spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 7 August 2007
doi: 10.1242/jcs.009613


Journal of Cell Science 120, 3034-3044 (2007)
Published by The Company of Biologists 2007
This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow All Versions of this Article:
jcs.009613v1
120/17/3034    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Faure, C.
Right arrow Articles by Girault, J.-A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Faure, C.
Right arrow Articles by Girault, J.-A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Research Article

Calcineurin is essential for depolarization-induced nuclear translocation and tyrosine phosphorylation of PYK2 in neurons

Camille Faure1,2,3,*, Jean-Christophe Corvol1,2,3,*, Madeleine Toutant1,2,3,*, Emmanuel Valjent1,2,3, Øivind Hvalby4, Vidar Jensen4, Said El Messari1,2,3, Jean-Marc Corsi1,2,3, Gress Kadaré1,2,3 and Jean-Antoine Girault1,2,3,{ddagger}

1 Inserm, U839, Paris F-75005, France
2 Université Pierre et Marie Curie, Paris F-75005, France
3 Institut du Fer à Moulin, Paris F-75005, France
4 Molecular Neurobiology Research Group, Institute of Basic Medical Sciences, University of Oslo, 0317 Oslo, Norway

{ddagger} Author for correspondence (e-mail: girault{at}fer-a-moulin.inserm.fr)

Accepted 25 June 2007


    Summary
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Proline-rich tyrosine kinase 2 (PYK2) is a non-receptor tyrosine kinase expressed in many cell types and enriched in neurons. PYK2 is a cytoplasmic enzyme activated by increases in cytosolic free Ca2+ through an unknown mechanism. We report that depolarization or electrical stimulation of hippocampal slices induced a rapid and transient nuclear accumulation of PYK2. Depolarization of cultured neurons or PC12 cells also triggered a Ca2+-dependent nuclear accumulation of PYK2, much more pronounced than that induced by blockade of nuclear export with leptomycin B. Src-family kinase activity, PYK2 autophosphorylation and kinase activity were not required for its nuclear translocation. Depolarization induced a slight decrease in PYK2 apparent molecular mass, compatible with a Ca2+-activated dephosphorylation. Pretreatment of PC12 cells with inhibitors of calcineurin (protein phosphatase 2B), cyclosporin A and FK506, prevented depolarization-induced nuclear translocation and tyrosine phosphorylation of PYK2. Transfection with dominant-negative and constitutively active calcineurin-A confirmed the role of calcineurin in the regulation of PYK2 tyrosine phosphorylation and nuclear accumulation. Our results show that depolarization independently induces nuclear translocation and tyrosine phosphorylation of PYK2, and that both responses require calcineurin activation. We suggest that PYK2 exerts some of its actions in the nucleus and that the effects of calcineurin inhibitors may involve PYK2 inhibition.

Key words: Tyrosine kinase, Protein phosphatase, Nucleus


    Introduction
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Proline-rich tyrosine kinase 2 (PYK2), also referred to as cell-adhesion kinase beta (CAKbeta) (Sasaki et al., 1995Go), RAFTK (Avraham et al., 1995Go) or CADTK (Yu et al., 1996Go), is a non-receptor tyrosine kinase, closely related to focal adhesion kinase (FAK). PYK2 is highly enriched in neurons and thought to play an important role in neuronal plasticity (Girault et al., 1999Go; Henley and Nishimune, 2001Go). PYK2 is phosphorylated on tyrosine after depolarization (Siciliano et al., 1996Go) and its activation appears to be necessary for the induction of LTP (Huang et al., 2001Go). In addition, PYK2 is activated in the hippocampus following brain ischemia and convulsions (Tian et al., 2000Go) suggesting a role in these pathologies. PYK2 is also involved in many other biological functions including activation of macrophages (Okigaki et al., 2003Go) and osteoclasts (Lakkakorpi et al., 2003Go), as well as in pathological conditions including cancer (Lipinski et al., 2003Go) and cardiac hypertrophy (Hirotani et al., 2004Go).

The most striking characteristic of PYK2 is its activation following increases in cytosolic free Ca2+ (Lev et al., 1995Go). The mechanism of this activation, however, is not understood. In many cell types activation of PYK2 appears to involve protein kinase C (PKC) (Lev et al., 1995Go; Siciliano et al., 1996Go) and, in some cases, a Ca2+-calmodulin-dependent protein kinase (Zwick et al., 1999Go). The phosphorylation reactions mediating directly or indirectly the activation of PYK2 remain to be identified. Increases in Ca2+ lead to PYK2 autophosphorylation on Tyr402, creating a Src-homology-2 (SH2) binding site that recruits Src family kinases, which phosphorylate other tyrosine residues of PYK2 and associated proteins (Dikic et al., 1996Go; Park et al., 2004Go). Interactions between the activated PYK2-Src module and proteins such as the Grb2-Sos complex, p130Cas, paxillin and Graf regulate multiple intracellular signaling pathways (reviewed by Avraham et al., 2000Go).

PYK2 possesses a C-terminal focal adhesion targeting (FAT) domain very similar to that of FAK (61% identity), although in most cells PYK2 is not enriched at focal contacts. Transfected PYK2 is generally expressed in the cytoplasm (Schaller and Sasaki, 1997Go; Zheng et al., 1998Go), whereas endogenous PYK2 can be observed in perinuclear punctuate structures (Sieg et al., 1998Go) or, for a fraction, at focal adhesions (Du et al., 2001Go). In neurons, PYK2 is mostly localized in perikarya and dendritic shafts (Corvol et al., 2005Go; Menegon et al., 1999Go). Although it is likely that PYK2 plays an important role in post-synaptic densities, because of its interaction with NMDA receptors and associated scaffold proteins (Bongiorno-Borbone et al., 2005Go; Cheung et al., 2000Go; Heidinger et al., 2002Go; Liu et al., 2001Go; Seabold et al., 2003Go), it does not appear to be enriched in spines. By contrast, deleted or mutated forms of PYK2 accumulate in the nucleus of transfected COS-7 cells (Aoto et al., 2002Go) and PYK2 is localized in the nucleus in chondrocytes and keratinocytes (Arcucci et al., 2006Go; Schindler et al., 2007Go). In rat brain, following ischemia or convulsions, PYK2 immunoreactivity appears to be in part nuclear (Tian et al., 2000Go). However, the significance of these observations is not known.


Figure 1
View larger version (35K):
[in this window]
[in a new window]

 
Fig. 1. Depolarization induces nuclear translocation of PYK2 in hippocampal slices, independently of Src-family kinases. (A) Rat hippocampal slices incubated in physiological conditions were placed for 2 minutes in high [K+]o (High K+, 40 mM) or normal [K+]o (Control) and immediately fixed. Slices were cut into 30-µm thick sections and stained with anti-PYK2 antibody and DAPI. Bars, 50 µm. (B) Quantification of the percentage of cells with PYK2-positive nuclei. Values are means ± s.e.m., six slices per condition, Student's t-test: ***P<0.001. (C) Time course of the effects of high [K+]o on nuclear localization of PYK2 immunoreactivity. High K+ or control solution was added between 0 and 2 minutes (horizontal bar) and then replaced by standard ACSF. Slices were fixed at the indicated times. Values are means ± s.e.m., two to five slices per data point. Two-way ANOVA: interaction between time and treatment F(3,28)=18.3, P<0.001, treatment effect F(1,28)=29.5, P<0.001, time effect F(3,28)=15.4, P<0.001. Point by point comparison with controls using the Bonferroni test: ***P<0.001. (D) Rat hippocampal slices were treated with vehicle or high [K+]o for 2 minutes in the absence or presence of a Src-family inhibitor, PP2 (20 µM, added 30 minutes before depolarization). Slice homogenates were blotted with a phosphotyrosine antibody (pY, top panel) or with an anti-phospho-Tyr418-Src antibody (p-Src, bottom panel). The positions of PYK2 (110 kDa, p110-PYK2) and Src (60 kDa, p60Src) are indicated. (E) Rat hippocampal slices were treated as in D and PYK2 localization analyzed by immunofluorescence. Bar, 50 µm. (F) Quantification of the percentage of cells with PYK2-positive nuclei in slices treated as in E. Values are means ± s.e.m., five to eight slices per group, one-way ANOVA: F(2,17)=49.1, P<0.001. Newman-Keuls test: ***P<0.001 compared with control.

 
We show here that depolarization induces PYK2 translocation to the nucleus of neurons and PC12 cells. PYK2 redistribution to the nucleus is independent of its tyrosine phosphorylation and tyrosine kinase activity. By contrast, inhibition of the Ser/Thr phosphatase calcineurin blocked both depolarization-induced PYK2 tyrosine phosphorylation and nuclear translocation, providing evidence of a key role of calcineurin in the regulation of PYK2.


    Results
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Depolarization induces nuclear translocation of PYK2 in CA1 hippocampal neurons independently of phosphorylation by Src family kinases
We and others previously reported that depolarization of hippocampal slices induces a robust tyrosine phosphorylation of PYK2 (Derkinderen et al., 1998Go; Huang et al., 2001Go; Siciliano et al., 1996Go). In this preparation, KCl-induced PYK2 phosphorylation peaked around 2 minutes and returned to a basal state in 20 minutes (Corvol et al., 2005Go). PYK2 phosphorylation at Tyr402 occurred primarily in cell bodies and dendritic shafts of hippocampal neurons (Corvol et al., 2005Go). In the course of these experiments, we noticed that depolarization induced an accumulation of PYK2 immunoreactivity in the nuclei of neurons and we undertook a systematic study of PYK2 localization in rat hippocampal slices by immunohistofluorescence.

In the absence of depolarization, there were few neurons with nuclear PYK2 immunoreactivity in the CA1 region of hippocampus (Fig. 1A). When the extracellular concentration of K+ ([K+]o) was raised by 40 mM for 2 minutes a striking accumulation of PYK2 was observed in the nuclei of neurons in CA1. Counting PYK2-immunoreactive nuclei showed that approximately 40% of nuclei were labeled in depolarized slices (Fig. 1B). PYK2 nuclear translocation was rapid and transient since it was observed within 2 minutes after the onset of depolarization and disappeared after 10 minutes (Fig. 1C).

Depolarization of hippocampal slices increases PYK2 autophosphorylation on Tyr402 and its phosphorylation by Src-family kinases (Corvol et al., 2005Go; Siciliano et al., 1996Go). We investigated the role of Src recruitment in the depolarization-induced nuclear translocation of PYK2, using PP2, a Src-family inhibitor that inhibits tyrosine phosphorylation of PYK2 in depolarized hippocampal slices, without altering phosphorylation of Tyr402 (Corvol et al., 2005Go). Pretreatment of hippocampal slices with PP2 decreased dramatically depolarization-induced PYK2 tyrosine phosphorylation and Src autophosphorylation (Fig. 1D). However, this treatment did not alter high [K+]o-induced PYK2 translocation to the nucleus (Fig. 1E,F), showing that Src-family kinases activation was not necessary for PYK2 redistribution.

Tetanic stimulation of afferent fibers induces PYK2 nuclear translocation in CA1 neurons
We next examined whether synaptic activation of neurons in response to electrical stimulation of afferent fibers (Schaeffer collaterals) in the CA1 region of mouse hippocampus altered PYK2 subcellular localization. In unstimulated slices, PYK2 immunoreactivity examined by confocal microscopy was localized mainly in the cytoplasm and dendritic shafts (Fig. 2A upper panel). After high [K+]o, PYK2 immunostaining in the nucleus was greater or equal to that in the cytoplasm in 75% of PYK2-immunoreactive cells (Fig. 2A upper panels, B). Electrical stimulation of afferent fibers of CA1 pyramidal cells (100 Hz for 1 second, four times at 10-second intervals) induced a potentiation of synaptic transmission (Fig. 2C) and triggered nuclear accumulation of PYK2 immunoreactivity (Fig. 2A,B). In the same experimental conditions, we studied phosphorylation of Tyr402, using phosphorylation state-specific antibodies (Fig. 2A lower panels). Virtually no immunofluorescence was observed in control slices, whereas a dramatic increase in pY402-PYK2 immunoreactivity was observed after high [K+]o-induced depolarization or electric stimulation of Schaeffer collaterals. Immunofluorescence was observed in dendrites and perikarya, but was more intense in the nuclei. These results revealed that synaptic activation of hippocampal pyramidal neurons, as well as direct depolarization, induced a nuclear translocation of PYK2 and that its autophosphorylated form also accumulated in the nucleus.


Figure 2
View larger version (87K):
[in this window]
[in a new window]

 
Fig. 2. Tetanic stimulation induces nuclear translocation of PYK2 in hippocampal slices. (A) Mouse hippocampal slices were incubated in physiological ACSF (Control) or treated with high [K+]o (High K+) as in Fig. 1, or subjected to a tetanic stimulation of the stratum radiatum (Schaeffer collaterals, 100 Hz, 4x 1 second, at 10-second intervals). Slices were prepared as in Fig. 1 and stained with an anti-PYK2 antibody or a phospho-specific antibody directed against pY402-PYK2. The CA1 region was analyzed by confocal microscopy (single optical sections are shown). Bars, 10 µm. (B) Quantification of the cells in which anti-PYK2 immunostaining in the nucleus (nuclear PYK2) was equal to or greater than in the cytoplasm. Values are means ± s.e.m., 12 slices per group, one-way ANOVA: F(2,33)=11.2, P<0.001. Newman-Keuls test: **P<0.01, ***P<0.001. (C) Tetanic stimulation of excitatory CA3-to-CA1 synapses potentiated synaptic transmission. Graph shows an example from one of the radiatum pathways. The slopes of the elicited field EPSPs were normalized to the mean value obtained 1 minute prior to tetanization (solid arrows). The slice was removed from the recording chamber 5 minutes after the repeated tetanization procedure and fixed. Inset: superimposed synaptic responses at times indicated by open arrows and numbers.

 
Depolarization induces a Ca2+-dependent nuclear translocation of PYK2 in hippocampal neurons in culture
To determine whether depolarization-induced PYK2 nuclear accumulation occurred in other experimental conditions we first used hippocampal neurons in primary culture. Analysis by fluorescence microscopy showed that high [K+]o induced the nuclear accumulation of PYK2 immunoreactivity (Fig. 3A). PYK2 subcellular distribution was predominantly cytoplasmic in ~70% of the neurons in primary cultures in basal conditions, whereas 3 minutes after depolarization, it was detected predominantly in the nucleus in ~85% of the neurons (Fig. 3B). This high [K+]o-induced nuclear accumulation of PYK2 was confirmed by confocal microscopy analysis (Fig. 3C). As the major consequence of depolarization is the opening of voltage-gated Ca2+ channels and the increase in intracellular Ca2+ levels, we examined if PYK2 nuclear translocation was Ca2+-dependent in hippocampal neurons in culture. Pretreatment with EGTA prevented the change in PYK2 localization (Fig. 3A,B), demonstrating that PYK2 nuclear translocation required Ca2+ entry.


Figure 3
View larger version (78K):
[in this window]
[in a new window]

 
Fig. 3. Depolarization induces Ca2+-dependent nuclear translocation of PYK2 in hippocampal neurons in culture. (A) Rat hippocampal neurons in culture treated with high [K+]o (High K+, 40 mM) or with a control solution for 3 minutes in the presence or absence of EGTA (5 mM, added 5 minutes before depolarization) and stained with an anti-PYK2 antibody were analyzed by fluorescence microscopy. Bars, 5 µm. (B) Quantification of the percentage of cells with nuclear PYK2. Values are means ± s.e.m. (six coverslips per group). Two-way ANOVA: interaction between depolarization and EGTA treatment F(1,20)=48.35, P<0.0001, depolarization effect F(3,20)=62.12, P<0.0001, EGTA treatment effect F(1,20)=77.28, P<0.0001. Newman-Keuls test: PYK2 control vs K+, ***P<0.001, PYK2 K+ vs (PYK2 + EGTA K+), °°°P<0.001. (C) Rat hippocampal neurons in culture treated with high [K+]o (High K+, 40 mM) or with a control solution for 3 minutes and stained with an anti-PYK2 antibody were analyzed by confocal microscopy. A single optical section is shown. Bars, 5 µm.

 

Depolarization induces nuclear accumulation of PYK2 in PC12 cells
We then used PC12 cells, a cell line with neuronal characteristics, to further investigate the mechanisms involved in the depolarization-induced nuclear translocation of PYK2 (Fig. 4A). Subcellular distribution of endogenous PYK2 was classified into three classes (n<c, n=c and n>c) depending on whether nuclear labeling intensity was less, equal or greater than cytoplasmic labeling, respectively. In this model, high [K+]o depolarization triggered PYK2 translocation, as evidenced by its colocalization with DAPI (Fig. 4A,B). Depolarization also increased pY402-PYK2 immunoreactivity, which was detected in the cytoplasm and nuclei of PC12 cells (Fig. 4C,D). As in hippocampal slices, in depolarized PC12 cells PP2 caused a dramatic decrease in tyrosine phosphorylation of PYK2 (supplementary material Fig. S1A,B) but did not alter high [K+]o-induced PYK2 translocation to the nucleus (supplementary material Fig. S1C,D).


Figure 4
View larger version (68K):
[in this window]
[in a new window]

 
Fig. 4. Depolarization induces nuclear accumulation of PYK2 in PC12 cells. (A) PC12 cells were treated with high [K+]o for 3 minutes or 11 ng/ml leptomycin B for 3 hours. Endogenous PYK2 was detected with an anti-PYK2 antibody and nuclei were stained with DAPI. Bars, 10 µm. (B) Percentage of cells with PYK2 immunoreactivity in the nucleus that was less than (n<c), equal to (n=c) or greater than (n>c) that in the cytoplasm. Values are means ± s.e.m., {chi}2=44.9, d.f.=4, P<0.0001, control vs K+ P<0.0001, control vs lepto B P<0.1, K+ vs lepto B P<0.0001. (C) Cells were immunostained with a pY402-PYK2 phospho-specific antibody and analyzed with confocal microscopy. Bars, 10 µm. (D) Quantification as in B was done for pTyr402-PYK2 immunoreactivity. Values are means ± s.e.m. {chi}2=623.2, d.f.=4, P<0.0001.

 

Many cytoplasmic proteins undergo a constant cyto-nuclear shuttling, which is unmasked by treatment with leptomycin B, an antibiotic blocking CRM1 (also known as exportin 1)-mediated nuclear export (Nishi et al., 1994Go). When PC12 cells were treated with leptomycin B for 3 hours, an increase in PYK2 nuclear staining was observed (Fig. 4A,B). However, quantification showed that the effects of leptomycin B on the nuclear accumulation of PYK2 were much weaker than those of depolarization (Fig. 4B).


Figure 5
View larger version (81K):
[in this window]
[in a new window]

 
Fig. 5. Depolarization induces Ca2+-dependent nuclear translocation of GFP-PYK2 in PC12 cells. (A) PC12 cells transfected with GFP-PYK2 were treated with high [K+]o (High K+) or control solution for 3 minutes in the presence or absence of EGTA (5 mM, added 5 minutes before depolarization). GFP-PYK2 fluorescence and nuclear staining with DAPI were analyzed by fluorescence microscopy. Bars, 10 µm. (B) Confocal sections showing the nuclear localization of PYK2. Bars, 10 µm. (C) Quantification of the percentage of cells with nuclear GFP-PYK2 (i.e. fluorescence in the nucleus that was stronger than or equal to that in the cytoplasm). Values are means ± s.e.m. (three to four coverslips per group). Two-way ANOVA: interaction between depolarization and EGTA treatment F(1,11)=10.2, P<0.01, depolarization effect F(1,11)=16.2, P<0.005, EGTA treatment effect F(1,11)=5.5, P<0.05. Newman-Keuls test: PYK2 control vs K+, **P<0.01, PYK2 K+ vs (PYK2 + EGTA K+), °°P<0.01.

 
Depolarization induces Ca2+-dependent nuclear translocation of GFP-PYK2 in PC12 cells independently of its autophosphorylation and kinase activity
We then studied the intracellular localization of a green fluorescent protein-PYK2 fusion protein (GFP-PYK2) in transfected PC12 cells. GFP-PYK2 was mainly cytoplasmic in normal [K+]o conditions, with no overlap with DAPI nuclear staining in most cells (Fig. 5A). By contrast, 3 minutes after high [K+]o, GFP-PYK2 fluorescence was partly colocalized with DAPI (Fig. 5A) and clearly located in the nucleus when viewed by confocal microscopy (Fig. 5B). Depolarization-induced nuclear translocation of GFP-PYK2 in PC12 cells was prevented by EGTA pretreatment (Fig. 5A,C). These results showed that GFP-PYK2 behaved like endogenous PYK2 in PC12 cells in response to depolarization.


Figure 6
View larger version (65K):
[in this window]
[in a new window]

 
Fig. 6. PYK2 redistribution in PC12 cells is independent of its autophosphorylation and kinase activity. (A) PC12 cells were transfected with wild-type GFP-PYK2 (WT, lanes 1, 2), GFP-PYK2 Y402F (Y402F, lanes 3, 4) or kinase-dead mutant K457A lanes (K457A, lanes 5, 6), and treated with control or depolarizing solution (K+ 40 mM) for 3 minutes. PYK2 was analyzed by immunoblotting (100 µg protein) with anti-pY402 antibody (upper panel) or with anti-PYK2 antibody (lower panel). (B) PC12 cells transfected with GFP-PYK2 WT, Y402F or K457A were treated with high [K+]o or control solution for 3 minutes. PYK2 immunoreactivity was analyzed by fluorescence microscopy. Bar, 10 µm. (C) Quantification of the percentage of cells with nuclear GFP-PYK2. Values are means ± s.e.m. (four coverslips per group). Two-way ANOVA: interaction between mutation and depolarization F(2,6)=2.1, P>0.05, depolarization effect F(1,6)=72.7, P<0.0001, mutation effect F(2,6)=1.1, P>0.05. Newman-Keuls test: WT control vs K+, **P<0.01, Y402F control vs K+, *P<0.05, K457A control vs K+, **P<0.01. (D) Homogenates (70 µg protein) from control or K+-treated PC12 cells were loaded on a 7% acrylamide gel. Note the downward shift induced by depolarization.

 
Our above results in hippocampal slices showed that PYK2 translocation was independent from Src-family kinases. To investigate the role of PYK2 autophosphorylation and kinase activity we used mutant GFP-PYK2, in which we replaced Tyr402 or Lys457, a critical ATP-binding residue, with Phe (Y402F) or Ala (K457A), respectively. Immunoblotting with anti-phospho-Tyr402-PYK2-specific antibody showed that high [K+]o induced a strong phosphorylation of wild-type GFP-PYK2-Tyr402 (Fig. 6A), whereas this phosphorylation was abolished in GFP-PYK2-Y402F and GFP-PYK2-K457A (Fig. 6A). In the same samples, Tyr402 in endogenous PYK2 was weakly phosphorylated in response to depolarization in all cases (Fig. 6A). Although the total amounts of endogenous PYK2 and GFP-PYK2 were similar, Tyr402 phosphorylation of GFP-PYK2 appeared stronger. A possible explanation is that PYK2 concentration was higher in transfected cells, which were only 5-10% of the total. This high concentration is expected to favor autophosphorylation that occurs through an intermolecular mechanism (Park et al., 2004Go).

We then examined the subcellular localization of transfected wild-type or mutant GFP-PYK2 fusion proteins in response to depolarization (Fig. 6B). Wild type, Y402F and K457A GFP-PYK2 displayed a similar nuclear translocation after K+ depolarization (Fig. 6B,C), demonstrating that PYK2 autophosphorylation and kinase activity are not necessary for depolarization-induced PYK2 nuclear translocation.

In the course of these experiments, we noticed on immunoblots a slight downward shift of the endogenous PYK2 band in samples from K+-treated cells (Fig. 6A, see also Fig. 1D in slices). To further investigate this observation, small amounts of protein from control or K+-treated PC12 cells were loaded on a 7% acrylamide-bisacrylamide gel and migration time was increased. This resulted in a distinct shift of endogenous PYK2 in depolarized PC12 cells, towards a lower apparent molecular mass (Fig. 6D). Several mechanisms could account for this accelerated gel mobility, including dephosphorylation. As depolarization induces a marked increase in PYK2 tyrosine phosphorylation, such dephosphorylation would be expected to occur on Ser/Thr residues.


Figure 7
View larger version (44K):
[in this window]
[in a new window]

 
Fig. 7. Depolarization-induced phosphorylation and nuclear translocation of PYK2 are abolished by cyclosporin A (CsA) and FK506. (A) PC12 cells were treated with high [K+]o (High K+ 40 mM) or control solution for 3 minutes in the absence or presence of cyclosporin A (10 µM, added 30 minutes prior to depolarization). Endogenous PYK2 was immunoprecipitated and analyzed by immunoblotting with anti-P-Tyr antibody (pY, upper panel). Whole cell lysates were analyzed by immunoblotting with PYK2 antibody (lower panel). (B) Quantification of pY-PYK2 in A. Values are means ± s.e.m. (three per group). One-way ANOVA: F(2,6)=65.8, P<0.0001. Newman-Keuls test: control vs K+, ***P<0.001, (CsA + K+) vs K+, °°°P<0.001. (C) PC12 cells transfected with GFP-PYK2 were treated as in A and PYK2 immunofluorescence was analyzed by fluorescence microscopy. Bars, 10 µm. (D) Quantification of results in C. Values are means ± s.e.m. (three per group). One-way ANOVA: F(2,6)=18.8, P<0.05. Newman-Keuls test: control vs K+, *P<0.05, (CsA + K+) vs K+, °P<0.05. (E) PC12 cells were treated as in A, except that FK506 (FK506 1 µM, added 30 minutes prior to depolarization) was used instead of cyclosporin A. Endogenous PYK2 was immunoprecipitated and analyzed by immunoblotting with anti-P-Tyr antibody (pY, upper panel). Whole cell lysates were analyzed by immunoblotting for pY402-PYK2 (middle panel) or PYK2 (lower panel). (F) Quantification of pY-PYK2 in E. Values are means ± s.e.m. (three per group). One-way ANOVA: F(2,6)=153.1, P<0.0001. Newman-Keuls test: control vs K+, ***P<0.001, (FK506 + K+) vs K+, °°°P<0.001. (G) Quantification of pY402-PYK2 in E. Values are means ± s.e.m. (three per group). One-way ANOVA: F(2,6)=162.2, P<0.0001. Newman-Keuls test: control vs K+, ***P<0.001, (FK506 + K+) vs K+, °°°P<0.001. (H) PC12 cells transfected with GFP-PYK2 were treated as in E and PYK2 immunofluorescence was analyzed by fluorescence microscopy. Bars, 10 µm. (I) Quantification of results in H. Values are means ± s.e.m. (three per group). One-way ANOVA: F(2,6)=166.2, P<0.0001. Newman-Keuls test: control vs K+, ***P<0.001, (FK506 + K+) vs K+, °°°P<0.001.

 
Pharmacological inhibition of calcineurin prevents depolarization-induced tyrosine phosphorylation and nuclear translocation of PYK2 in PC12 cells
Depolarization-induced Ca2+ influx can activate protein phosphatase 2B, also known as calcineurin, a Ser/Thr phosphatase regulated by Ca2+ and calmodulin. To test whether calcineurin might be involved in the activation of PYK2, we used cyclosporin A, a potent calcineurin inhibitor (Liu et al., 1991Go). Pretreatment of PC12 cells with cyclosporin A (10 µM, 30 minutes) had no effect by itself (data not shown) but dramatically decreased depolarization-induced PYK2 tyrosine phosphorylation (Fig. 7A,B). We then examined the effects of cyclosporin A pretreatment on PYK2 intracellular localization (Fig. 7C). Pretreatment of PC12 cells with cyclosporin A before depolarization prevented PYK2 nuclear translocation (Fig. 7C,D).

In order to rule out a non-calcineurin-mediated effect of cyclosporin A, we used FK506 an immunosuppressant structurally unrelated to cyclosporin A, which inhibits calcineurin by interacting with a different immunophilin (Rusnak and Mertz, 2000Go). Pretreatment of PC12 cells with FK506 (1 µM, 30 minutes before high K+) prevented the depolarization-induced increase in endogenous PYK2 tyrosine phosphorylation (Fig. 7E,F) and specifically the phosphorylation of Tyr402 (Fig. 7E,G). Depolarization-induced translocation of GFP-PYK2 was also completely prevented in FK506-pretreated PC12 cells (Fig. 7H,I). Similar results were obtained with hippocampal slices pretreated with FK506 (supplementary material Fig. S2). Since we have shown above that nuclear translocation of PYK2 did not require its tyrosine phosphorylation, these results strongly indicate that Ca2+-induced activation of calcineurin is necessary for two independent events, the autophosphorylation of PYK2 and subsequent recruitment of Src-family kinases, and the nuclear translocation of PYK2.

Depolarization-induced tyrosine phosphorylation of PYK2 is prevented by a dominant-negative form of calcineurin
Calcineurin is a heterodimer of a catalytic (CnA) subunit and a regulatory (CnB) subunit (Klee et al., 1998Go). CnA encompasses several domains: a catalytic domain, a CnB-binding domain, a calmodulin-binding domain and an autoinhibitory domain. To test the role of calcineurin in PYK2 tyrosine phosphorylation we used a Flag-tagged CnA construct (1-397) deleted from its autoinhibitory domain and bearing a point mutation in its catalytic site (H151Q, phosphatase-dead, PD-CnA) which behaves as a dominant-negative inhibitor of calcineurin (Kahl and Means, 2004Go). We co-transfected GFP-PYK2 and PD-CnA or vector, and cells were treated with a control solution or a high [K+]o depolarizing solution (Fig. 8). Depolarization-induced tyrosine phosphorylation of GFP-PYK2 was dramatically decreased in PD-CnA co-transfected cells (Fig. 8A,B). Since cotransfection of PD-CnA slightly decreased the expression of GFP-PYK2, we normalized the amount of tyrosine-phosphorylated GFP-PYK2 to the amount of total GFP-PYK2 protein: depolarization-induced increase in tyrosine phosphorylation was 80±18% in mock-cotransfected cells and 24±3% in PD-CnA-cotransfected cells. Thus, these results strongly supported the implication of endogenous calcineurin in this response.


Figure 8
View larger version (40K):
[in this window]
[in a new window]

 
Fig. 8. Depolarization-induced tyrosine phosphorylation of PYK2 is prevented by a dominant negative form of calcineurin. (A) PC12 cells transfected with GFP-PYK2 in the absence or presence of Flag-PD-CnA (phosphatase-dead calcineurin A) were treated with a depolarizing (High K+ 40 mM; +) or control (–) solution for 3 minutes. PYK2 tyrosine phosphorylation was analyzed by immunoblotting with an anti-P-Tyr antibody (pY, upper panel) and with an anti-PYK2 antibody (middle panel). The presence of Flag-PD-CnA was detected by Flag immunoblotting (lower panel). (B) Quantification of pY-PYK2 in A. Values are means ± s.e.m., of six cultures per group in two independent experiments. Two-way ANOVA: interaction between depolarization and PD-CnA co-transfection F(1,16)=5.3, P<0.05, depolarization effect F(1,16)=8.5, P<0.05, PD-CnA co-transfection effect F(1,16)=5.5, P<0.01. Newman-Keuls test: control vs K+, **P<0.01, PD-CnA K+ vs K+, °°°P<0.001.

 
Transfection of mutated forms of calcineurin alters localization of endogenous PYK2
We then investigated the role of calcineurin in PYK2 nuclear translocation by examining the effects of constitutively active CnA (1-397, Flag-CA-CnA) or phosphatase-dead CnA (Flag-PD-CnA) on endogenous localization of PYK2 in PC12 cells (Fig. 9A). These two plasmids gave similar levels of Flag-protein expression (Fig. 9B). PC12 cells were transfected with Flag-PD-CnA, Flag-CA-CnA or, as control, an unrelated protein subcloned into the same expression vector (Flag-protein), and treated or not with high [K+]o. Endogenous PYK2 localization was examined by immunofluorescence in the Flag-positive cells. In PC12 cells transfected with Flag-PD-CnA the effects of K+ on PYK2 nuclear translocation were markedly decreased as compared with Flag-protein-transfected control cells, showing that inhibition of endogenous calcineurin altered PYK2 nuclear translocation (Fig. 9A,C). By contrast, in cells transfected with CA-CnA, we observed an increase in the number of cells with nuclear PYK2, in the absence of depolarization (Fig. 9A,C). High [K+]o did not further increase that proportion. These results showed that blockade of calcineurin with a dominant-negative mutant prevented depolarization-induced PYK2 nuclear accumulation, whereas a constitutively active mutant of calcineurin was sufficient to trigger that translocation.


Figure 9
View larger version (46K):
[in this window]
[in a new window]

 
Fig. 9. The role of calcineurin in nuclear translocation of PYK2. (A) PC12 cells were transfected with a tagged control protein (Flag-protein, FP), a phosphatase-dead form of calcineurin A (Flag-PD-CnA), or a constitutively active calcineurin A (Flag-CA-CnA) and treated for 3 minutes with a control or depolarizing (High K+, 40 mM) solution. Immunofluorescence was analyzed for Flag (left), PYK2 (middle) and merged with DAPI (right). Bars, 10 µm. (B) Control of expression levels of Flag-PD-CnA or Flag-CA-CnA by immunoblotting with an anti-Flag antibody. (C) Quantification of results in A. Values are means ± s.e.m. (four to six per group). Two-way ANOVA: interaction between depolarization and transfection F(2,26)=14.6, P<0.0001, depolarization effect F(1,26)=44.5, P<0.0001, transfection effect F(1,26)=26.3, P<0.0001. Newman-Keuls test: FP control vs FP K+, ***P<0.001, PD-CnA K+ vs FP K+, {blacktriangleup}{blacktriangleup}{blacktriangleup}P<0.001, CA-CnA control vs FP control, °°P<0.01, CA-CnA K+ vs FP K+, {blacktriangleup}{blacktriangleup}P<0.01.

 


    Discussion
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Although the non-receptor tyrosine kinase PYK2 was initially described as a cytoplasmic protein, activated by increases in cytosolic free Ca2+ (Avraham et al., 1995Go; Sasaki et al., 1995Go; Yu et al., 1996Go), in some cells, PYK2 immmunoreactivity is nuclear (Arcucci et al., 2006Go; Schindler et al., 2007Go; Tian et al., 2000Go). The significance of these observations was not clear and our results provide the first evidence for a physiological translocation of PYK2 from the cytoplasm to the nucleus since we show that depolarization or electrical stimulation induced a nuclear accumulation of PYK2 in hippocampal slices. We observed similar effects in neurons and PC12 cells in culture. Several proteins that appear to be located in the cytoplasm undergo a constant cyto-nuclear shuttling, revealed by treatment with leptomycin B, an antibiotic blocking CRM1/exportin1-mediated nuclear export (Nishi et al., 1994Go). The effects of leptomycin B on PYK2 nuclear accumulation were weak, indicating that PYK2 undergoes a limited basal CRM1-dependent nucleo-cytoplasmic shuttling in PC12 cells. In COS-7 cells, a more pronounced nuclear accumulation of transfected PYK2 after treatment with leptomycin B has been reported (Aoto et al., 2002Go), suggesting that high levels of expression of PYK2 may facilitate its nuclear accumulation, perhaps by saturating cytoplasmic anchors for this protein. In PC12 cells, depolarization-induced nuclear accumulation of PYK2 was rapid (2-3 minutes), transient, and more intense than following leptomycin B. Thus the effects of depolarization on PYK2 subcellular localization are unlikely to result only from an interference with CRM1-mediated nuclear export. Although we cannot exclude that PYK2 also undergoes a CRM1-independent nuclear export, these results suggest that depolarization acts by releasing PYK2 from a cytoplasmic anchor and/or by promoting its nuclear import.

Increases in cytosolic free Ca2+ trigger PYK2 autophosphorylation and the recruitment of Src family kinases, which in turn phosphorylate multiple tyrosines of PYK2 (Lev et al., 1995Go). Since nuclear translocation of PYK2 was also Ca2+-dependent and PYK2 activation and nuclear translocation occurred concomitantly, we tested whether nuclear translocation involved PYK2 tyrosine phosphorylation. Clearly, PYK2 nuclear translocation did not require its tyrosine phosphorylation. By contrast, nuclear translocation of PYK2 was prevented by pretreatment of PC12 cells with two calcineurin inhibitors, cyclosporin A and FK506, which act through binding to different immunophilins. Calcineurin inhibition also blocked depolarization-induced PYK2 tyrosine autophosphorylation and subsequently tyrosine phosphorylation by Src family kinases. The role of calcineurin was confirmed by transfection of dominant-negative or constitutively active forms of this enzyme in PC12 cells. These results strongly indicate that Ca2+-activated calcineurin simultaneously triggers two independent events: autophosphorylation of PYK2 on Tyr402 and nuclear translocation of PYK2. As tyrosine phosphorylation of PYK2 is not necessary for its nuclear translocation, it is likely that calcineurin acts upstream from these two events.

Cyto-nuclear shuttling of many proteins is regulated by Ser/Thr phosphorylation events (Poon and Jans, 2005Go). A well characterized example is the translocation of the nuclear factor of activated T cells (NFAT) triggered by calcineurin-mediated dephosphorylation of Ser/Thr residues located near a nuclear localization sequence (Crabtree and Olson, 2002Go). Our results reveal that calcineurin also plays a critical role in the regulation of PYK2 nuclear redistribution. Calcineurin may dephosphorylate Ser/Thr residues in PYK2 or in associated proteins. PYK2, as the related FAK, contains many potential serine and threonine phosphorylation sites, some of which are known to be phosphorylated (Grigera et al., 2005Go; Wissing et al., 2006Go). Regulation of PYK2 by serine/threonine phosphorylation is likely to be complex since several protein kinases including protein kinase C and Ca2+-calmodulin-dependent kinases appear to be involved (Lev et al., 1995Go; Siciliano et al., 1996Go; Zwick et al., 1999Go). The mechanism of action of dephosphorylation can only be speculative at this time. In transfected COS-7 cells nuclear accumulation of PYK2 was promoted by mutation of Pro859 to Ala (Aoto et al., 2002Go), whereas in chondrocytes a N-terminally truncated form of PYK2 was detected in the nucleus (Arcucci et al., 2006Go). Possible interpretations of these findings are that mutation or truncation releases PYK2 from a cytoplasmic anchor and/or modifies the exposition of nuclear localization sequences. Our results suggest that such processes could be triggered by Ser/Thr dephosphorylation, in response to a physiological stimulus raising intracellular Ca2+. PYK2 does not have a canonical nuclear localization sequence, indicating that its nuclear import involves a different targeting motif or association with other proteins. Studies are in progress to clarify these issues.

Altogether, our results provide novel information regarding PYK2 regulation and function. Although this tyrosine kinase was initially described as activating cytoplasmic signaling pathways, our results show that it may have an important function in the nucleus. Interestingly, in keratinocytes PYK2 is constitutively nuclear and appears to be involved in Jun-D and Fra1 expression (Schindler et al., 2007Go). It has also been reported that PYK2 and calcineurin are involved in the control of serum response element by muscarinic receptors (Lin et al., 2002Go). Thus, it is tempting to speculate that, in neurons, PYK2 regulates nuclear functions important for long-lasting plasticity, in response to Ca2+ entry. Interestingly, the related kinase FAK can also undergo a nuclear translocation in some specific conditions or cell types (Yi et al., 2006Go), and can be sumoylated (Kadare et al., 2003Go), a post-translational modification which usually takes place in the nucleus. These observations suggest that PYK2 and possibly FAK, under specific circumstances, play a role in the control of nuclear functions such as RNA transcription or processing.

Another important implication of the present study is that inhibition of PYK2 must be considered among the relevant targets of calcineurin inhibitors. These drugs are powerful and useful immunosuppressants, known to act by preventing NFAT activation in lymphocytes. As PYK2 is involved in maturation of specific B cell populations (Guinamard et al., 2000Go) and in macrophage activation (Okigaki et al., 2003Go), prevention of its activation through inhibition of calcineurin may contribute to the immunosuppressive effects of FK506 and cyclosporin A. Interestingly calcineurin inhibitors have also been reported to exert protective effects in cardiac hypertrophy, attributed to NFAT activation (Heineke and Molkentin, 2006Go). As PYK2 is also a critical player in some forms of cardiac hypertrophy (Hirotani et al., 2004Go), our results raise the intriguing possibility that some of the cardioprotective effects of calcineurin inhibitors are mediated by PYK2 inhibition. Finally, it should be pointed out that FK506 or cyclosporin A may possibly be a useful means of indirectly inhibiting PYK2 activation in pathological conditions, including osteoclastic bone resorption and in some cancers.


    Materials and Methods
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Reagents
4-Amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo[3,4-d]pyrimidine (PP2), leptomycin B, and cyclosporin A were from Calbiochem. Anti-phosphotyrosine (4G10) mouse monoclonal antibody (blot: 1:4000) was from Upstate Biotechnology. Affinity purified rabbit antibodies anti-PYK2 residues 2–18 (blot: 1:200) were described previously (Siciliano et al., 1996Go). Affinity-purified rabbit anti-phospho-Tyr402-PYK2 antibodies (blot: 1:1000) and affinity-purified rabbit anti-phospho-Tyr418-Src antibodies (blot: 1:2500) were from Biosource. Anti-flag M2 mouse monoclonal antibody was from Sigma (blot: 1:1000, immunofluorescence: 1:250). Alexa Fluor 488- or Cy3-coupled secondary antibodies (1:400) were from Molecular Probes.

Mouse hippocampal slices for electrophysiology
Hippocampal slices were prepared from desflurane-anesthetized B6CBA mice (older than 60 days). Transverse slices (400 µm) were cut from the middle portion of each hippocampus with a vibroslicer in artificial cerebrospinal fluid (ACSF, 4°C, bubbled with 95% O2 and 5% CO2, pH 7.4), placed in a humidified interface chamber at 30±1°C and perfused with ACSF containing 2 mM CaCl2. Orthodromic stimuli (50 µseconds, <300 µA, 0.1 Hz) were delivered alternately through two tungsten electrodes, in the stratum radiatum of the CA1 region. Extracellular synaptic responses were monitored by two ACSF-filled glass electrodes placed in the corresponding synaptic layers. After obtaining stable synaptic responses in both pathways (0.1 Hz stimulation) for at least 10-15 minutes, the slices were exposed to one of the following three procedures: (1) in the control group synaptic responses were monitored during low frequency stimulation (0.1 Hz) to ascertain the viability of the slices and fixed; (2) in the high [K+]out group, synaptic responses were monitored before and during exposure to 40 mM K+; (3) in the tetanization group synaptic responses were monitored before and 4-6 minutes following a tetanization procedure, which consisted of 1-second 100 Hz stimulation given four times (10-second interval) alternatively to each of the radiatum pathways. The stimulation strength used for tetanization was well above threshold for generation of a population spike in response to a single test shock. Synaptic efficacy was assessed by measuring the slope of the synaptic field excitatory post-synaptic potentials (fEPSPs) in the middle third of their rising phase, and normalized to stable control recordings. At the end of the recordings, slices were fixed as described below.

Immunofluorescent staining of hippocampal slices
Rat hippocampal slices (300 µm) were prepared from young male Sprague-Dawley rats (100–150 g) with a McIlwain tissue chopper and incubated as previously described (Corvol et al., 2005Go; Siciliano et al., 1996Go). Slices from rat or mouse were placed in paraformaldehyde (4% weight/vol.) in PBS at 4°C overnight, and then stored at 4°C in PBS. Sections (30-µm) were cut with a microtome (Leica) from agarose-embedded slices and kept at –20°C in a solution containing 30% ethylene glycol, 30% glycerol, and 0.1 M phosphate buffer. Immunolabeling procedures were as described previously (Valjent et al., 2000Go) using Alexa Fluor 488- or Cy3-coupled secondary antibodies. Sections were mounted in Vectashield with 4{alpha}, 6-diamidino-2-phenylindole (DAPI) counterstain (Vector Laboratories) and studied using laser scanning confocal microscopy (SP2, Leica).

Cell cultures
Low-density primary cultures of hippocampal neurons were prepared from rat embryos (E18). Hippocampal cells were dissociated and plated at a density of 20,000/cm2 on polylysine-coated glass coverslips in Neurobasal-B27 (Neurobasal, Invitrogen). PC12 cells were grown on type I collagen-coated dishes (BD Biosciences) in RPMI medium (GIBCO) containing 10% horse serum, 5% fetal calf serum. Transfections were done with Lipofectamine 2000 (Invitrogen). For fluorescence analysis, PC12 cells were grown in RPMI on type I collagen-coated glass coverslips after incubation with poly-L-lysine (Sigma). For 40 mM K+-induced depolarization of cells in culture, half of the cell culture medium was removed and replaced for 3 minutes by a solution containing 1 mM MgCl2, 2 mM CaCl2, 25 mM Hepes and either 135 mM NaCl, (control solution), or 55 mM NaCl, 80 mM KCl (high [K+]o). In both cases, the osmolarity of the solution remained 300 mOsm/l.

Cell cultures immunofluorescence
Cells were fixed for 15 minutes in a solution containing 4% (weight/vol) paraformaldehyde, permeabilized on ice with methanol-acetone (vol./vol.) for 12 minutes. Cells were washed with PBS, blocked and incubated for 2 hours with primary antibodies [anti-PYK2 antibody (1/100), anti-phospho-Tyr402 (1/200) and mouse anti-flag M2 monoclonal antibody (1/250)]. After washes, cells were incubated with Alexa Fluor 488- or Cy3-coupled secondary antibodies (1/400) for 45 minutes, washed and mounted in Vectashield with DAPI. PC12 cells transfected with GFP-PYK2 constructs were fixed, washed and mounted in Vectashield with DAPI. Images were acquired with a digital camera CCD Micromax (Roper Scientific) or with a confocal microscope Leica SP2.

Immunoprecipitation and immunoblot analysis
PC12 cells were lysed on ice, in RIPA buffer [1% Triton X-100, 0.5% (weight/vol.) deoxycholate, 0.1% (weight/vol.) SDS, 50 mM Tris (pH 7.4), 150 mM NaCl, 1 mM sodium orthovanadate, 50 mM NaF, 10 mM sodium pyrophosphate and protease inhibitors (Complete Boehringer 1/20)]. Immunoprecipitations and immunoblot were carried out as described previously (Derkinderen et al., 2001Go). Quantifications were carried out by scanning the autoradiograms and measuring relative optical density with Scion Image software, or by direct measurement using the Odyssey imaging system (Li-Cor Bioscences, Lincoln, NE). Data were normalized to the mean value of untreated controls in the same autoradiograms.

Cloning and directed mutagenesis
A plasmid encoding the N terminus of rat PYK2 (1-364) was fused to green fluorescent protein by ligating the BamHI-SalI fragment of PYK2 into the BglII-SalI sites of pEGFP-C1 (Clontech). Full-length PYK2 was obtained by ligating the ScaI-BamHI fragment of PYK2 into the ScaI-BamHI sites of this construct. The Y402F and K457A mutants of PYK2 were prepared by site-directed mutagenesis (QuikChange, Stratagene). The HindIII fragment of PYK2 was subcloned into the HindIII site of pBlueScript KS (Fermentas). Oligonucleotides to change Y402 to phenylalanine and K457 to alanine were GCATAGAGTCAGACATCTTTGCAGAGATTCCTGATGAGACCC and GGGAAAAAATTAATGTGGCCGTCGCGACCTGTAAGAAAGATTGTACCC, respectively. Mutations were verified by DNA sequencing. Plasmids encoding constitutively active calcineurin A (CnA) (residues 1-397, CA-CnA), and mutated CnA (H151Q) were a gift from A. Means and were subcloned into the BglII-SmaI sites of FLAG-CMV2 expression vector (Sigma). The H151Q CnA mutant was truncated and the phosphatase-dead form used in the study was PD-CnA 1-397 H151Q.

Quantifications and statistical analysis
Cells were classified in three categories by observers blind to the treatment: cytoplasmic fluorescence more intense than nuclear fluorescence (c>n), cytoplasmic equal to nuclear fluorescence (c=n) or cytoplasmic inferior to nuclear fluorescence (c<n). The boundaries of the nuclei were determined by DAPI staining. The percentage of cells in each category was determined for each coverslip (approximately 50-100 cells per coverslip in 10-20 fields). Data are from at least three independent experiments each in duplicate. Statistical analysis was done using GraphPad Prism 3.02.


    Acknowledgments
 
This work was supported in part by Inserm, UPMC, and grants ACI-BCMS from the Ministry of Research, Appel non thématisé from Agence Nationale de la Recherche (ANR), and Association pour la Recherche contre le Cancer (ARC). The authors thank A. Means and M. Sanchez Matamales for providing constructs.


    Footnotes
 
Supplementary material available online at http://jcs.biologists.org/cgi/content/full/120/17/3034/DC1

* These authors contributed equally to this work Back


    References
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 

Aoto, H., Sasaki, H., Ishino, M. and Sasaki, T. (2002). Nuclear translocation of cell adhesion kinase beta/proline-rich tyrosine kinase 2. Cell Struct. Funct. 27, 47-61.[CrossRef][Medline]

Arcucci, A., Montagnani, S. and Gionti, E. (2006). Expression and intracellular localization of Pyk2 in normal and v-src transformed chicken epiphyseal chondrocytes. Biochimie 88, 77-84.[Medline]

Avraham, S., London, R., Fu, Y. G., Ota, S., Hiregowdara, D., Li, J. Z., Jiang, S. X., Pasztor, L. N., White, R. A., Groopman, J. E. et al. (1995). Identification and characterization of a novel related adhesion focal tyrosine kinase (RAFTK) from megakaryocytes and brain. J. Biol. Chem. 270, 27742-27751.[Abstract/Free Full Text]

Avraham, H., Park, S. Y., Schinkmann, K. and Avraham, S. (2000). RAFTK/Pyk2-mediated cellular signalling. Cell. Signal. 12, 123-133.[CrossRef][Medline]

Bongiorno-Borbone, L., Kadare, G., Benfenati, F. and Girault, J. A. (2005). FAK and PYK2 interact with SAP90/PSD-95-associated protein-3. Biochem. Biophys. Res. Commun. 337, 641-646.[CrossRef][Medline]

Cheung, H. H., Takagi, N., Teves, L., Logan, R., Wallace, M. C. and Gurd, J. W. (2000). Altered association of protein tyrosine kinases with postsynaptic densities after transient cerebral ischemia in the rat brain. J. Cereb. Blood Flow Metab. 20, 505-512.[CrossRef][Medline]

Corvol, J. C., Valjent, E., Toutant, M., Enslen, H., Irinopoulou, T., Lev, S., Herve, D. and Girault, J. A. (2005). Depolarization activates ERK and proline-rich tyrosine kinase 2 (PYK2) independently in different cellular compartments in hippocampal slices. J. Biol. Chem. 280, 660-668.[Abstract/Free Full Text]

Crabtree, G. R. and Olson, E. N. (2002). NFAT signaling: choreographing the social lives of cells. Cell 109, S67-S79.[CrossRef][Medline]

Derkinderen, P., Siciliano, J., Toutant, M. and Girault, J. A. (1998). Differential regulation of FAK+ and PYK2/Cakbeta, two related tyrosine kinases, in rat hippocampal slices: effects of LPA, carbachol, depolarization and hyperosmolarity. Eur. J. Neurosci. 10, 1667-1675.[CrossRef][Medline]

Derkinderen, P., Toutant, M., Kadaré, G., Ledent, C., Parmentier, M. and Girault, J. A. (2001). Dual role of Fyn in the regulation of FAK+6,7 by cannabinoids in hippocampus. J. Biol. Chem. 276, 38289-38296.[Abstract/Free Full Text]

Dikic, I., Tokiwa, G., Lev, S., Courtneidge, S. A. and Schlessinger, J. (1996). A role for Pyk2 and Src in linking G-protein-coupled receptors with MAP kinase activation. Nature 383, 547-550.[CrossRef][Medline]

Du, Q. S., Ren, X. R., Xie, Y., Wang, Q., Mei, L. and Xiong, W. C. (2001). Inhibition of PYK2-induced actin cytoskeleton reorganization, PYK2 autophosphorylation and focal adhesion targeting by FAK. J. Cell Sci. 114, 2977-2987.[Medline]

Girault, J. A., Costa, A., Derkinderen, P., Studler, J. M. and Toutant, M. (1999). FAK and PYK2/CAK in the nervous system, a link between neuronal activity, plasticity and survival? Trends Neurosci. 22, 257-263.[CrossRef][Medline]

Grigera, P. R., Jeffery, E. D., Martin, K. H., Shabanowitz, J., Hunt, D. F. and Parsons, J. T. (2005). FAK phosphorylation sites mapped by mass spectrometry. J. Cell Sci. 118, 4931-4935.[Free Full Text]

Guinamard, R., Okigaki, M., Schlessinger, J. and Ravetch, J. V. (2000). Absence of marginal zone B cells in Pyk-2-deficient mice defines their role in the humoral response. Nat. Immunol. 1, 31-36.[CrossRef][Medline]

Heidinger, V., Manzerra, P., Wang, X. Q., Strasser, U., Yu, S. P., Choi, D. W. and Behrens, M. M. (2002). Metabotropic glutamate receptor 1-induced upregulation of NMDA receptor current: mediation through the Pyk2/Src-family kinase pathway in cortical neurons. J. Neurosci. 22, 5452-5461.[Abstract/Free Full Text]

Heineke, J. and Molkentin, J. D. (2006). Regulation of cardiac hypertrophy by intracellular signalling pathways. Nat. Rev. Mol. Cell Biol. 7, 589-600.[CrossRef][Medline]

Henley, J. M. and Nishimune, A. (2001). CAKbeta/Pyk2 activates Src: another piece in the puzzle of LTP induction. Neuron 29, 312-314.[CrossRef][Medline]

Hirotani, S., Higuchi, Y., Nishida, K., Nakayama, H., Yamaguchi, O., Hikoso, S., Takeda, T., Kashiwase, K., Watanabe, T., Asahi, M. et al. (2004). Ca(2+)-sensitive tyrosine kinase Pyk2/CAK beta-dependent signaling is essential for G-protein-coupled receptor agonist-induced hypertrophy. J. Mol. Cell. Cardiol. 36, 799-807.[CrossRef][Medline]

Huang, Y., Lu, W., Ali, D. W., Pelkey, K. A., Pitcher, G. M., Lu, Y. M., Aoto, H., Roder, J. C., Sasaki, T., Salter, M. W. et al. (2001). CAKbeta/Pyk2 kinase is a signaling link for induction of long-term potentiation in CA1 hippocampus. Neuron 29, 485-496.[CrossRef][Medline]

Kadare, G., Toutant, M., Formstecher, E., Corvol, J. C., Carnaud, M., Boutterin, M. C. and Girault, J. A. (2003). PIAS1-mediated sumoylation of focal adhesion kinase activates its autophosphorylation. J. Biol. Chem. 278, 47434-47440.[Abstract/Free Full Text]

Kahl, C. R. and Means, A. R. (2004). Calcineurin regulates cyclin D1 accumulation in growth-stimulated fibroblasts. Mol. Biol. Cell 15, 1833-1842.[Abstract/Free Full Text]

Klee, C. B., Ren, H. and Wang, X. T. (1998). Regulation of the calmodulin-stimulated protein phosphatase, calcineurin. J. Biol. Chem. 273, 13367-13370.[Free Full Text]

Lakkakorpi, P. T., Bett, A. J., Lipfert, L., Rodan, G. A. and Duong, L. T. (2003). PYK2 autophosphorylation, but not kinase activity, is necessary for adhesion-induced association with c-Src, osteoclast spreading, and bone resorption. J. Biol. Chem. 278, 11502-11512.[Abstract/Free Full Text]

Lev, S., Moreno, H., Martinez, R., Canoll, P., Peles, E., Musacchio, J. M., Plowman, G. D., Rudy, B. and Schlessinger, J. (1995). Protein tyrosine kinase PYK2 involved in Ca2+-induced regulation of ion channel and MAP kinase functions. Nature 376, 737-745.[CrossRef][Medline]

Lin, K., Wang, D. and Sadée, W. (2002). Serum response factor activation by muscarinic receptors via Rho: a novel pathway specific to m1 subtype involving calmodulin, calcineurin, and PYK2. J. Biol. Chem. 277, 40789-40798.[Abstract/Free Full Text]

Lipinski, C. A., Tran, N. L., Bay, C., Kloss, J., McDonough, W. S., Beaudry, C., Berens, M. E. and Loftus, J. C. (2003). Differential role of proline-rich tyrosine kinase 2 and focal adhesion kinase in determining glioblastoma migration and proliferation. Mol. Cancer Res. 1, 323-332.[Abstract/Free Full Text]

Liu, J., Farmer, J. D., Lane, W. S., Friedman, J., Weissman, I. and Schreiber, S. L. (1991). Calcineurin is a common target of cyclophilin-cyclosporin A and FKBP-FK506 complexes. Cell 66, 807-815.[CrossRef][Medline]

Liu, Y., Zhang, G., Gao, C. and Hou, X. (2001). NMDA receptor activation results in tyrosine phosphorylation of NMDA receptor subunit 2A(NR2A) and interaction of Pyk2 and Src with NR2A after transient cerebral ischemia and reperfusion. Brain Res. 909, 51-58.[CrossRef][Medline]

Menegon, A., Burgaya, F., Baudot, P., Dunlap, D. D., Girault, J. A. and Valtorta, F. (1999). FAK+ and PYK2/CAKbeta, two related tyrosine kinases highly expressed in the central nervous system: similarities and differences in the expression pattern. Eur. J. Neurosci. 11, 3777-3788.[CrossRef][Medline]

Nishi, K., Yoshida, M., Fujiwara, D., Nishikawa, M., Horinouchi, S. and Beppu, T. (1994). Leptomycin B targets a regulatory cascade of crm1, a fission yeast nuclear protein, involved in control of higher order chromosome structure and gene expression. J. Biol. Chem. 269, 6320-6324.[Abstract/Free Full Text]

Okigaki, M., Davis, C., Falasca, M., Harroch, S., Felsenfeld, D. P., Sheetz, M. P. and Schlessinger, J. (2003). Pyk2 regulates multiple signaling events crucial for macrophage morphology and migration. Proc. Natl. Acad. Sci. USA 100, 10740-10745.[Abstract/Free Full Text]

Park, S. Y., Avraham, H. K. and Avraham, S. (2004). RAFTK/Pyk2 activation is mediated by trans-acting autophosphorylation in a Src-independent manner. J. Biol. Chem. 279, 33315-33322.[Abstract/Free Full Text]

Poon, I. K. and Jans, D. A. (2005). Regulation of nuclear transport: central role in development and transformation? Traffic 6, 173-186.[CrossRef][Medline]

Rusnak, F. and Mertz, P. (2000). Calcineurin: form and function. Physiol. Rev. 80, 1483-1521.[Abstract/Free Full Text]

Sasaki, H., Nagura, K., Ishino, M., Tobioka, H., Kotani, K. and Sasaki, T. (1995). Cloning and characterization of cell adhesion kinase beta, a novel protein-tyrosine kinase of the focal adhesion kinase subfamily. J. Biol. Chem. 270, 21206-21219.[Abstract/Free Full Text]

Schaller, M. D. and Sasaki, T. (1997). Differential signaling by the focal adhesion kinase and cell adhesion kinase beta. J. Biol. Chem. 272, 25319-25325.[Abstract/Free Full Text]

Schindler, E. M., Baumgartner, M., Gribben, E. M., Li, L. and Efimova, T. (2007). The role of proline-rich protein tyrosine kinase 2 in differentiation-dependent signaling in human epidermal keratinocytes. J. Invest. Dermatol. 127, 1094-1106.[CrossRef][Medline]

Seabold, G. K., Burette, A., Lim, I. A., Weinberg, R. J. and Hell, J. W. (2003). Interaction of the tyrosine kinase Pyk2 with the N-methyl-D-aspartate receptor complex via the Src homology 3 domains of PSD-95 and SAP102. J. Biol. Chem. 278, 15040-15048.[Abstract/Free Full Text]

Siciliano, J. C., Toutant, M., Derkinderen, P., Sasaki, T. and Girault, J. A. (1996). Differential regulation of proline-rich tyrosine kinase 2 cell adhesion kinase beta (PYK2/CAKbeta) and pp125FAK by glutamate and depolarization in rat hippocampus. J. Biol. Chem. 271, 28942-28946.[Abstract/Free Full Text]

Sieg, D. J., Ilic, D., Jones, K. C., Damsky, C. H., Hunter, T. and Schlaepfer, D. D. (1998). Pyk2 and Src-family protein-tyrosine kinases compensate for the loss of FAK in fibronectin-stimulated signaling events but Pyk2 does not fully function to enhance FAK- cell migration. EMBO J. 17, 5933-5947.[CrossRef][Medline]

Tian, D., Litvak, V. and Lev, S. (2000). Cerebral ischemia and seizures induce tyrosine phosphorylation of PYK2 in neurons and microglial cells. J. Neurosci. 20, 6478-6487.[Abstract/Free Full Text]

Valjent, E., Corvol, J. C., Pages, C., Besson, M. J., Maldonado, R. and Caboche, J. (2000). Involvement of the extracellular signal-regulated kinase cascade for cocaine-rewarding properties. J. Neurosci. 20, 8701-8709.[Abstract/Free Full Text]

Wissing, J., Jansch, L., Nimtz, M., Dieterich, G., Hornberger, R., Keri, G., Wehland, J. and Daub, H. (2006). Proteomic analysis of protein kinases by target class-selective pre-fractionation and tandem mass spectrometry. Mol. Cell. Proteomics 6, 537-547.[CrossRef][Medline]

Yi, X. P., Zhou, J., Huber, L., Qu, J., Wang, X., Gerdes, A. M. and Li, F. (2006). Nuclear compartmentalization of FAK and FRNK in cardiac myocytes. Am. J. Physiol. Heart Circ. Physiol. 290, H2509-H2515.[Abstract/Free Full Text]

Yu, H., Li, X., Marchetto, G. S., Dy, R., Hunter, D., Calvo, B., Dawson, T. L., Wilm, M., Anderegg, R. J., Graves, L. M. et al. (1996). Activation of a novel calcium-dependent protein-tyrosine kinase. Correlation with c-Jun N-terminal kinase but not mitogen-activated protein kinase activation. J. Biol. Chem. 271, 29993-29998.[Abstract/Free Full Text]

Zheng, C., Xing, Z., Bian, Z. C., Guo, C., Akbay, A., Warner, L. and Guan, J. L. (1998). Differential regulation of Pyk2 and focal adhesion kinase (FAK). The C-terminal domain of FAK confers response to cell adhesion. J. Biol. Chem. 273, 2384-2389.[Abstract/Free Full Text]

Zwick, E., Wallasch, C., Daub, H. and Ullrich, A. (1999). Distinct calcium-dependent pathways of epidermal growth factor receptor transactivation and PYK2 tyrosine phosphorylation in PC12 cells. J. Biol. Chem. 274, 20989-20996.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?



This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow All Versions of this Article:
jcs.009613v1
120/17/3034    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Faure, C.
Right arrow Articles by Girault, J.-A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Faure, C.
Right arrow Articles by Girault, J.-A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?