (Koken). Wells were coated with protein at 2 µg/cm2, dried under sterile conditions and washed three times with PBS. Cells (1x104) suspended in DMEM/HamF12 medium containing 20 mg/ml BSA were then seeded onto each well. In some wells, affinity-purified rabbit antibodies against epimorphin or control rabbit IgG were added to the medium at the final concentration of 100 µg/ml. Cell adhesion was assessed after 4 hours. To prepare cell lysates for detection of phosphorylated FAK, adhered and unbound cells collected by centrifugation were mixed and dissolved in 1x lysis buffer (Tris-buffered saline containing 1% Triton X-100, 1% NP-40 and protease inhibitor cocktail) (Nacalai Tesque, Inc.). To assess the activity of soluble epimorphin to bind to and activate the target cells, 20 µg/ml recombinant epimorphin corresponding to the secreted form (r-Epm30, aa 1-245), r-Epm or r-SNARE was added to cells that has been maintained in serum-free medium for 24 hours. Cells were collected for western blotting after 15 and 30 minutes, or washed and fixed for immunocytochemistry with ice-cold methanol after a 30-minute incubation.
Antibodies
For immunocytochemistry, affinity-purified rabbit and rat polyclonal antibodies against epimorphin (Hirai et al., 1998
), goat polyclonal antibodies against E-cadherin (R&D systems), mouse monoclonal antibody against the T7 tag (Novagen) and β-actin (Sigma) were used. Antibodies used for cell-binding assay were affinity-purified anti-epimorphin polyclonal antibodies, rabbit polyclonal antibodies against annexin II (Santa Cruz) Chicken polyclonal antibodies against synaptptagmin-1 (Abcam, ab8037-100) and function-blocking and function-stimulating monoclonal antibodies against integrins purchased from Chemicon. These antibodies were added to medium at a concentration of 25 µg/ml. Monoclonal antibodies against integrins were against
1-integrin (FB12),
2-integrin (PIE6),
3-integrin (ASC-1),
6-integrin (GoH3),
v-integrin (P3G8 and AV1), β1-integrin (6S6 and B3B11), β3-integrin (25E11),
5β1-integrin (JBS5),
Vβ5-integrin (P1F6),
Vβ6-integrin (10D5) and
Vβ3-integrin (LM609). To test the inhibitory effect on 3D morphogenesis these antibodies were added to medium at a concentration of 200 µg/ml. Antibodies used for immunoprecipitation were affinity-purified rabbit anti-epimorphin polyclonal antibodies that cross-react with syntaxin 1A (Hirai et al., 1998
; Takebe et al., 2003
), rabbit antiserum against the cytoplasmic domains of
v-integrin,
5-integrin, β1-integrin (Chemicon) and β3-integrin (Santa Cruz) and mouse monoclonal antibodies against the T7 peptide (Novagen). Primary antibodies used for western blotting were mouse monoclonal antibodies against the T7 peptide (Novagen), β-actin (Sigma), phosphotyrosine (Takara) and cellular fibronectin (Sigma), rabbit polyclonal antibodies against FAK (Santa Cruz), FAK phosphorylated at Y97 (Sigma and Biosource), ERK1/2, and ERK1/2 phosphorylated at Y187/Y204 and T185/202, EGFR, Annexin II (Santa Cruz), cytoplasmic domain of
v-integrin,
5-integrin, β1-integrin (Chemicon) and β3-integrin (Santa Cruz), goat polyclonal antibodiesagainst phosphorylated EGFR at Y1173 (Santa Cruz) and chicken polyclonal antibodies against synaptotagmin 1 (Abcam, ab8037-100). As for anti-β-actin and the T7 peptide, HRP-labeled forms were also used for some western blots without secondary HRP-labeled antibodies.
Immunoprecipitation
To prepare lysates of adherent cells, supernatant was collected out of one well of a six-well plate, in which sub-confluent cells had been cultured in 1 ml medium and the cells had been treated with 1 ml of 1x lysis buffer for 30 minutes at room temperature. After removal of insoluble precipitates from supernatant and cell lysate by centrifugation at 18,500 g for 30 minutes, specific antibodies were added to them and the immunocomplex was retrieved with ProteinG-sepharose beads (GE Healthcare). The bound materials were dissolved in 50 µl (for supernatant sample) or 250 µl (for lysate sample) of SDS sample buffer, so that the amount of supernatant sample for laoding was five times that of the cell lysates sample. To prepare whole-culture lysates (cells plus supernatant), same volumes of 2x lysis buffer and supernatant were added directly to the culture. To collect epimorphin-bound materials, beads immobilized with r-Epm were prepared. A 1:1 mixture of Affigel 10 and Affigel 15 (Bio-Rad) was incubated with 1 mg/ml of r-Epm or r-GFP in PBS. After 4 hours the beads were treated with 100 mM ethanolamine and washed several times with 1x lysis Buffer. Thus prepared r-Epm-beads were incubated with protein samples in 1x lysis buffer containing the lysis-cations CaCl2, MgCl2 and MnCl2 at a final concentration of 1 mM for 12 hours, washed with lysis-cations three times and bound proteins were analyzed by western blotting. In some tubes, the synthetic peptide RGDS or RGES (Gibco BRL) was added at a concentration of 20 µg/ml. The protein sample includes 1 µg/ml of purified
vβ5-integrin or
1β1-integrin (Chemicon).
Biotin labeling
For biotinylation of r-Epm and r-GFP, 1 mg/ml of the proteins was mixed with 1 mg/ml of Sulfo-NHS-biotin (Pierce) in PBS and incubated for 2 hours followed by extensive dialysis against PBS. To obtain lysate containing labeled cell surface proteins, living cells were treated with membrane impermeant Sulfo-NHS-biotin (100 µg/ml) in Hepes-buffered saline for 30 minutes, washed several times with serum-free medium and dissolved in lysis buffer. After removal of insoluble materials by centrifugation, the lysate was applied to streptavidin-agarose beads (Life Technologies) or r-Epm-beads to collect total cell surface proteins or the epimorphin-binding components, respectively.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Bader, B. L., Rayburn, H., Crowley, D. and Hynes, R. O. (1998). Extensive vasculogenesis, angiogenesis, and organogenesis precede lethality in mice lacking all alpha v integrins. Cell 95, 507-519.[CrossRef][Medline]
Bai, J. and Chapman, E. R. (2004). The C2 domains of synaptotagmin – partners in exocytosis. Trends Biochem. Sci. 29, 143-151.[CrossRef][Medline]
Bao, W. and Stromblad, S. (2004). Integrin alphav-mediated inactivation of p53 controls a MEK1-dependent melanoma cell survival pathway in three-dimensional collagen. J. Cell Biol. 167, 745-756.
Bascom, J. L., Fata, J. E., Hirai, Y., Sternlicht, M. D. and Bissell, M. J. (2005). Epimorphin overexpression in the mouse mammary gland promotes alveolar hyperplasia and mammary adenocarcinoma. Cancer Res. 65, 8617-8621.
Bayless, K. J., Salazar, R. and Davis, G. E. (2000). RGD-dependent vacuolation and lumen formation observed during endothelial cell morphogenesis in three-dimensional fibrin matrices involves the alpha(v)beta(3) and alpha(5)beta(1) integrins. Am. J. Pathol. 156, 1673-1683.
Bennett, M. K., Garcia-Arraras, J. E., Elferink, L. A., Peterson, K., Fleming, A. M., Hazuka, C. D. and Scheller, R. H. (1993). The syntaxin family of vesicular transport receptors. Cell 74, 863-873.[CrossRef][Medline]
Bevers, E. M., Comfurius, P., Dekkers, D. W. and Zwaal, R. F. (1999). Lipid translocation across the plasma membrane of mammalian cells. Biochim. Biophys. Acta 1439, 317-330.[Medline]
Brimhall, B. B., Sikorski, K. A., Torday, J., Shahsafaei, A., Haley, K. J. and Sunday, M. E. (1999). Syntaxin 1A is transiently expressed in fetal lung mesenchymal cells: potential developmental roles. Am. J. Physiol. 277, L401-L411.[Medline]
Chen, Y. A. and Scheller, R. H. (2001). SNARE-mediated membrane fusion. Nat. Rev. Mol. Cell Biol. 2, 98-106.[CrossRef][Medline]
Eliceiri, B. P. and Cheresh, D. A. (2000). Role of alpha v integrins during angiogenesis. Cancer J. 6 Suppl. 3, S245-S249.[Medline]
Fritsch, C., Swietlicki, E. A., Lefebvre, O., Kedinger, M., Iordanov, H., Levin, M. S. and Rubin, D. C. (2002). Epimorphin expression in intestinal myofibroblasts induces epithelial morphogenesis. J. Clin. Invest. 110, 1629-1641.[CrossRef][Medline]
Giraudo, C. G., Eng, W. S., Melia, T. J. and Rothman, J. E. (2006). A clamping mechanism involved in SNARE-dependent exocytosis. Science 313, 676-680.
Gumbiner, B. M. (1992). Epithelial morphogenesis. Cell 69, 385-387.[Medline]
Gurdon, J. B. and Bourillot, P. Y. (2001). Morphogen gradient interpretation. Nature 413, 797-803.[CrossRef][Medline]
Hirai, Y. (1994). Sodium-dodecyl-sulfate-resistant complex formation of epimorphin monomers and interaction of the 150-kDa complex with the cell surface. Eur. J. Biochem. 225, 1133-1139.[Medline]
Hirai, Y. (2001). Epimorphin as a morphogen: does a protein for intracellular vesicular targeting act as an extracellular signaling molecule? Cell Biol. Int. 25, 193-195.[CrossRef][Medline]
Hirai, Y., Takebe, K., Takashina, M., Kobayashi, S. and Takeichi, M. (1992). Epimorphin: a mesenchymal protein essential for epithelial morphogenesis. Cell 69, 471-481.[CrossRef][Medline]
Hirai, Y., Lochter, A., Galosy, S., Koshida, S., Niwa, S. and Bissell, M. J. (1998). Epimorphin functions as a key morphoregulator for mammary epithelial cells. J. Cell Biol. 140, 159-169.
Hirai, Y., Radisky, D., Boudreau, R., Simian, M., Stevens, M. E., Oka, Y., Takebe, K., Niwa, S. and Bissell, M. J. (2001). Epimorphin mediates mammary luminal morphogenesis through control of C/EBPbeta. J. Cell Biol. 153, 785-794.
Iizuka, M., Sasaki, K., Hirai, Y., Shindo, K., Konno, S., Itou, H., Ohshima, S., Horie, Y. and Watanabe, S. (2007). Morphogenic protein epimorphin protects intestinal epithelial cells from oxidative stress by the activation of EGF receptor and MEK/ERK, PI3 kinase/Akt signals. Am. J. Physiol. Gastrointest. Liver Physiol. 292, G39-G52.
Jackson, A., Friedman, S., Zhan, X., Engleka, K. A., Forough, R. and Maciag, T. (1992). Heat shock induces the release of fibroblast growth factor 1 from NIH 3T3 cells. Proc. Natl. Acad. Sci. USA 89, 10691-10695.
Kumar, C. C. (1998). Signaling by integrin receptors. Oncogene 17, 1365-1373.[CrossRef][Medline]
Lehnert, L., Lerch, M. M., Hirai, Y., Kruse, M. L., Schmiegel, W. and Kalthoff, H. (2001). Autocrine stimulation of human pancreatic duct-like development by soluble isoforms of epimorphin in vitro. J. Cell Biol. 152, 911-922.
Lubarsky, B. and Krasnow, M. A. (2003). Tube morphogenesis: making and shaping biological tubes. Cell 112, 19-28.[CrossRef][Medline]
Montaville, P., Neumann, J. M., Russo-Marie, F., Ochsenbein, F. and Sanson, A. (2002). A new consensus sequence for phosphatidylserine recognition by annexins. J. Biol. Chem. 277, 24684-24693.
Nickel, W. (2003). The mystery of nonclassical protein secretion. A current view on cargo proteins and potential export routes. Eur. J. Biochem. 270, 2109-2119.[Medline]
Oka, Y. and Hirai, Y. (1996). Inductive influences of epimorphin on endothelial cells in vitro. Exp. Cell Res. 222, 189-198.[CrossRef][Medline]
Oka, Y., Sato, Y., Tsuda, H., Hanaoka, K., Hirai, Y. and Takahashi, Y. (2006). Epimorphin acts extracellularly to promote cell sorting and aggregation during the condensation of vertebral cartilage. Dev. Biol. 291, 25-37.[CrossRef][Medline]
Pelham, H. R. (1993). Is epimorphin involved in vesicular transport? Cell 73, 425-426.[CrossRef][Medline]
Prudovsky, I., Bagala, C., Tarantini, F., Mandinova, A., Soldi, R., Bellum, S. and Maciag, T. (2002). The intracellular translocation of the components of the fibroblast growth factor 1 release complex precedes their assembly prior to export. J. Cell Biol. 158, 201-208.
Prudovsky, I., Mandinova, A., Soldi, R., Bagala, C., Graziani, I., Landriscina, M., Tarantini, F., Duarte, M., Bellum, S., Doherty, H. et al. (2003). The non-classical export routes: FGF1 and IL-1alpha point the way. J. Cell Sci. 116, 4871-4881.
Ptitsyn, O. B. (1995). Molten globule and protein folding. Adv. Protein Chem. 47, 83-229.[Medline]
Qin, J., Takahashi, Y., Isuzugawa, K., Imai, M., Yamamoto, S., Hirai, Y. and Imakawa, K. (2005). Regulation of embryo outgrowth by a morphogenic factor, epimorphin, in the mouse. Mol. Reprod. Dev. 70, 455-463.[CrossRef][Medline]
Quinones, B., Riento, K., Olkkonen, V. M., Hardy, S. and Bennett, M. K. (1999). Syntaxin 2 splice variants exhibit differential expression patterns, biochemical properties and subcellular localizations. J. Cell Sci. 112, 4291-4304.[Abstract]
Radisky, D. C., Hirai, Y. and Bissell, M. J. (2003). Delivering the message: epimorphin and mammary epithelial morphogenesis. Trends Cell Biol. 13, 426-434.[CrossRef][Medline]
Rubartelli, A., Cozzolino, F., Talio, M. and Sitia, R. (1990). A novel secretory pathway for interleukin-1 beta, a protein lacking a signal sequence. EMBO J. 9, 1503-1510.[Medline]
Sakai, T., Larsen, M. and Yamada, K. M. (2003). Fibronectin requirement in branching morphogenesis. Nature 423, 876-881.[CrossRef][Medline]
Schanne, F. A., Kane, A. B., Young, E. E. and Farber, J. L. (1979). Calcium dependence of toxic cell death: a final common pathway. Science 206, 700-702.
Sieber, J. J., Willig, K. I., Heintzmann, R., Hell, S. W. and Lang, T. (2006). The SNARE motif is essential for the formation of syntaxin clusters in the plasma membrane. Biophys. J. 90, 2843-2851.[CrossRef][Medline]
Smirnova, T., Laroche, S., Errington, M. L., Hicks, A. A., Bliss, T. V. and Mallet, J. (1993a). Transsynaptic expression of a presynaptic glutamate receptor during hippocampal long-term potentiation. Science 262, 433-436.
Smirnova, T., Stinnakre, J. and Mallet, J. (1993b). Characterization of a presynaptic glutamate receptor. Science 262, 430-433.
Smrz, D., Draberova, L. and Draber, P. (2007). Non-apoptotic phosphatidylserine externalization induced by engagement of glycosylphosphatidylinositol-anchored proteins. J. Biol. Chem. 282, 10487-10497.
Squier, M. K., Sehnert, A. J., Sellins, K. S., Malkinson, A. M., Takano, E. and Cohen, J. J. (1999). Calpain and calpastatin regulate neutrophil apoptosis. J. Cell. Physiol. 178, 311-319.[CrossRef][Medline]
Takebe, K., Oka, Y., Radisky, D., Tsuda, H., Tochigui, K., Koshida, S., Kogo, K. and Hirai, Y. (2003). Epimorphin acts to induce hair follicle anagen in C57BL/6 mice. FASEB J. 17, 2037-2047.
Takebe, Y., Seiki, M., Fujisawa, J., Hoy, P., Yokota, K., Arai, K., Yoshida, M. and Arai, N. (1988). SR alpha promoter: an efficient and versatile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Mol. Cell. Biol. 8, 466-472.
Tarantini, F., LaVallee, T., Jackson, A., Gamble, S., Mouta Carreira, C., Garfinkel, S., Burgess, W. H. and Maciag, T. (1998). The extravesicular domain of synaptotagmin-1 is released with the latent fibroblast growth factor-1 homodimer in response to heat shock. J. Biol. Chem. 273, 22209-22216.
Tulachan, S. S., Doi, R., Hirai, Y., Kawaguchi, Y., Koizumi, M., Hembree, M., Tei, E., Crowley, A., Yew, H., McFall, C. et al. (2006). Mesenchymal epimorphin is important for pancreatic duct morphogenesis. Dev. Growth Differ. 48, 65-72.[CrossRef][Medline]
van den Eijnde, S. M., van den Hoff, M. J., Reutelingsperger, C. P., van Heerde, W. L., Henfling, M. E., Vermeij-Keers, C., Schutte, B., Borgers, M. and Ramaekers, F. C. (2001). Transient expression of phosphatidylserine at cell-cell contact areas is required for myotube formation. J. Cell Sci. 114, 3631-3642.[Medline]
Webb, S. E. and Miller, A. L. (2003). Calcium signalling during embryonic development. Nat. Rev. Mol. Cell Biol. 4, 539-551.[CrossRef][Medline]
Wickner, W. and Schekman, R. (2005). Protein translocation across biological membranes. Science 310, 1452-1456.
Yoshino, R., Miura, K., Segawa, D., Hirai, Y., Goto, T., Ohshima, S., Mikami, K., Yoneyama, K., Shibuya, T., Watanabe, D. et al. (2006). Epimorphin expression and stellate cell status in mouse liver injury. Hepatol. Res. 34, 238-249.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
Related articles in JCS:
This article has been cited by other articles:
![]() |
C. S. Chen, C. M. Nelson, D. Khauv, S. Bennett, E. S. Radisky, Y. Hirai, M. J. Bissell, and D. C. Radisky Homology with Vesicle Fusion Mediator Syntaxin-1a Predicts Determinants of Epimorphin/Syntaxin-2 Function in Mammary Epithelial Morphogenesis J. Biol. Chem., March 13, 2009; 284(11): 6877 - 6884. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. L. Chaffin Candida albicans Cell Wall Proteins Microbiol. Mol. Biol. Rev., September 1, 2008; 72(3): 495 - 544. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Torkko, A. Manninen, S. Schuck, and K. Simons Depletion of apical transport proteins perturbs epithelial cyst formation and ciliogenesis J. Cell Sci., April 15, 2008; 121(8): 1193 - 1203. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Maxwell, J. McCarthy, and E. Turley Cell-surface and mitotic-spindle RHAMM: moonlighting or dual oncogenic functions? J. Cell Sci., April 1, 2008; 121(7): 925 - 932. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Hirai, M. J. Bissell, and D. C. Radisky Extracellular localization of epimorphin/syntaxin-2 Blood, October 15, 2007; 110(8): 3082 - 3082. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||