spacer gif spacer gif spacer gif spacer gif Propose a workshop for 2011 spacer gif
QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 12 August 2008
doi: 10.1242/jcs.030353

Journal of Cell Science 121, 2892-2903 (2008)
Published by The Company of Biologists 2008
This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow All Versions of this Article:
jcs.030353v1
121/17/2892    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Waters, J. E.
Right arrow Articles by Mitchell, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Waters, J. E.
Right arrow Articles by Mitchell, C. A.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Research Article

P-Rex1 – a multidomain protein that regulates neurite differentiation

JoAnne E. Waters, Megan V. Astle, Lisa M. Ooms, Demis Balamatsias, Rajendra Gurung and Christina A. Mitchell*

Department of Biochemistry and Molecular Biology, Monash University, Clayton 3800, Victoria, Australia

* Author for correspondence (e-mail: Christina.Mitchell{at}med.monash.edu.au)

Accepted 3 June 2008


   Summary
Top
 Summary
Introduction
 Results
 Discussion
 Materials and Methods
 References
 
The Rac-GEF P-Rex1 promotes membrane ruffling and cell migration in response to Rac activation, but its role in neuritogenesis is unknown. Rac1 promotes neurite differentiation; Rac3, however, may play an opposing role. Here we report that in nerve growth factor (NGF)-differentiated rat PC12 cells, P-Rex1 localised to the distal tips of developing neurites and to the axonal shaft and growth cone of differentiating hippocampal neurons. P-Rex1 expression inhibited NGF-stimulated PC12 neurite differentiation and this was dependent on the Rac-GEF activity of P-Rex1. P-Rex1 inhibition of neurite outgrowth was rescued by low-dose cytochalasin D treatment, which prevents actin polymerisation. P-Rex1 activated Rac3 GTPase activity when coexpressed in PC12 cells. In the absence of NGF stimulation, targeted depletion of P-Rex1 in PC12 cells by RNA interference induced the spontaneous formation of β-tubulin-enriched projections. Following NGF stimulation, enhanced neurite differentiation, with neurite hyper-elongation correlating with decreased F-actin at the growth cone, was demonstrated in P-Rex1 knockdown cells. Interestingly, P-Rex1-depleted PC12 cells exhibited reduced Rac3 and Rac1 GTPase activity. This study has identified P-Rex1 as a Rac3-GEF in neuronal cells that localises to, and regulates, actin cytoskeletal dynamics at the axonal growth cone to in turn regulate neurite differentiation.

Key words: Rac1, Rac3, Actin, Guanine nucleotide exchange factor, Neurite differentiation


   Introduction
Top
 Summary
 Introduction
Results
 Discussion
 Materials and Methods
 References
 
Neurite differentiation is a cellular process responsible for neuronal patterning and the formation of connections crucial for the development of the nervous system. The establishment of neuronal networks is regulated by actin cytoskeletal dynamics. In response to specific stimuli, the growth cone of the axon produces and retracts filopodia and membrane ruffles, events that require the temporal and spatial regulation of the actin cytoskeleton (Luo, 2002Go). The Rho family of small GTPases, which includes Rho, Rac and Cdc42, promote morphological changes during neuronal development, including neurite outgrowth, axonal guidance and dendritic development (Dickson, 2001Go; Govek et al., 2005Go; Luo, 2000Go). The Rho GTPases function as molecular switches, cycling between GTP-bound active forms and GDP-bound inactive forms. The temporal and spatial activation of Rho GTPases during neuronal differentiation in response to various extracellular cues is crucial for neurite outgrowth (Aoki et al., 2004Go).

Rac1 and Rac3 (Rac1B), but not Rac2, are expressed in brain. Rac1 stimulates the formation of membrane ruffles and is essential for neurite outgrowth, axonal growth, guidance and branching (de Curtis, 2008Go; Govek et al., 2005Go). Rac3 exhibits high identity with Rac1, with divergent sequences in its C-terminus (Malosio et al., 1997Go). A recent study using RNA interference (RNAi)-mediated depletion of Rac3 from mouse NIE-115 neuroblastoma cells revealed that Rac3 may exhibit an opposing function to Rac1, negatively regulating cell matrix adhesions and neurite outgrowth, activities dependent on its polybasic C-terminal region (Hajdo-Milasinovic et al., 2007Go). By contrast, studies analysing hippocampal neurons from Rac3–/– mice revealed no defects in neuronal differentiation or polarisation (Gualdoni et al., 2007Go).

The active/inactive states of Rac proteins are regulated by a variety of intracellular molecules that include guanine nucleotide exchange factors (GEFs) and GTPase-activating proteins (GAPs). GEFs unlock the nucleotide-binding site of the GTPase, allowing GDP disassociation and binding of GTP, whereas GAPs stimulate the intrinsic activity of Rho family proteins to hydrolyse GTP. Several GEFs specific for Rac (Rac-GEFs), including STEF (Tiam2), Tiam1, kalirin, Trio, Vav2/3, GEFT and alsin (Als2), are strongly implicated in regulating neuritogenesis (Aoki et al., 2005Go; Bryan et al., 2004Go; Estrach et al., 2002Go; Matsuo et al., 2002Go; Penzes et al., 2001Go; Tanaka et al., 2004Go; Tudor et al., 2005Go).

The PtdIns(3,4,5)P3-dependent Rac exchanger (P-Rex) proteins (P-Rex1, P-Rex2 and P-Rex2b) are a novel family of Rac-GEFs. P-Rex1 depletion from neutrophil-related cell lines is associated with decreased G protein-coupled receptor-stimulated reactive oxygen species formation (Welch et al., 2002Go). P-Rex1 (BC067047) knockout mice have mild neutrophilia, and neutrophils exhibit decreased reactive oxygen species production (Dong et al., 2005Go; Welch et al., 2005Go). The P-Rex family of enzymes are directly activated by Gβ{gamma} subunits and PtdIns(3,4,5)P3 (Hill et al., 2005Go; Welch et al., 2002Go). P-Rex1 contains multiple domains including an N-terminal catalytic Dbl-homology (DH) domain, which contains the catalytic GEF motifs for Rac activation, followed by a pleckstrin homology (PH) domain, which binds PtdIns(3,4,5)P3, and tandem DEP (Dishevelled, EGL-10, pleckstrin homology) domains; the latter domains have recently been shown to interact with the mTor complex (Hernandez-Negrete et al., 2007Go). Following the DEP domains are two PDZ (post-synaptic density, disc-large, ZO-1 homology) domains; however, their function in P-Rex1 remains speculative. In the C-terminal region, P-Rex1 shows homology to inositol polyphosphate 4-phosphatases and contains a CX5R motif, which is a common catalytic motif found in many phosphoinositide phosphatases and dual-specificity protein phosphatases. Inositol polyphosphate 4-phosphatases hydrolyse the 4-position phosphate from inositol (3,4)-bisphosphate, inositol (1,3,4)-trisphosphate and phosphatidylinositol 3,4-bisphosphate [PtdIns(3,4)P2], with the latter representing the preferred substrate (Norris and Majerus, 1994Go). Interestingly, the type I 4-phosphatase is strongly implicated in neuronal survival and development (Nystuen et al., 2001Go). However, P-Rex1 does not hydrolyse inositol phosphates or phosphoinositides, including PtdIns(3,4)P2, so the functional role of this domain remains elusive (Welch et al., 2002Go). P-Rex2b, a splice variant of P-Rex2, lacks this C-terminal 4-phosphatase domain (Donald et al., 2004Go; Rosenfeldt et al., 2004Go). P-Rex1 is expressed in a variety of cells in the brain and spinal cord, including the developing cortical and dorsal root ganglion neurons (Yoshizawa et al., 2005Go). Studies using ectopic expression and small interfering RNA (siRNA)-mediated depletion of P-Rex1 in PC12 cells have revealed that P-Rex1 influences nerve growth factor (NGF)-stimulated cell motility (Yoshizawa et al., 2005Go); however, its role in regulating neuronal differentiation has not been reported.

In this study, we have investigated the role that P-Rex1 plays in regulating neuronal morphogenesis in rat primary embryonic hippocampal neurons and in NGF-stimulated PC12 cells. In hippocampal neurons, P-Rex1 localises to the distal tips of developing neurites, the axon shaft and growth cone. Ectopic expression of P-Rex1 and RNAi-mediated targeted depletion of P-Rex1 in PC12 cells and primary hippocampal neurons demonstrate that P-Rex1 inhibits neurite elongation by directing actin cytoskeletal dynamics specifically at the growth cone. Furthermore, we present evidence that P-Rex1 may function as a novel Rac3-GEF in neuronal cells. These studies have revealed that the relatively uncharacterised Rac-GEF, P-Rex1, contributes to the complex network of signalling events that regulate neuronal morphogenesis.


   Results
Top
 Summary
 Introduction
 Results
Discussion
 Materials and Methods
 References
 
P-Rex1 distribution during neuronal differentiation
To determine the functional role of P-Rex1 in regulating neuronal differentiation, we first investigated the localisation of P-Rex1 in hippocampal neurons and PC12 cells. P-Rex1-specific polyclonal antibodies were raised to a unique P-Rex1 peptide sequence (Fig. 1A) and immune serum affinity-purified on a peptide-coupled thiopropyl Sepharose column. In immunoblots, P-Rex1 antibodies detected a ~180 kDa protein consistent with P-Rex1 in mouse brain lysates, rat E18 hippocampal neurons and PC12 cells (Fig. 1B). Some proteolytic P-Rex1 immunoreactive peptides migrating at 110 and 80 kDa were also detected in hippocampal neurons and PC12 cells. Two PEST sites, predicted to be susceptible to calpain-mediated cleavage (Dice, 1987Go), are predicted in the P-Rex1 sequence. However, mouse brain immediately harvested and boiled in SDS-PAGE reducing buffer exhibited only the single, 180 kDa immunoreactive polypeptide.


Figure 1
View larger version (60K):
[in this window]
[in a new window]

  		Fig. 1. P-Rex1 localises to the shaft and distal tip of PC12 neurite growth cones. (A) Domain structure of P-Rex1 showing the Dbl homology (DH), pleckstrin homology (PH), Dishevelled, EGL-10, pleckstrin homology (DEP), post-synaptic density, disc-large, ZO-1 homology (PDZ), PEST sequences (P) and 4-phosphatase homology (4ptase) domains. The peptide sequence used as an immunogen to generate the P-Rex1-specific antibody is indicated. (B) Cell lysates from mouse brain, rat E18 hippocampal neurons and undifferentiated PC12 cells (30 µg) were immunoblotted with affinity-purified P-Rex1 antibodies. Immunoreactive endogenous P-Rex1 is indicated by the arrow. (C) PC12 cells were left undifferentiated, or NGF-stimulated as indicated, then immunostained with P-Rex1-specific antibodies (green) and Texas Red-conjugated phalloidin (red). Merged images are shown in the third column and enlarged images of the boxed areas of growth cones of immature (1) or mature (2) neurites are shown in the bottom row. The growth cone peripheral (P) and central (C) zones are indicated in the bottom row. P-Rex1 localisation at the distal tip of filopodia and lamellipodia is indicated by arrows and at growth cones by arrowheads. Undifferentiated PC12 cells were also stained with P-Rex1 peptide-adsorbed antibody as control (right-most panel). Scale bars: 10 µm.

 
Rat pheochromocytoma PC12 cells provide an experimentally accessible model system in which to study neurite outgrowth. NGF stimulation allows PC12 cells to initiate and extend neurites; however, these processes do not form polarised axons or dendrites, or specialised synapses (Greene and Tischler, 1976Go). Indirect immunofluorescence of undifferentiated serum-starved PC12 cells using affinity-purified P-Rex1 antibodies revealed punctate cytosolic staining (Fig. 1C, top row). No immunoreactivity was detected using peptide-adsorbed serum (Fig. 1C). Preimmune sera were also non-reactive (not shown). Following brief NGF stimulation (6 minutes), intense P-Rex1 staining was detected at the tips of lamellipodia and filopodia co-localising with phalloidin-stained F-actin (Fig. 1C, arrows). Following 8-hour NGF-stimulated differentiation, P-Rex1 was detected at the PC12 cell periphery, neurite shaft and at the distal end of the growth cone, the specialised motile tip of a neuronal process that contains an actin-rich peripheral (P) zone and a central (C) zone of bundled microtubules. High-magnification images revealed that P-Rex1 was localised in the central regions of the growth cone (Fig. 1C, see `C' in bottom row), but was absent from the actin-rich P zone (see `P' in bottom row). P-Rex1 consistently localised to growth cone tips, distal to the actin-rich zone (Fig. 1C, arrowheads, bottom row), the site of actin polymerisation within the P zone of the growth cone (Lin and Forscher, 1995Go).

Primary hippocampal neurons provide a well-characterised model for the development of neuronal polarity, with cells progressing through five developmental stages characterised by the outgrowth of short, unpolarised neurites during stage 2, axonal specification in stage 3 and dendritic differentiation and synaptogenesis during stages 4 and 5 (Dotti et al., 1988Go). In early stage 2 hippocampal neurons, P-Rex1 was detected at the cell periphery, the developing neurite shaft and at the tips of the nascent growth cone (Fig. 2A, arrows, growth cone staining). Rac1 exhibited a patchy distribution in the developing neurite, being most intensely localised at the distal ends of the nascent growth cone, and was co-localised with P-Rex1 (Fig. 2A, arrow in upper row), but not in the body of the emerging growth cone or the neurite shaft. F-actin at the developing growth cone co-localised with P-Rex1, but only at the most-distal end of the neurite tips (Fig. 2A, arrows in middle row). P-Rex1 exhibited partial co-distribution with β-tubulin across the span of the neurite shaft and at the distal neurite tips (Fig. 2A, arrows in bottom row).


Figure 2
View larger version (65K):
[in this window]
[in a new window]

  		Fig. 2. P-Rex1 distribution during hippocampal differentiation. (A) One day in vitro (d.i.v.) embryonic rat hippocampal neurons were immunostained with P-Rex1-specific antibodies (green), Rac antibodies (red), Texas Red-conjugated phalloidin (red) or β-tubulin antibodies (red) as indicated. Higher-magnification images of the boxed area outlining the growth cones are shown in the fourth column. Arrows indicate endogenous P-Rex1, Rac or F-actin at tips of growth cones. Co-localisation in merged images appears yellow. (B,C) Three (B) and 4-7 (C) d.i.v. embryonic rat hippocampal neurons were co-stained with P-Rex1-specific antibodies (green), Texas Red-conjugated phalloidin (red), β-tubulin (red), Tau1 (red) or MAP2 (red) antibodies. The relative intensity of P-Rex1 antibody staining is shown in the left-hand column by `glowover' images, in which blue indicates high-intensity staining (see scale beneath B). Merged images in the right-hand column demonstrate co-localisation by yellow staining. Open arrows indicate primary neurites. Arrowhead indicates P-Rex1 co-localisation with β-tubulin. White arrows in C indicate Tau1-positive or MAP2-negative processes. Scale bars: 10 µm in A; 20 µm in B,C.

 
In early stage 3 neurites, P-Rex1 was detected at the cell periphery, prominently in the primary neurite shaft and developing growth cone, as illustrated by the intensity of staining in the neurite shaft (Fig. 2B, open arrows in `glowover' images). P-Rex1 co-localised with actin at the growth cone and with β-tubulin at the neurite shaft (Fig. 2B, second panel, arrowhead). In differentiated stage 4-5 neurons, P-Rex1 localised to the perinuclear region of the cell body and intensely in the growth cone and shaft of one process (Fig. 2C, `glowover' images). Intense P-Rex1 antibody staining of Tau1 (Mapt)-positive axons was detected, with only faint staining in MAP2 (Mtap2)-positive dendrites, indicating that P-Rex1 exhibits a polarised axonal distribution (Fig. 2B, see arrows for Tau1-positive, MAP2-negative axons).

Ectopic expression of P-Rex1 inhibits neurite differentiation via Rac-GEF activity
We examined the effect of ectopic expression of P-Rex1 on NGF-mediated PC12 neurite differentiation for 3 days. For each construct, the length of the longest neurite was measured and growth cone F-actin was examined by Texas Red-phalloidin staining (see Fig. 3A). Cells were classified as differentiated upon the acquisition of one or more neurites that were greater in length than the diameter of the cell body. By this criterion, 50% of cells expressing vector-only controls were differentiated. Ectopic expression of P-Rex1 resulted in a 3-fold decrease in differentiation (Fig. 3C). P-Rex1-expressing cells initiated actin-rich projections, but these did not differentiate into elongated neurites as shown by scoring the number of neurites/actin-rich projections of any length. However, P-Rex1 cells initiated ~2-fold more actin-rich projections than did vector controls (Fig. 3B, upper row, arrows; supplementary material Fig. S1). Cells were treated with low-dose cytochalasin D, which inhibits actin polymerisation. Under these conditions, >40% of HA-P-Rex1-expressing PC12 cells exhibited differentiated neurites (Fig. 3C), suggesting that P-Rex1 inhibition of neurite differentiation is mediated by actin. A P-Rex1 mutant (P-Rex1GEFdead) that is GEF-dead as a consequence of two point mutations, E56A and N238A, in the Rac-GEF domain (Hill et al., 2005Go), did not inhibit neurite differentiation indicating that Rac activation is crucial for P-Rex1 function. Mutant P-Rex1 that contained only the central and 4-phosphatase homology domains (P-Rex1{Delta}N) had no effect, when at low dose (1 µg), on neurite differentiation, but at high levels (5 µg) resulted in a similar phenotype to wild-type P-Rex1, with a 3-fold inhibition of differentiation resulting in short projections with greatly increased F-actin (Fig. 3A-C). This might be due to as yet unidentified molecular mechanisms because this construct does not contain the Rac-GEF activating domain, but does contain the central and 4-phosphatase domains. HA-P-Rex1{Delta}4P, which lacks the 4-phosphatase homology domain but contains the Rac-GEF domain, did not inhibit neurite differentiation, although we noted that F-actin growth cone content appeared reduced (Fig. 3A-C). This result suggests that the 4-phosphatase domain might contribute to P-Rex1 inhibition of neurite differentiation and actin polymerisation by unknown mechanisms. In control studies, expression of mutant and wild-type P-Rex1 was shown to be intact by immunoblot analysis (Fig. 3A).


Figure 3
View larger version (60K):
[in this window]
[in a new window]

  		Fig. 3. Ectopic expression of P-Rex1 inhibits NGF-mediated neurite differentiation and is dependent on both the Rac-GEF activity and the 4-phosphatase domain. (A) Schematic of P-Rex1 deletion mutant constructs. PC12 cells were transiently transfected with P-Rex1 mutant constructs and cell lysates were immunoblotted with HA or myc antibodies, as shown beneath. 1, HA-vector; 2, HA-P-Rex1; 3, HA-P-Rex1{Delta}N; 4, HA-P-Rex1{Delta}4P; 5, myc-P-Rex1; 6, myc-P-Rex1GEFdead. To the right, neurite outgrowth, neurite F-actin and initiation are summarised for each P-Rex1 mutant protein. For neurite outgrowth: +++, as vector control; +, reduced neurite outgrowth; –, no outgrowth. For F-actin: +, as vector control; +++, increased. For initiation: +, initiation as vector control. (B,C) PC12 cells were transiently transfected with wild-type or mutant P-Rex1 (5 µg, unless otherwise indicated) and NGF-stimulated for 3 days in the presence or absence of 1 µM cytochalasin D. (B) Cells were co-stained with HA or myc antibodies (green) and Texas Red-conjugated phalloidin (red or grey). Merged images are shown (lower row) with neurites or actin-rich projections indicated by arrows. Scale bar: 10 µm. (C) Cells containing actin-rich projections were imaged and the length of the neurite/projection and the cell body diameter determined. Bars indicate the mean ± s.e.m. of cells bearing neurites longer than one cell body diameter. 100 cells were scored for each construct for three independent transfections. *P<0.05; **P<0.01; ***P<0.001.

 

Recent studies have revealed that the Rac proteins, Rac1 and Rac3, although highly related, may exert distinct functions in the developing nervous system (Hajdo-Milasinovic et al., 2007Go). P-Rex1 activates Rac1 in purified-component assays, but in neutrophils it exhibits preference for Rac2, a haematopoiesis-specific Rac (Dong et al., 2005Go; Welch et al., 2005Go). The ability of P-Rex1 to function as a Rac3-GEF has not been reported. To address this, PC12 cells were co-transfected with vector, P-Rex1 or P-Rex1GEFdead, and with Rac1 or Rac3, and an ELISA-based Rac activation assay (G-LISA) performed. In response to NGF, only a small increase in Rac1 activation in the P-Rex1-expressing cells was detected in each of four experiments and this trend only approached significance (P=0.057). By contrast, Rac3 activation in P-Rex1-expressing cells was consistently higher, and statistically significant (P=0.011), in response to NGF as compared with vector controls. The P-Rex1GEFdead construct did not activate either Rac1 or Rac3 (Fig. 4A). P-Rex1 can therefore activate Rac3 in neuronal cells and this is dependent on its Rac-GEF activity. Rac3 localises to the plasma membrane of stimulated cells, but in contrast to Rac1, it also exhibits a perinuclear localisation (Hajdo-Milasinovic et al., 2007Go). There was minimal co-localisation of P-Rex1 and Rac1 at the plasma membrane of PC12 cells following a 3-minute NGF stimulation (Fig. 4B, arrowheads, middle row). Interestingly, however, P-Rex1 co-localised with Rac3 in a perinuclear distribution (Fig. 4B, arrow, bottom row).


Figure 4
View larger version (40K):
[in this window]
[in a new window]

  		Fig. 4. P-Rex1 co-localises with, and promotes the activation of, HA-Rac3 in NGF-stimulated PC12 cells. (A) PC12 cells were co-transfected with myc-Rac1 or HA-Rac3 and vector control, P-Rex1 or P-Rex1GEFdead, and left serum starved or stimulated with NGF for 3 minutes. Duplicate samples of cell lysates were subjected to colorimetric Rac1,2,3 G-LISA Activation Assays and the average Rac activation was calculated relative to serum-starved HA-vector-only controls. Equivalent expression of Rac constructs was confirmed by immunoblot analysis using a pan-Rac antibody (not shown). Bars indicate mean ± s.e.m. of relative Rac activation for four independent experiments (*P<0.05). (B) PC12 cells were transfected with HA-P-Rex1 (upper row) or co-transfected with HA-P-Rex1 and myc-Rac1 (middle row) or myc-P-Rex1 and HA-Rac3 (bottom row). Cells were stimulated with NGF for 3 minutes. P-Rex1 (green) and Myc-Rac1 or HA-Rac3 (red) were detected using antibodies to each tag. Co-localisation is indicated by yellow staining in the merged images (right-hand column). Arrowheads indicate P-Rex1/Rac1 membrane co-localisation, with P-Rex1/Rac3 perinuclear co-staining indicated by the arrow. Scale bars: 10 µm.

 
We also examined the role P-Rex1 plays in the differentiation of primary neurons, by transfecting rat embryonic hippocampal cells after 1 day of differentiation in vitro (1 d.i.v.) with plasmids encoding HA-P-Rex1. However, no neurons expressing P-Rex1 could be identified, for reasons unknown (results not shown). To overcome this, differentiated hippocampal neurons were transfected at 7 d.i.v., then grown for an additional 2 days. HA-P-Rex1 was detected at the cell body, the distal half of the axon shaft and growth cone (Fig. 5A), co-localising with Tau1, an axonal marker (Fig. 5B, arrowhead). Significantly, P-Rex1 expression resulted in enlargement of the Tau1-positive axonal growth cones (2.1-fold) associated with prominent F-actin accumulation; however, MAP2-positive dendritic growth cones were not affected (Fig. 5A, lower row, Fig. 5C). Expression of the P-Rex1{Delta}N mutant, which lacks the Rac-GEF, PH, DEP and PDZ domains, resulted in loss of the enlargement of axonal growth cones seen with wild-type P-Rex1 expression (Fig. 5C).


Figure 5
View larger version (47K):
[in this window]
[in a new window]

  		Fig. 5. Hippocampal neurons ectopically expressing P-Rex1 show enlarged growth cones with prominent F-actin accumulation. Embryonic rat hippocampal cells were transiently transfected at 7 d.i.v. with plasmids encoding HA-P-Rex1. At 9 d.i.v., cells were co-stained with HA antibodies (red or green) and either (A) Alexa Fluor 594-conjugated phalloidin (green) or (B) Tau1 (red) antibodies. (A) Representative images of differentiated neurons (upper row), with higher-magnification images of the boxed areas (1, 2) shown in the two lower rows; growth cones are outlined. The relative intensity of F-actin staining is shown on the left in glowover images, in which blue indicates high-intensity staining (see scale). Scale bars: 10 µm. (B) Co-localisation of HA-P-Rex1 and Tau1. In the merged image, axon is indicated by an arrowhead. Scale bar: 20 µm. (C) The fold increase in growth cone area in HA-P-Rex1 or HA-P-Rex1{Delta}N relative to mock-transfected cells. Axonal and dendritic growth cones were identified by Tau1 and MAP2 staining, respectively. Thirty cells were scored for each construct for two independent transfections. Bars indicate the mean ± s.e.m. of the growth cone area; *P<0.05.

 

P-Rex1 RNAi-mediated depletion promotes spontaneous neurite initiation
The effects on neuronal differentiation of RNAi-mediated depletion of P-Rex1 were investigated. Oligonucleotides designed to unique P-Rex1 sequences (P-Rex1 RNAi), or the same sequence scrambled (scram RNAi), were cloned into the psiRNA-hH1 vector, stably transfected into PC12 cells (Fig. 6A) and individual clones isolated. Immunoblot analysis demonstrated a reduction in P-Rex1 protein (58 and 70% in P-Rex1 RNAi clones 1 and 5, respectively), relative to scrambled RNAi clones (3 and 4) (Fig. 6B). RT-PCR analysis confirmed a ~50% reduction in P-Rex1 mRNA, consistent with the immunoblot analysis (Fig. 6C). In the absence of NGF stimulation, conditions not normally associated with neurite formation in controls, P-Rex1 depletion resulted in the loss of PC12 rounded cell morphology (Fig. 6D). Additionally, P-Rex1 RNAi clones exhibited a 3-fold increase in β-tubulin-rich projections, relative to scrambled or vector controls (2.9±0.3-fold and 3.3±0.3-fold increase in P-Rex1 RNAi clones 1 and 5, respectively, relative to scrambled controls, Fig. 6D). PC12 cell morphology was also assessed immediately following NGF treatment (10 minutes) (Fig. 6D, right-hand column). Of the cells expressing scrambled RNAi, 60-80% formed lamellipodia that were similar to those of untransfected PC12 cells. However, P-Rex1 RNAi PC12 cells appeared elongated and exhibited projections that contained a β-tubulin core (Fig. 6D, green) surrounded by F-actin (red), rather than lamellipodia around the entire cell periphery. Immediately following NGF stimulation, the minimum cell diameter was 14.5±0.18 µm in scrambled controls, but had decreased to 11.5±0.14 µm and 11.3±0.25 µm in P-Rex1 RNAi clones 1 and 5, respectively. This correlated with a >30% decrease in the area of the cell body of P-Rex1 RNAi (~170 µm2) as compared with scrambled control (~260 µm2) PC12 cells (200 cells scored using Image J analysis as described in Materials and Methods).


Figure 6
View larger version (62K):
[in this window]
[in a new window]

  		Fig. 6. Targeted depletion of P-Rex1 promotes spontaneous outgrowth of β-tubulin-rich projections (A) The location of the unique nucleotide sequence used to generate P-Rex1 RNAi clones is indicated in the P-Rex1 structure. (B) Cells were stably transfected with a plasmid encoding P-Rex1 RNAi sequence, or a scrambled RNAi control. Cell lysates (40 µg) were immunoblotted with P-Rex1 or actin antibodies. Relevant samples loaded on the same, representative immunoblot are shown. The relative P-Rex1 expression in P-Rex1 clones (1 and 5) was determined by densitometry of P-Rex1-immunoreactive polypeptides from five independent immunoblots, standardised to the actin loading control and expressed as a percentage of that detected in scrambled RNAi clones (3 and 4 combined). The bars indicate the mean ± s.e.m. of five independent experiments. (C) RT-PCR analysis of P-Rex1 RNAi clones. RT-PCR was performed on mRNA extracted from scrambled and P-Rex1 RNAi clones using Gapdh as a control. P-Rex1 expression was calculated and expressed relative to that from Scram(3), which was designated as one. Bars indicate the mean ± s.e.m. of three independent experiments. (D) Cells stably transfected with P-Rex1 RNAi or scrambled RNAi control were left unstimulated (a,b,c) or NGF-stimulated for 10 minutes (d). Cells were stained with Texas Red-conjugated phalloidin (red or grey) or β-tubulin antibody (green) to image cell morphology. Representative images of unstimulated P-Rex1 RNAi clones (1 and 5) and scrambled RNAi control (4) are shown (a,b) with merged magnified images of boxed regions (c). β-tubulin-containing projections are indicated (b, arrows). Merged images of cells treated with NGF for 10 minutes are shown (d) with areas of extensive peripheral F-actin indicated by arrowheads. Scale bars: 5 µm. (E) RNAi-mediated depletion of P-Rex1 in PC12 cells reduces Rac3 activation in response to NGF stimulation. Scrambled RNAi or P-Rex1 PC12 RNAi clones were transiently transfected with myc-Rac1 or HA-Rac3, serum starved and NGF-stimulated (3 minutes). Duplicate samples of cell lysates were subjected to colorimetric Rac1,2,3 G-LISA Activation Assay and the average Rac activation was calculated relative to serum-starved scrambled control cells. Equivalent expression of Rac constructs was confirmed by immunoblot analysis using a pan-Rac antibody (not shown). Bars indicate mean ± s.e.m. of relative Rac activation for four independent experiments. **P<0.005; ***P<0.001.

 

We next examined Rac1 versus Rac3 activation in PC12 cells expressing control or P-Rex1 RNAi. Cells were transfected with Rac1 or Rac3 and Rac activation assays performed (Fig. 6E). Recent studies have revealed that in P-Rex1–/– neutrophils, Rac1 and Rac2 peak activation is reduced by 25 and 50%, respectively (Welch et al., 2005Go). In another study, Rac1 activation was not altered in P-Rex1–/– neutrophils, whereas Rac2 activation was almost completely abrogated, revealing that although P-Rex1 can activate both Rac isoforms in vitro, in haematopoietic cells it functions as a Rac2-specific GEF (Dong et al., 2005Go). In response to NGF stimulation, peak Rac1 activation was decreased by ~20% in P-Rex1 RNAi cells as compared with the control, but this was not statistically significant. By contrast, we noted a significant, ~40% decrease in Rac3 activation in NGF-stimulated P-Rex1 knockdown cells. These studies suggest that the P-Rex1 RNAi-mediated phenotype might be a consequence of decreased Rac3 activity.

P-Rex1 RNAi-mediated depletion enhances neurite elongation
P-Rex1 RNAi clones were stimulated with NGF for 3 days. The percentage of cells bearing differentiated neurites increased >1.8-fold upon targeted depletion of P-Rex1, relative to scrambled or vector controls (Fig. 7A and see supplementary material Fig. S2 for a comparison of vector versus scrambled RNAi). Although the majority (>70%) of differentiated scrambled RNAi cells exhibited short neurites that were less than two cell diameters in length, less than 40% of differentiated P-Rex1 RNAi cells carried short neurites. By contrast, ~30% of P-Rex1 RNAi versus <5% of scrambled RNAi PC12 cells displayed neurites that were longer than three diameters of the cell body, a 6-fold increase (Fig. 7B). Analysis of the length of the longest neurite per cell after 3 days of NGF stimulation revealed that P-Rex1 RNAi neurites were ~1.4-fold longer than those of scrambled RNAi controls (Fig. 7C).


Figure 7
View larger version (50K):
[in this window]
[in a new window]

  		Fig. 7. P-Rex1 regulates NGF-stimulated neurite elongation. Cells stably transfected with P-Rex1 RNAi, or a scrambled control RNAi, were NGF-stimulated for 3 days and stained with Texas Red-conjugated phalloidin and β-tubulin antibodies to image neurite morphology. (A) Representative images of NGF-differentiated P-Rex1-depleted or control PC12 cells. Scale bars: 10 µm. (B) The numbers of differentiated PC12 cells with short neurites (length less than two cell body diameters) and long neurites (length greater than three cell body diameters) were expressed as a percentage of all differentiated neurites. Bars indicate mean ± s.e.m. of at least 100 cells scored for each of three independent differentiation experiments. (C) Neurite length was expressed as the fold increase (mean ± s.e.m.) of the length of the longest neurite for P-Rex1 clones 1 and 5 relative to that of the scrambled control (4). At least 60 neurites were scored for each of three independent differentiation experiments. (D) P-Rex1 RNAi clone (5) was transiently transfected with HA empty vector or with plasmids containing HA-P-Rex1 (1, 2 or 5 µg of DNA), myc-P-Rex1GEFdead (5 µg), HA-P-Rex1{Delta}N (5 µg) or HA-P-Rex1{Delta}4P (5 µg) and NGF-differentiated for 3 days. Cells were stained with Texas Red-conjugated phalloidin and HA or myc antibodies. The number of cells bearing neurites longer than two cell body diameters was calculated and standardised relative to that of the P-Rex1 RNAi clone (5). Knockdown cells transfected with HA empty vector were scored as 100%. Bars indicate the mean ± s.e.m. for at least 50 cells scored per indicated construct for each of three independent experiments. *P<0.05; **P<0.01; ***P<0.001.

 
Rac and its effectors regulate axonal guidance and direction (Dickson, 2001Go; Kubiseski et al., 2003Go; Ng et al., 2002Go). Although this cannot be evaluated in PC12 cells, we noted that P-Rex1 RNAi neurites exhibited a `wandering neurite' phenotype, with a 5-fold increase in the number of neurites showing multiple changes in direction, or one significant change in direction with an angle of less than 130°, compared with scrambled RNAi neurites (Fig. 7A, representative images). Actin instability has been implicated in mediating defects in neuronal elongation and pathfinding (Marsh and Letourneau, 1984Go; Zhou et al., 2002Go). Rac and its effectors regulate axon branching and suppress ectopic axon/neurite formation. P-Rex1 RNAi PC12 cells exhibited a >2-fold increase in the number of branch points per neurite (data not shown).

Because siRNAs can exert off-target effects, we investigated whether co-transfection of increasing amounts of P-Rex1 cDNA could rescue the phenotype mediated by P-Rex1 RNAi knockdown. To this end, P-Rex1 RNAi clones were transfected with increasing amounts of wild-type HA-P-Rex1 (1, 2 or 5 µg), or vector (5 µg) and neurite length assessed. A dose-dependent reduction in the percentage of cells bearing long neurites correlated with transfection of wild-type P-Rex1, but not vector cDNA (Fig. 7D). P-Rex1 also rescued the `wandering neurite' phenotype (not shown). The P-Rex1GEFdead construct only partially rescued the hyper-elongated phenotype. Interestingly, unlike wild-type P-Rex1, expression of HA-P-Rex1{Delta}4P did not rescue the phenotype of P-Rex-1 RNAi-transfected cells (Fig. 7D); instead, it enhanced the phenotype and an increased number of cells with hyper-elongated neurites was observed (Fig. 7D). Previous studies have indicated that the 4-phosphatase domain of P-Rex1 is required to maintain the protein in the cytosol with basal levels of Rac activity, and that the N-terminal GEF and PH domains mediate membrane localisation (Barber et al., 2007Go; Hill et al., 2005Go). Loss of the 4-phosphatase domain might allow unimpaired translocation of P-Rex1 to the membrane where the predominant Rac isoform, Rac1, localises. As Rac1 GEF activity promotes neurite outgrowth and, as we have shown, P-Rex1 exhibits GEF activity for both Rac1 and Rac3, this might lead to unopposed neurite elongation. However, we cannot exclude the possibility that this construct might homodimerise with the residual endogenous P-Rex1 and act as a dominant-negative construct. HA-P-Rex1{Delta}N did not rescue the phenotype in P-Rex1 RNAi cells. Therefore, both the Rac-GEF and 4-phosphatase-homology domains contribute to P-Rex1 regulation of neuronal differentiation.

To assess the effect of P-Rex1 knockdown in hippocampal neurons, cells at 1 d.i.v. were transfected with the P-Rex1 RNAi constructs and with eGFP-expressing vector (ratio of 0.5 µg eGFP:1.5 µg RNAi plasmid to identify RNAi-transfected neurons). Cells were differentiated for 2 days before fixation and staining for F-actin (Fig. 8A, representative images). As with P-Rex1-depleted PC12 cells, P-Rex1-depleted neurons exhibited neurites that were 1.3-fold longer than controls, with an average of two neurites per cell regardless of the construct expressed (data not shown). Interestingly, the growth cones of P-Rex1 RNAi neurons were ~30% smaller than those of controls and exhibited less F-actin (Fig. 8A, enlarged images of growth cones), the opposite phenotype to that observed with ectopic P-Rex1 expression. The actin-rich P zone of the growth cone is composed of radially aligned, filopodial bundles of F-actin with lamellipodial-meshed F-actin situated between the bundles. Dynamic pioneer microtubules advance from the C zone into the P domain and, via interactions with F-actin bundles, promote neurite outgrowth and growth cone turning. The advance of dynamic microtubules into the growth cone P domain is inhibited by retrograde flow of F-actin (Lin and Forscher, 1995Go). F-actin is a major intracellular determinant of neurite elongation and axon elongation rates (Letourneau et al., 1987Go; Marsh and Letourneau, 1984Go). F-actin is polymerised from monomeric G-actin subunits at the neurite growth cone, the tips of the filopodia and the leading edge of membrane ruffles. The dynamic depolymerisation of F-actin and recycling of actin monomers for further rounds of polymerisation facilitates neurite/axon elongation (Dent and Gertler, 2003Go). To assess actin polymerisation at the growth cone, cells were fixed and stained with phalloidin and with fluorescently labelled DNaseI, selective probes for F-actin and G-actin, respectively (Fig. 8B). The ratio of fluorescence of growth cone F-actin to G-actin was determined (Torreano et al., 2005Go). The growth cones of P-Rex1 RNAi neurites appeared smaller than those of scrambled RNAi neurites, with decreased F-actin relative to G-actin (Fig. 8C). Only ~30% of P-Rex1 RNAi growth cones exhibited lamellipodial veils between filopodia compared with ~60% of scrambled RNAi growth cones (Fig. 8B, arrows; Fig. 8D). These results suggest that P-Rex1 knockdown leads to decreased F-actin growth cone content which thereby promotes neurite elongation.


Figure 8
View larger version (52K):
[in this window]
[in a new window]

  		Fig. 8. P-Rex1-depleted neurites exhibit small growth cones with decreased F-actin. (A) Embryonic rat hippocampal cells (1 d.i.v.) were transiently transfected with plasmids encoding P-Rex1 RNAi or a control RNAi. Cells were co-transfected with a low concentration of pEGFP-C2 vector (ratio of 0.5 µg eGFP:1.5 µg RNAi plasmid) to allow for identification of RNAi P-Rex1-depleted neurons. At 3 d.i.v., cells were stained with Texas Red-conjugated phalloidin to visualise F-actin. Representative images are shown in the left column, with magnified images of the boxed growth cones (1-4) shown in the middle and right-hand columns. Scale bars: 10 µm. (B-D) The indicated scrambled RNAi and P-Rex1 PC12 RNAi clones were NGF-differentiated for 3 days, co-stained with Alexa Fluor 488-conjugated phalloidin to visualise F-actin and Alexa Fluor 594-conjugated DNaseI to visualise G-actin and analysed using confocal microscopy. (B) Representative images of growth cone F-actin. Lamellipodial veils are indicated by arrows. Scale bar: 5 µm. (C) The mean fluorescence intensity of F-actin relative to G-actin at the growth cone was determined. Bars indicate the mean ± s.e.m. of the F-actin:G-actin ratio for at least ten growth cones per RNAi clone for each of three independent differentiation experiments. (D) Growth clones were scored for the presence of lamellipodial veils by F-actin morphology. Bars indicate the mean ± s.e.m. for the percentage of cells containing growth cone lamellipodial veils for at least ten growth cones per RNAi clone for each of three independent differentiation experiments. *P<0.05.

 


   Discussion
Top
 Summary
 Introduction
 Results
 Discussion
Materials and Methods
 References
 
The co-ordinated reorganisation of the actin cytoskeleton is required at several stages of neuronal differentiation including neurite initiation, neurite elongation, growth cone guidance and axonal specification. We have shown here that a recently identified Rac-GEF, P-Rex1, localises to sites of actin reorganisation during various stages of neuronal differentiation, including to the hippocampal cell membrane during early stage 2, to the tips of lamellipodia and filopodia of the developing neurites in stage 2 and 3 neurons, to the growth cones of differentiating PC12 cells and to the growth cone and shaft of axons during later stages of hippocampal morphogenesis. P-Rex1 expression inhibited neurite elongation and actin growth cone dynamics, whereas its RNAi-mediated depletion resulted in spontaneous process initiation with hyper-elongation of differentiated neurites. P-Rex1 knockdown reduced the NGF-stimulated activation of Rac3, identifying P-Rex1 as a Rac3-GEF. Collectively, this study has identified P-Rex1 as a novel regulator of actin dynamics at the growth cone that inhibits neurite differentiation.

P-Rex1 activates Rac3
In this study, we made the unanticipated finding that P-Rex1 activates Rac3 in neuronal cells. This conclusion is further supported by the fact that the phenotype of the P-Rex1 knockdown neurites resembles that described for Rac3, but not Rac1, knockdown in neuroblastoma cells. Rac1, which is ubiquitously expressed, and Rac3, which is neuron-specific, may function differently in neuronal development despite their closely related sequences (Hajdo-Milasinovic et al., 2007Go). These functional differences might be a consequence of the divergent sequences in the C-terminal region, which might target distinct effectors. Although Rac3 exhibits a developmentally regulated distribution in mammalian brain, the physiological function of Rac3 in mammalian neurons remains poorly understood. A recent study demonstrated that hippocampal neurons from Rac3–/– mice develop normally in culture, although it was acknowledged that long-term depletion of Rac3 in these neurons may lead to a compensatory upregulation of Rac1 activity (Gualdoni et al., 2007Go). Initial studies demonstrated that the avian homologue of Rac3 (Rac1B) promoted neurite outgrowth in disassociated avian neurons (Albertinazzi et al., 1998Go). However, Rho GTPases exhibit species-, cell type- and matrix-dependent effects on neurite outgrowth (Govek et al., 2005Go). Recent studies have shown that RNAi-mediated depletion of Rac1 promotes cell rounding in unstimulated neuronal N1E-115 cells, whereas Rac3 depletion stimulates the outgrowth of neurite-like extensions, suggesting that Rac3 exhibits an opposing function to Rac1 in promoting neurite outgrowth (Hajdo-Milasinovic et al., 2007Go). Here, we have presented several lines of evidence that P-Rex1 activates Rac3 in neuronal cells. First, P-Rex1 activated Rac3 when P-Rex1 was ectopically expressed in PC12 cells and co-localised with Rac3 at the peri-Golgi region and plasma membrane. Secondly, RNAi-mediated depletion of P-Rex1 promoted the spontaneous formation of projections in PC12 cells, a phenotype similar to that obtained upon knockdown of Rac3 in N1E-115 neuroblastoma cells. Consistent with this, P-Rex1-depleted cells exhibited reduced activation of Rac3. Although P-Rex1 activates Rac1 in purified-component assays, neutrophils from P-Rex1–/– mice showed little change in Rac1-GEF activity, but significant decreases in Rac2-GEF activity (Welch et al., 2005Go). Given that the P-Rex1 RNAi knockdown phenotype mimics the Rac3 knockdown, we propose that P-Rex1 contributes to Rac3 activation in some neuronal cells.

P-Rex1 knockout mice appear healthy with no gross neuronal phenotype (Dong et al., 2005Go; Welch et al., 2005Go). However, detailed analysis of the brain and neural tissue has not been described and neither cognitive function nor behavioural analysis of these mice has been reported. Rac1–/– mice are embryonic lethal with no mice surviving to E10 (Sugihara et al., 1998Go). By contrast, Rac3–/– mice are healthy with no gross brain abnormalities; however, specific behavioural differences to wild type, including superior motor co-ordination and learning, were noted (Corbetta et al., 2008Go; Corbetta et al., 2005Go). Rac3 gene expression is highest postnatally in areas of the brain that contain projection neurons involved in long and complex neuronal networks, such as the hippocampus and cerebral cortex (Corbetta et al., 2005Go). Therefore, P-Rex1 might activate Rac3 in a specific subset of neuronal cells.

P-Rex1 regulates actin dynamics at the growth cone
Co-ordinated neurite outgrowth is essential for both normal nervous system development and for nerve regrowth following injury. P-Rex1 expression inhibited neurite differentiation and elongation, a phenotype corrected by inhibition of actin polymerisation. By contrast, P-Rex1-depleted neurites exhibited decreased F-actin, smaller growth cones and a reduction in lamellipodial veils, correlating with neurite hyper-elongation and abnormal, `wavy' neurites. These results support the contention that targeted depletion of P-Rex1 leads to decreased Rac activation and, thereby, decreased growth cone actin polymerisation and membrane ruffling, which in turn allows the unopposed activity of microtubules to promote neurite elongation. Rac activity regulates the cycling of actin polymerisation and depolymerisation at membrane ruffles, and the balance between too much versus too little Rac activity governs neurite/axon guidance and elongation. Extensive membrane ruffling strongly attenuates neurite expansion, process formation and directional growth as a consequence of the inhibition of microtubule-mediated neurite extension (Tanaka and Sabry, 1995Go). Growth cone F-actin, which is not incorporated into actin bundles, may retard the dynamic advance of microtubules into the peripheral region (Zhou et al., 2002Go). The density of actin in the nascent growth cone of PC12 cells overexpressing P-Rex1, and the failure of these neurites to differentiate, did not allow clear visualisation of F-actin in the growth cone in these cells. However, P-Rex1-mediated inhibition of neurite differentiation was rescued by low-dose cytochalasin D treatment, which, by decreasing actin polymerisation at membrane ruffles, may enable neurite extension.

P-Rex1 is a multi-domain protein
The relative roles that Rac and its various Rac-GEFs play in neurite outgrowth, guidance and differentiation are dependent on the cell type, stimulus and matrix upon which the neurons differentiate. Many neuronal Rac-GEFs have a multi-domain structure that allows the activation of Rac exchange activity at specific subcellular regions to be regulated by extracellular signalling and to link with appropriate downstream effectors (Rossman et al., 2005Go). Domains other than the Rac-GEF domain can modulate exchange activity, often acting as scaffolds so that both the Rho GTPase and its effectors are in contact; for example, PAK binding to the GEF {alpha}-Pix (Feng et al., 2004Go). PH domains can regulate Rac-GEF activity by binding directly to the GEF domain, to phosphoinositides or directly to Rac1, as has recently been described for Trio (Chhatriwala et al., 2007Go). Additionally, many of these proteins have GEF activity-independent functions; for example, kalirin is able to regulate actin to induce lamellipodia via both Rac1-dependent and Rac1-independent mechanisms (Schiller et al., 2005Go). Here, we examined the P-Rex1 domains that regulate its capacity to inhibit neurite differentiation. Rac-GEF activity was crucial for P-Rex1 function, as a P-Rex1GEFdead construct that could activate neither Rac1 nor Rac3 did not inhibit neurite differentiation when overexpressed. Interestingly, however, this construct could only partially rescue the P-Rex1 RNAi knockdown phenotype, suggesting that other domains might contribute to P-Rex1 function. In this regard, it is of interest that expression of a P-Rex1 mutant lacking the 4-phosphatase domain (P-Rex1{Delta}4P) in RNAi P-Rex1-depleted cells was unable to rescue the hyper-elongation phenotype, but instead exacerbated it. Cells overexpressing a 4-phosphatase domain deletion mutant (P-Rex1{Delta}4P) developed neurites of a similar length and F-actin content to vector-transfected cells. These results suggest that the 4-phosphatase domain of P-Rex1 might play a role in regulating neurite elongation, by promoting actin polymerisation independent of the Rac-GEF domain and/or by inhibiting de-polymerisation, or by another as yet unidentified mechanism.

Recent studies by Welch's group using in vitro binding and stimulation of purified proteins has revealed that the isolated 4-phosphatase domain does not modulate the ability of PtdIns(3,4,5)P3 or Gβ{gamma} subunits to stimulate P-Rex1 Rac-GEF activity (Hill et al., 2005Go). However, in the absence of the 4-phosphatase homology domain, the level of basal and/or stimulated P-Rex1 Rac-GEF activity is significantly attenuated, suggesting a functional interaction between the DH/PH domains and the 4-phosphatase homology domain that prevents P-Rex1 GEF enzyme inactivation at high concentrations of PtdIns(3,4,5)P3. Indirect evidence also suggests that the 4-phosphatase domain might contain a second PtdIns(3,4,5)P3-binding domain (Hill et al., 2005Go). Collectively, our analyses indicate that P-Rex1 regulation of neurite elongation requires both an intact Rac-GEF domain and a 4-phosphatase domain, although the function of the 4-phosphatase domain remains elusive.

In summary, this study has identified P-Rex1 as a Rac3-GEF in neuronal cells that regulates neurite differentiation. As Rac3 knockout mice exhibit enhanced motor skills and learning ability, it would be of great interest in future studies to determine the cognitive function of P-Rex1–/– mice.


   Materials and Methods
Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
References
 
Reagents
DNA-modifying and restriction enzymes were from Fermentas, New England Biolabs or Promega. Texas Red-conjugated phalloidin, Alexa Fluor 488-conjugated phalloidin and Alexa Fluor 594-conjugated deoxyribonuclease I (DNaseI) were from Molecular Probes (Eugene, OR). Antibodies specific for Rac were from Upstate (Lake Placid, NY), β-tubulin from Zymed (San Francisco, CA), MAP2 from Sigma (St Louis, MO), Tau1 from Chemicon (Temecula, CA), actin from Santa Cruz (Santa Cruz, CA) and hemagglutinin (HA) from Covance (Berkeley, CA). All hippocampal neuron culture reagents were purchased from Gibco BRL (Gaithersburg, MD). Oligonucleotides were obtained either from Micromon (Monash University, Australia) or GeneWorks (Adelaide, Australia). PC12 cells were from the American Type Culture Collection. Synthetic peptides were obtained from Chiron Mimotopes (Melbourne, Australia). Unless otherwise stated, all other reagents were from Sigma. pCGN vector was a gift from Tony Tiganis (Monash University, Australia).

Cloning of human P-Rex1
A human P-Rex1 (PREX1) partial cDNA (KIAA1415, residues 359-4890) was a gift from Dr T. Nagase (Kazusa DNA Research Institute, Kisarazu, Japan). A retained intron of 1100 bp contained within this clone was removed using a PCR-based mutagenesis protocol with overlapping primers, 5'-CTATGAACCACAGCTTACAAGAGTTTAAACAGAAAGAAG and 5'-CTTCTTTCTGTTTAAACTCTTGTAAGCTGTGGTTCATAG. An additional 254 bp of 5' sequence was amplified from a human EST (BFI10873) using primers 5'-GCTTAGAATTCCCGTGTGCGGCCCGGGAGTCCG and 5'-CTCCTTAAGGAGGAGCGGGTAC. This fragment was ligated into a unique AflII site within the P-Rex1 cDNA. To generate HA-tag fusion constructs, full-length P-Rex1 cDNA, or various P-Rex1 mutants, were amplified by PCR and subcloned into the XbaI site of pCGN in-frame with the N-terminal HA tag.

Production of a P-Rex1-specific anti-peptide antibody
A P-Rex1-specific anti-peptide antibody was generated to a peptide corresponding to a unique sequence (1346LGYRYNNNGEYEESS1360) within human P-Rex1. The peptide, conjugated to diphtheria toxoid, was injected into New Zealand White rabbits and the anti-peptide antibodies were affinity purified from immune sera by chromatography using the peptide coupled to thiopropyl-Sepharose according to manufacturer's instructions (Chiron Mimotopes, Melbourne, Australia). Peptide-adsorbed P-Rex1 antibodies were prepared by incubating the P-Rex1-specific antibody with the peptide-coupled column for 2 hours at room temperature.

PC12 cell culture
PC12 cells were maintained in PC12 medium (DMEM supplemented with 10% FCS, 5% horse serum, 2 mM L-glutamine, 100 units/ml penicillin and 0.1% streptomycin). For transient transfections, cells were suspended in 200 µl of PC12 medium with the addition of a 50 µl DNA mix comprising 1-5 µg DNA in 0.15 M NaCl, then electroporated at 0.2 kV, 975 µF. Cells were added to 8 ml of PC12 medium and incubated for 48 hours at 37°C in 5% CO2. For indirect immunofluorescence, cells were plated onto 0.01% poly-L-lysine (PLL)-coated coverslips. For differentiation assays, cells were incubated in low-serum medium (DMEM supplemented with 1% horse serum, 2 mM L-glutamine, 100 units/ml penicillin and 0.1% streptomycin) containing 50 or 100 ng/ml NGF for the indicated times.

Preparation of hippocampal neurons
Hippocampal neuron cultures were prepared from pregnant Sprague-Dawley rats (Monash University Animal Ethics Project No. BAM/B/2004/47) at day 18 of gestation as described (Banker and Goslin, 1991Go), with slight modifications. Briefly, following dissection, hippocampi were digested in 0.25% trypsin in Hanks Balanced Salt Solution at 37°C for 15 minutes. Cells were manually dissociated by trituration using a fire-polished Pasteur pipette and plated onto 0.01% PLL-coated coverslips at a density of 5x105-1x106/cm2. Following adherence of cells to coverslips, plating medium (MEM, 10% FCS, 0.6% glucose, 100 units/ml penicillin and 0.1% streptomycin) was replaced with Neurobasal medium supplemented with B27 and 0.5 mM glutamine, and cells were allowed to differentiate for 1-7 days d.i.v. as indicated. For transient transfection of hippocampal neurons, cells were transfected at 1 or 6 d.i.v. with 1-5 µg of DNA using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. Neurons were fixed in PBS containing 4% paraformaldehyde and 0.12 M sucrose for 20 minutes.

Generation of P-Rex1 RNAi clones
Stable cell lines underexpressing P-Rex1 and scrambled control clones were generated using the psiRNA-hH1neo Kit (InvivoGen). The following oligonucleotide pairs were annealed and ligated into the BbsI site of the psiRNA-hH1neo vector (as per manu-facturer's instructions), generating P-Rex1-psiRNA-hH1neo and scrambled-psiRNA-hH1neo (P-Rex1-specific or scrambled equivalent sequence underlined, loop sequence in italics): P-Rex1 sense, 5'-TCCCAAGAACAAACAGCTTCGCAATTCAAGAGATTGCGAAGCTGTTTGTCTTTT and P-Rex1 antisense, 5'-CAAAAAAGAACAAACAGCTTCGCAATCTCTTGAATTGCGAAGCTGTTTGTTCTT; scrambled sense, 5'-TCCCAAACGACTACAAAGTCGACATTCAAGAGATGTCGACTTTGTAGTCGTTTT and scrambled antisense, 5'-CAAAAAAACGACTACAAAGTCGACATCTCTTGAATGTCGACTTTGTAGTCGTTT. Following confirmation of nucleotide sequence by dideoxy sequencing, the constructs were transfected into PC12 cells by electroporation as described above. Clones were selected in PC12 medium containing 0.9 mg/ml G418. Individual clones were maintained in PC12 medium containing 0.5 mg/ml G418 until transferred to PC12 medium prior to each experiment.

Immunofluorescence
Cells were fixed in 3% paraformaldehyde in PBS for 20 minutes, permeabilised in 0.1% Triton X-100 in PBS for 2 minutes, washed three times in PBS and then blocked in 1% BSA in PBS for 15 minutes. Following incubation with primary and secondary antibodies as indicated for 1 hour, cells were analysed with a Leica TCS-NT confocal microscope with an Ar-Kr triple-line laser at Monash MicroImaging, Monash University, Australia.

Image analysis
Image analysis was performed using ImageJ software (NIH, version 1.34) (Abramoff et al., 2004Go). Neurite length was calculated by manually tracing the longest neurite for each cell. Neurite branching was determined by counting the number of branch points per cell and dividing by the number of neurites. Growth cone and cell soma area were determined by tracing the perimeter of the cell/growth cone. Statistical significance was determined using a paired or unpaired Student's t-test, with a P-value of <0.05 considered to be statistically significant.

Quantification of F-actin:G-actin
The ratio of F-actin to G-actin within the growth cone was determined as described (Torreano et al., 2005Go). Briefly, following 3-day NGF differentiation and fixation/permeabilisation as described above, cells were incubated with 18 µg/ml Alexa Fluor 594-conjugated DNaseI to visualise G-actin and 6.6 nM Alexa Fluor 488-conjugated phalloidin for F-actin. Confocal images were taken using identical parameters and analysed using ImageJ. The perimeter of the entire growth cone was traced and the average fluorescence intensity, minus the substratum background fluorescence, was measured for both F-actin and G-actin and expressed as a ratio.

Rac Activation Assay
Rac activity was determined using a colorimetric Rac1,2,3 G-LISA Activation Assay (Cytoskeleton, CO) according to the manufacturer's instructions. PC12 cells transiently expressing P-Rex1, or stably RNAi P-Rex1-depleted, were transiently transfected with pcDNA3.1 myc-Rac1 or with pcDNA3.1 HA-Rac3, a kind gift from Dr Collard (Netherlands Cancer Institute). Cells were serum starved, or serum starved and then briefly NGF-stimulated, before whole-cell lysates were prepared using the cell lysis buffer provided, clarified by centrifugation and snap-frozen until required. Following determination of protein concentration according to the manufacturer's protocol, cell lysates were equalised by protein concentration, to 1 or 1.5 mg/ml, and then incubated in the Rac-GTP affinity plate for 30 minutes. Bound, activated Rac1, 2 or 3 was recognised using the pan-Rac antibody provided and a colorimetric reaction measured by absorbance at 490 nm. Assays were performed in duplicate. Protein expression of Rac1 versus Rac3 or P-Rex1 in transfected PC12 cells was quantitated using pan-Rac or P-Rex1 antibodies, respectively, by immunoblot analysis of each transfection.

Examination of P-Rex1 RNAi knockdown by RT-PCR
RNA was extracted from P-Rex1 or scrambled RNAi clones using the RNeasy Miniprep Kit (Qiagen, AL) according to the manufacturer's instructions. RT-PCR was performed using a QuantiTect SYBR green RT-PCR Kit (Qiagen) with P-Rex1- or Gapdh-specific QuantiTect Primer Assays (Qiagen). Reactions (25 µl) containing 10 ng RNA, 12.5 µl 2x QuantiTect SYBR Green RT-PCR Master Mix, 2.5 µl 10x QuantiTect Primer Assay and 0.25 µl QuantiTect RT Mix were performed in triplicate in a Corbett 3000 Rotor Gene Cycler using the following conditions: 50°C for 30 minutes, 95°C for 15 minutes, then 40 cycles of 94°C for 15 seconds, 55°C for 30 seconds and 72°C for 30 seconds. Relative expression of P-Rex1 as compared with Gapdh was calculated using the {Delta}{Delta}Ct method as described (Dussault and Pouliot, 2006Go).


   Acknowledgments
 
We thank Jennifer Dyson for helpful suggestions, Heidi Welch for providing constructs and helpful suggestions, and Monash MicroImaging for technical assistance. This work was funded from a grant from the NHMRC, Australia.


   Footnotes
 
Supplementary material available online at http://jcs.biologists.org/cgi/content/full/121/17/2892/DC1


   References
Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 

Abramoff, M., Magelhaes, P. and Ram, S. (2004). Image processing with Image J. Biophotonics Int. 11, 36-42.

Albertinazzi, C., Gilardelli, D., Paris, S., Longhi, R. and de Curtis, I. (1998). Overexpression of a neural-specific rho family GTPase, cRac1B, selectively induces enhanced neuritogenesis and neurite branching in primary neurons. J. Cell Biol. 142, 815-825.[Abstract/Free Full Text]

Aoki, K., Nakamura, T. and Matsuda, M. (2004). Spatio-temporal regulation of Rac1 and Cdc42 activity during nerve growth factor-induced neurite outgrowth in PC12 cells. J. Biol. Chem. 279, 713-719.[Abstract/Free Full Text]

Aoki, K., Nakamura, T., Fujikawa, K. and Matsuda, M. (2005). Local phosphatidylinositol 3,4,5-trisphosphate accumulation recruits Vav2 and Vav3 to activate Rac1/Cdc42 and initiate neurite outgrowth in nerve growth factor-stimulated PC12 cells. Mol. Biol. Cell 16, 2207-2217.[Abstract/Free Full Text]

Banker, G. and Goslin, K. (1991). Culturing Nerve Cells (Cellular and Molecular Series) (ed. C. F. Stevens). Cambridge, MA: The MIT Press.

Barber, M. A., Donald, S., Thelen, S., Anderson, K. E., Thelen, M. and Welch, H. C. (2007). Membrane translocation of P-Rex1 is mediated by G protein betagamma subunits and phosphoinositide 3-kinase. J. Biol. Chem. 282, 29967-29976.[Abstract/Free Full Text]

Bryan, B., Kumar, V., Stafford, L. J., Cai, Y., Wu, G. and Liu, M. (2004). GEFT, a Rho family guanine nucleotide exchange factor, regulates neurite outgrowth and dendritic spine formation. J. Biol. Chem. 279, 45824-45832.[Abstract/Free Full Text]

Chhatriwala, M. K., Betts, L., Worthylake, D. K. and Sondek, J. (2007). The DH and PH domains of Trio coordinately engage Rho GTPases for their efficient activation. J. Mol. Biol. 368, 1307-1320.[CrossRef][Medline]

Corbetta, S., Gualdoni, S., Albertinazzi, C., Paris, S., Croci, L., Consalez, G. G. and de Curtis, I. (2005). Generation and characterization of Rac3 knockout mice. Mol. Cell. Biol. 25, 5763-5776.[Abstract/Free Full Text]

Corbetta, S., D'Adamo, P., Gualdoni, S., Braschi, C., Berardi, N. and de Curtis, I. (2008). Hyperactivity and novelty-induced hyperreactivity in mice lacking Rac3. Behav. Brain Res. 186, 246-255.[CrossRef][Medline]

de Curtis, I. (2008). Functions of Rac GTPases during neuronal development. Dev. Neurosci. 30, 47-58.[CrossRef][Medline]

Dent, E. W. and Gertler, F. B. (2003). Cytoskeletal dynamics and transport in growth cone motility and axon guidance. Neuron 40, 209-227.[CrossRef][Medline]

Dice, J. F. (1987). Molecular determinants of protein half-lives in eukaryotic cells. FASEB J. 1, 349-357.[Abstract]

Dickson, B. J. (2001). Rho GTPases in growth cone guidance. Curr. Opin. Neurobiol. 11, 103-110.[CrossRef][Medline]

Donald, S., Hill, K., Lecureuil, C., Barnouin, R., Krugmann, S., John Coadwell, W., Andrews, S. R., Walker, S. A., Hawkins, P. T., Stephens, L. R. et al. (2004). P-Rex2, a new guanine-nucleotide exchange factor for Rac. FEBS Lett. 572, 172-176.[CrossRef][Medline]

Dong, X., Mo, Z., Bokoch, G., Guo, C., Li, Z. and Wu, D. (2005). P-Rex1 is a primary Rac2 guanine nucleotide exchange factor in mouse neutrophils. Curr. Biol. 15, 1874-1879.[CrossRef][Medline]

Dotti, C. G., Sullivan, C. A. and Banker, G. A. (1988). The establishment of polarity by hippocampal neurons in culture. J. Neurosci. 8, 1454-1468.[Abstract]

Dussault, A. A. and Pouliot, M. (2006). Rapid and simple comparison of messenger RNA levels using real-time PCR. Biol. Proced. Online 8, 1-10.[CrossRef][Medline]

Estrach, S., Schmidt, S., Diriong, S., Penna, A., Blangy, A., Fort, P. and Debant, A. (2002). The Human Rho-GEF trio and its target GTPase RhoG are involved in the NGF pathway, leading to neurite outgrowth. Curr. Biol. 12, 307-312.[CrossRef][Medline]

Feng, Q., Baird, D. and Cerione, R. A. (2004). Novel regulatory mechanisms for the Dbl family guanine nucleotide exchange factor Cool-2/alpha-Pix. EMBO J. 23, 3492-3504.[CrossRef][Medline]

Govek, E. E., Newey, S. E. and Van Aelst, L. (2005). The role of the Rho GTPases in neuronal development. Genes Dev. 19, 1-49.[Abstract/Free Full Text]

Greene, L. A. and Tischler, A. S. (1976). Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc. Natl. Acad. Sci. USA 73, 2424-2428.[Abstract/Free Full Text]

Gualdoni, S., Albertinazzi, C., Corbetta, S., Valtorta, F. and de Curtis, I. (2007). Normal levels of Rac1 are important for dendritic but not axonal development in hippocampal neurons. Biol. Cell 99, 455-464.[CrossRef][Medline]

Hajdo-Milasinovic, A., Ellenbroek, S. I., van Es, S., van der Vaart, B. and Collard, J. G. (2007). Rac1 and Rac3 have opposing functions in cell adhesion and differentiation of neuronal cells. J. Cell Sci. 120, 555-566.[Abstract/Free Full Text]

Hernandez-Negrete, I., Carretero-Ortega, J., Rosenfeldt, H., Hernandez-Garcia, R., Calderon-Salinas, J. V., Reyes-Cruz, G., Gutkind, J. S. and Vazquez-Prado, J. (2007). P-Rex1 links mammalian target of rapamycin signaling to Rac activation and cell migration. J. Biol. Chem. 282, 23708-23715.[Abstract/Free Full Text]

Hill, K., Krugmann, S., Andrews, S. R., Coadwell, W. J., Finan, P., Welch, H. C., Hawkins, P. T. and Stephens, L. R. (2005). Regulation of P-Rex1 by phosphatidylinositol (3,4,5)-trisphosphate and Gβ{gamma} subunits. J. Biol. Chem. 280, 4166-4173.[Abstract/Free Full Text]

Kubiseski, T. J., Culotti, J. and Pawson, T. (2003). Functional analysis of the Caenorhabditis elegans UNC-73B PH domain demonstrates a role in activation of the Rac GTPase in vitro and axon guidance in vivo. Mol. Cell. Biol. 23, 6823-6835.[Abstract/Free Full Text]

Letourneau, P. C., Shattuck, T. A. and Ressler, A. H. (1987). "Pull" and "push" in neurite elongation: observations on the effects of different concentrations of cytochalasin B and taxol. Cell Motil. Cytoskeleton 8, 193-209.[CrossRef][Medline]

Lin, C. H. and Forscher, P. (1995). Growth cone advance is inversely proportional to retrograde F-actin flow. Neuron 14, 763-771.[CrossRef][Medline]

Luo, L. (2000). Rho GTPases in neuronal morphogenesis. Nat. Rev. Neurosci. 1, 173-180.[Medline]

Luo, L. (2002). Actin cytoskeleton regulation in neuronal morphogenesis and structural plasticity. Annu. Rev. Cell Dev. Biol. 18, 601-635.[CrossRef][Medline]

Malosio, M. L., Gilardelli, D., Paris, S., Albertinazzi, C. and de Curtis, I. (1997). Differential expression of distinct members of Rho family GTP-binding proteins during neuronal development: identification of Rac1B, a new neural-specific member of the family. J. Neurosci. 17, 6717-6728.[Abstract/Free Full Text]

Marsh, L. and Letourneau, P. C. (1984). Growth of neurites without filopodial or lamellipodial activity in the presence of cytochalasin B. J. Cell Biol. 99, 2041-2047.[Abstract/Free Full Text]

Matsuo, N., Hoshino, M., Yoshizawa, M. and Nabeshima, Y. (2002). Characterization of STEF, a guanine nucleotide exchange factor for Rac1, required for neurite growth. J. Biol. Chem. 277, 2860-2868.[Abstract/Free Full Text]

Ng, J., Nardine, T., Harms, M., Tzu, J., Goldstein, A., Sun, Y., Dietzl, G., Dickson, B. J. and Luo, L. (2002). Rac GTPases control axon growth, guidance and branching. Nature 416, 442-427.[CrossRef][Medline]

Norris, F. A. and Majerus, P. W. (1994). Hydrolysis of phosphatidylinositol 3,4-bisphosphate by inositol polyphosphate 4-phosphatase isolated by affinity elution chromatography. J. Biol. Chem. 269, 8716-8720.[Abstract/Free Full Text]

Nystuen, A., Legare, M. E., Shultz, L. D. and Frankel, W. N. (2001). A null mutation in inositol polyphosphate 4-phosphatase type I causes selective neuronal loss in weeble mutant mice. Neuron 32, 203-212.[CrossRef][Medline]

Penzes, P., Johnson, R. C., Kambampati, V., Mains, R. E. and Eipper, B. A. (2001). Distinct roles for the two Rho GDP/GTP exchange factor domains of kalirin in regulation of neurite growth and neuronal morphology. J. Neurosci. 21, 8426-8434.[Abstract/Free Full Text]

Rosenfeldt, H., Vazquez-Prado, J. and Gutkind, J. S. (2004). P-REX2, a novel PI-3-kinase sensitive Rac exchange factor. FEBS Lett. 572, 167-171.[CrossRef][Medline]

Rossman, K. L., Der, C. J. and Sondek, J. (2005). GEF means go: turning on RHO GTPases with guanine nucleotide-exchange factors. Nat. Rev. Mol. Cell. Biol. 6, 167-180.[CrossRef][Medline]

Schiller, M. R., Blangy, A., Huang, J., Mains, R. E. and Eipper, B. A. (2005). Induction of lamellipodia by Kalirin does not require its guanine nucleotide exchange factor activity. Exp. Cell Res. 307, 402-417.[CrossRef][Medline]

Sugihara, K., Nakatsuji, N., Nakamura, K., Nakao, K., Hashimoto, R., Otani, H., Sakagami, H., Kondo, H., Nozawa, S., Aiba, A. et al. (1998). Rac1 is required for the formation of three germ layers during gastrulation. Oncogene 17, 3427-3433.[CrossRef][Medline]

Tanaka, E. and Sabry, J. (1995). Making the connection: cytoskeletal rearrangements during growth cone guidance. Cell 83, 171-176.[CrossRef][Medline]

Tanaka, M., Ohashi, R., Nakamura, R., Shinmura, K., Kamo, T., Sakai, R. and Sugimura, H. (2004). Tiam1 mediates neurite outgrowth induced by ephrin-B1 and EphA2. EMBO J. 23, 1075-1088.[CrossRef][Medline]

Torreano, P. J., Waterman-Storer, C. M. and Cohan, C. S. (2005). The effects of collapsing factors on F-actin content and microtubule distribution of Helisoma growth cones. Cell Motil. Cytoskeleton 60, 166-179.[CrossRef][Medline]

Tudor, E. L., Perkinton, M. S., Schmidt, A., Ackerley, S., Brownlees, J., Jacobsen, N. J., Byers, H. L., Ward, M., Hall, A., Leigh, P. N. et al. (2005). ALS2/ALSIN regulates RAC-PAK signalling and neurite outgrowth. J. Biol. Chem. 280, 34735-34740.[Abstract/Free Full Text]

Welch, H. C., Coadwell, W. J., Ellson, C. D., Ferguson, G. J., Andrews, S. R., Erdjument-Bromage, H., Tempst, P., Hawkins, P. T. and Stephens, L. R. (2002). P-Rex1, a PtdIns(3,4,5)P3- and Gbetagamma-regulated guanine-nucleotide exchange factor for Rac. Cell 108, 809-821.[CrossRef][Medline]

Welch, H. C., Condliffe, A. M., Milne, L. J., Ferguson, G. J., Hill, K., Webb, L. M., Okkenhaug, K., Coadwell, W. J., Andrews, S. R., Thelen, M. et al. (2005). P-Rex1 regulates neutrophil function. Curr. Biol. 15, 1867-1873.[CrossRef][Medline]

Yoshizawa, M., Kawauchi, T., Sone, M., Nishimura, Y. V., Terao, M., Chihama, K., Nabeshima, Y. and Hoshino, M. (2005). Involvement of a Rac activator,P-Rex1, in neurotrophin-derived signaling and neuronal migration. J. Neurosci. 25, 4406-4419.[Abstract/Free Full Text]

Zhou, F. Q., Waterman-Storer, C. M. and Cohan, C. S. (2002). Focal loss of actin bundles causes microtubule redistribution and growth cone turning. J. Cell Biol. 157, 839-849.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
 J. Cell Sci.Home page
A. Hajdo-Milasinovic, R. A. van der Kammen, Z. Moneva, and J. G. Collard
Rac3 inhibits adhesion and differentiation of neuronal cells by modifying GIT1 downstream signaling
J. Cell Sci., June 15, 2009; 122(12): 2127 - 2136.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow All Versions of this Article:
jcs.030353v1
121/17/2892    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Waters, J. E.
Right arrow Articles by Mitchell, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Waters, J. E.
Right arrow Articles by Mitchell, C. A.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?