JCS03361 Supplementary Material

Files in this Data Supplement:

• Supplemental Figure 1 -

  Fig. S1. Validation of dynamin-2-siRNA and eNOS-siRNA. (A) In initial experiments, siRNA was labeled with Cy3 prior to transfection to monitor transfection efficiency (Silencer siRNA Labeling Kit; Ambion) by conventional fluorescence microscopy (5100TV; Zeiss, Germany). siRNA transfection of BAEC was performed using Oligofectamine reagent (Invitrogen) with a final concentration of 100 nM of siRNA and prepared for microscopic analysis after 48-72 hours. Cells were examined by phase contrast (left) and fluorescence microscopy (middle). Approximately 75% of BAEC were transfected with siRNA as evidenced by Cy3 uptake in the merged image (right). (B) Dyn2-siRNA was generated from the bovine cDNA sequence from 519 to 539 bp (AAGGACATGATCCTGCAGTTT). After transfection, cells were collected and lysed for western blot after 48-72 hours. Dyn-2 expression was significantly decreased in the siRNA group compared with the control panel. GAPDH levels were similar in both groups, as were other proteins such as eNOS and AKT (not shown). (C) eNOS-siRNA was generated from the eNOS sequence from 1824 bp after the start codon (GAGTTACAAGATCCGCTTC). (Left) Transfection of BAEC with eNOS-siRNA depleted eNOS protein levels by 80% as compared with transfection of BAEC with scrambled RNA. The blot was reprobed with GAPDH antibody for a control of protein loading. (Middle) Densitometric analysis result is shown. (Right) BAEC transfected with eNOS-siRNA show marked diminution in NOS activity (assessed by conversion of arginine to citrulline) compared with control BAEC transfected with scrambled RNA (*P<0.05; n=4).

• Supplemental Figure 2 -

  Fig. S2. NO protects EC from TNF-α-induced apoptosis. (A) BAEC were incubated with TNF-α (30 ng/ml), VEGF (150 ng/ml) and L-NAME (1 mM) in combinations and prepared for Hoechst 33342 staining after 24-hour treatment to detect chromatin condensation and nuclear fragmentation indicative of apoptosis. Data are shown with TNF-α-induced apoptosis arbitrarily assigned at 100%. VEGF reduced TNF-α-induced apoptosis by 30% and L-NAME largely reversed the protective effect of VEGF (*P<0.05; TNF-α+VEGF versus TNF-α+VEGF+L-NAME, n=3). (B) EC were incubated with TNF and/or varying concentrations of NO donors (SNP or GSNO). Lysates were prepared for western-blot analysis of cleaved caspase-3. (Top) SNP at concentrations ranging from 0.01 μM to 1 μM protected EC from TNF-α-induced apoptosis. (Bottom) GSNO, from concentrations of 0.05 μM to 100 μM, protected EC from TNF-α-induced apoptosis.