spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online September 3, 2008
doi: 10.1242/10.1242/jcs.030056


Journal of Cell Science 121, 3099-3108 (2008)
Published by The Company of Biologists 2008
This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Veeranki, S.
Right arrow Articles by Kim, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Veeranki, S.
Right arrow Articles by Kim, L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Research Article

The GPI-anchored superoxide dismutase SodC is essential for regulating basal Ras activity and for chemotaxis of Dictyostelium discoideum

Sudhakar Veeranki, Bohye Kim and Leung Kim*

Department of Biological Sciences, Florida International University, Miami, FL 33199, USA

* Author for correspondence (e-mail: kiml{at}fiu.edu)

Accepted 1 July 2008


    Summary
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
A genetic screen for Dictyostelium mutant displaying high level of constitutive phosphatidylinositol (3,4,5)-trisphosphate led to the finding that the glycosylphosphatidylinositol (GPI)-anchored superoxide dismutase SodC regulates small GTPase Ras. Cells that lack SodC exhibited constitutively high levels of active Ras, more membrane localization of GFP-PHcrac, and defects in chemoattractant sensing, cell polarization and motility. These defects of SodC-lacking cells were partially restored by expression of wild-type SodC but not by the catalytically inactive mutant SodC (H245R, H247Q). Furthermore, an inhibition of PI3K activity in SodC-deficient cells by LY294002 only partially restored chemoattractant sensing and cell polarization, consistent with the fact that SodC-deficient cells have aberrantly high level of active Ras, which functions upstream of PI3K. A higher level of active GFP-RasG was observed in SodC-deficient cells, which significantly decreased upon incubation of SodC-deficient cells with the superoxide scavenger XTT. Having constitutively high levels of active Ras proteins and more membrane localization of GFP-PHcrac, SodC-deficient cells exhibited severe defects in chemoattractant sensing, cell polarization and motility.

Key words: SOD, Ras, PI3K, PtdIns(3,4,5)P3, Chemotaxis, Motility


    Introduction
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Motile eukaryotic cells are equipped with machineries that interpret chemoattractant gradients and regulating cell polarization and motility. The molecular nature of these machineries remains to be fully understood. One view suggests that chemotaxis is regulated by a hypothetical molecular compass that functions upstream of PI3K and phospholipase A2 (PLA2), which could complement each other to form surprisingly robust molecular circuits that ensure proper chemotaxis under diverse situations (Chen et al., 2007Go; van Haastert et al., 2007Go). Several studies also showed that PI3K function is less crucial for efficient chemotaxis under a strong (over 1 µM cAMP) chemoattractant gradient, but is necessary under a weak (below 0.1 µM cAMP) gradient (Loovers et al., 2006Go; Takeda et al., 2007Go; Hoeller and Kay, 2007Go). Inactivation of either the PI3K or PLA2 pathways significantly perturbs chemotaxis under a weak gradient but not under a strong gradient (van Hastert et al., 2007Go). When both pathways are compromised, chemotaxis is severely compromised, even under a strong gradient (van Hastert et al., 2007Go). Another view, by contrast, suggests that the regulation of pseudopod formation is central in gradient sensing, where PtdIns(3,4,5)P3 is not the major determinant of the polarization or of the directional pseudopod formation, but rather controls the frequency of pseudopod formation (Andrew and Insall, 2007Go). It is not easy to compare these different views, considering that each group adopted very different chemotaxis assays for their studies, so it seems that more investigation into the mechanisms of chemotaxis is necessary in order to fully understand its nature.

Phosphatidylinositol (3,4,5)-trisphosphate [PtdIns(3,4,5)P3] is still an important part of the chemotaxis machinery in some situations, but it is not the molecular compass for gradient sensing, as was suggested initially (Loovers et al., 2006Go; Hoeller and Kay, 2007Go; Takeda et al., 2007Go). Generation of PtdIns(3,4,5)P3 depends heavily on the regulation of PI3Ks. In Dictyostelium, two PI3Ks, PI3K1 and PI3K2, are mostly responsible for chemoattractant cAMP-dependent PtdIns(3,4,5)P3 generation (Zhou et al., 1995Go; Huang et al., 2003Go). Both kinases can localize either at the cytosol or at the plasma membrane in response to chemoattractant signals. The domains for membrane localization and kinase activation have been clearly defined by serial deletion analysis. The membrane-targeting domain precedes the central Ras-binding domain, which mediates activation of the kinase through Ras (Funamoto et al., 2002Go). Previous studies also established that activation of PI3K through small GTPase Ras facilitates PI3K membrane localization of PI3K, and thus forms a positive-feedback loop in both a chemoattractant signal-dependent and -independent manner (Sasaki et al., 2004Go; Sasaki et al., 2007Go). The latter also explains how the Ras-PI3K loop is involved in the modulation of basic cell motility (Sasaki et al., 2007Go).

To identify additional regulators of PtdIns(3,4,5)P3, we performed restriction enzyme mediated insertion (REMI) mutagenesis on cells expressing GFP-PHcrac protein [a pleckstrin homology (PH) domain from the cytosolic regulator of adenylyl cyclase (CRAC) protein fused to the green fluorescent protein (GFP)]. Mutants that exhibit higher levels of GFP-PHcrac at the plasma membrane in the absence of chemoattractant stimulation were isolated by monitoring enhanced plasma membrane localization of GFP-PHcrac proteins. Four of the REMI mutants exhibited insertions at the same locus, which encodes a GPI-anchored superoxide dismutase (SOD) protein, SodC. A previous study using chemical superoxide scavengers suggested that proper control of superoxide radicals plays an important role in Dictyostelium cell aggregation (Bloomfield and Pears, 2003Go). The mechanism that underlies radical generation and dismutation, and the cellular targets that are involved in Dictyostelium aggregation have yet to be identified. In this report, we will present the characterization of SodC and the phenotypes of sodC cells, and will discuss potential roles of SodC in chemotaxis through the regulation of Ras activity and of PI3K.


    Results
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Generation of REMI mutants that exhibit higher constitutive levels of PtdIns(3,4,5)P3
To find additional components involved in the regulation of PtdIns(3,4,5)P3 levels, wild-type cells expressing GFP-PHcrac were randomly mutagenized by the terminator trapping REMI method (Takeda et al., 2003Go). GFP-PHcrac has previously been shown to bind PtdIns(3,4,5)P3 and has been used as a marker for PtdIns(3,4,5)P3 localization (Huang et al., 2003Go). Out of ~1000 independently isolated insertional mutants, six independent remi clones exhibited elevated level of GFP-PHcrac at the plasma membrane in the absence of chemoattractant stimulation (Fig. 1A). By contrast, GFP-PHcrac proteins were localized uniformly through the cytoplasm and occasionally enriched at the local membrane ruffles and macropinosomes in wild-type cells. It is expected that the mutants displaying higher PtdIns(3,4,5)P3 levels would be severely defective in chemotaxis. One such example is pten cells, which show severe defect in chemotaxis (Funamoto et al., 2002Go; Iijima and Devreotes, 2002Go). remi56 cells, as a representative of REMI mutants, failed to form territorial streams when tested by under-buffer aggregation assay (Fig. 1B).


Figure 1
View larger version (66K):
[in this window]
[in a new window]

 
Fig. 1. Generation of REMI mutants exhibiting higher basal levels of GFP-PHcrac at the plasma membrane. (A) remi56 cells displayed more plasma membrane localization of GFP-PHcrac, which suggests higher PtdIns(3,4,5)P3 levels in the membrane of remi56. (B) Wild type and remi56 lines were tested to see whether they are able to form developmental territorial streams. remi56 lines failed to aggregate in submerged culture at the cell density of 2.5x10 cells/cm, whereas wild type cells aggregated normally.

 
Identification and characterization of SodC
Insertion loci were identified as described in the Materials and Methods. Remi56, as well as three other mutants had insertions at the same locus encoding an extracellular superoxide dismutase (SOD) previously identified as SodC (Tsuji et al., 2003Go). SodC message is expressed both in vegetative and aggregative stages, and gradually declined as cells terminally differentiate (Van Driessche et al., 2002Go; Iranfar et al., 2003Go). Sequence analysis of SodC revealed a signal peptide as previously suggested (Tsuji et al., 2003Go), and a previously undescribed C-terminal glycosylphosphatidylinositol (GPI)-anchoring motif (Fig. 2A). Interestingly, SodC encodes an incomplete SOD domain near the N-terminal end, in addition to a complete SOD near the C terminus. Three independent sodC cells were generated by homologous recombination and confirmed by genomic PCR analysis (Fig. 2B). sodC cells were transfected with a GFP-PHcrac expression construct to assess indirectly the level of PtdIns(3,4,5)P3. sodC cells exhibited significantly more GFP-PHcrac protein at the plasma membrane than did wild-type cells, similar to remi56 (Fig. 2C). Aberrant plasma membrane localization of the GFP-PHcrac proteins in sodC cells was further confirmed by subcellular fractionation. The membrane and cytosolic fractions were prepared from wild-type and sodC cells using membrane filters (Parent et al., 1998Go), and analyzed by western blotting using an anti-GFP antibody. Consistent with the GFP images, significantly more GFP-PHcrac protein was detected in the membrane fraction of the sodC cells (Fig. 2D). As a control, the same blot was re-probed with a pan-Ras antibody. As expected, most Ras proteins were detected from membrane fractions. These data suggest that both remi56 and sodC cells might have constitutively higher levels of PtdIns(3,4,5)P3.


Figure 2
View larger version (65K):
[in this window]
[in a new window]

 
Fig. 2. Identification of the insertional mutation in the REMI mutants and generation of sodC cells. (A) remi56 displayed an insertion at a locus encoding a superoxide dismutase (SOD) domain-containing protein, SodC. SodC encodes an N-terminal signal peptide with the C-terminal GPI-anchoring sequence (omega domain), and a partial and a full Cu/Zn-superoxide dismutase (SOD) domain. (B) sodC cells were generated by homologous recombination from wild-type cells, and confirmed by genomic PCR. (C) sodC cells showed increased basal membrane localization of GFP-PHcrac compared with wild-type cells. (D) Western blot analysis of the cytosolic and membrane fractions of the wild-type and sodC cells showed more GFP-PHcrac localization at the membrane in sodC than in wild-type cells. Ras proteins are shown as a loading control for membrane fractions.

 


Figure 3
View larger version (18K):
[in this window]
[in a new window]

 
Fig. 3. SodC has SOD activity. (A) The SodC SOD domain was expressed in Dictyostelium as a GFP fusion protein under the Actin 15 promoter. GFP and GFP-SOD proteins were purified by immunoprecipitation with anti-GFP antibody, and normalized by western blot analysis using anti-GFP antibody. (B) Relative superoxide levels were compared after incubation with equal amounts of purified GFP or GFP-SOD protein. The relative superoxide level from GFP was set as 1.0. GFP-SOD samples exhibited an average level of 0.3 (standard deviation of 0.06) from three independent experiments.

 
SodC encodes superoxide dismutase with a GPI anchor
The Cu/Zn-SOD domain of SodC was expressed as a GFP fusion protein under the Actin-15 promoter and detected by anti-GFP antibody (Fig. 3A). When incubated with superoxide radicals, the GFP-SOD domain inhibited superoxide-dependent Formazan formation, whereas the same amount of GFP control showed little inhibition (Fig. 3B).

To confirm that SodC is actually a GPI-anchored membrane protein, a Myc-tag was inserted after the signal peptide of the full-length SodC. Myc-SodC proteins were immunopurified and detected by anti-Myc antibody (Fig. 4A, bottom left). Membrane localization of Myc-SodC was evident from both western blotting of subcellular fractions (Fig. 4A, bottom right) and indirect immunofluorescence microscopy (Fig. 4B). To further test whether there is a GPI anchored SOD activity, wild-type cells were treated with GPI specific phosphatidylinositol-phospholipase C (PI-PLC) (Kondoh et al., 2005Go). The media from PI-PLC treated wild-type cells displayed three times higher SOD activity than that of the control (Fig. 4C). By contrast, the media from sodC cells displayed no measurable amounts of SOD activity under the same experimental conditions.


Figure 4
View larger version (30K):
[in this window]
[in a new window]

 
Fig. 4. SodC is a GPI-anchored membrane protein. (A) A Myc epitope tag was inserted in-frame after the SodC signal peptide. Myc-SodC was expressed in the wild-type background, and detected by western blotting (bottom left). Membrane and cytosolic fractions were prepared, and Myc-SodC was detected only from the membrane fraction (bottom right). (B) Membrane localization of Myc-SodC was also confirmed by indirect immunofluorescence. (C) Log phase wild-type and sodC cells were plated at a density of 1x10 cells/cm, and treated with or without 1 unit of GPI-specific PI-PLC for 5 minutes at 25°C. Extracellular SOD activities were compared. (D) The relative levels of extracellular superoxide in wild-type and sodC cells were measured using XTT reduction, as described in the Materials and Methods. Virtually identical levels of the radical were detected from three independent experiments. (E) The relative intracellular superoxide levels were determined using NBT. Cell-trapped NBT levels were ~18±5% (s.d.) higher in sodC than in wild-type cells (data are from three independent experiments).

 
Being localized on the outer leaflet of the plasma membrane through a GPI anchor, SodC may control extracellular superoxide level and/or penetration of the radical across the plasma membrane, and thus intracellular superoxide level. When tested by the previously published assay method using superoxide-sensitive reagent XTT (Bloomfield and Pears, 2003Go), wild-type and sodC cells displayed no significant difference in the level of extracellular superoxide level, as shown in Fig. 4D.

Next, the intracellular superoxide levels were measured using another superoxide sensitive reagent: NBT. Contrary to XTT, NBT becomes an insoluble precipitate upon reduction by superoxide (Choi et al., 2006Go). The amount of insoluble NBT trapped inside the sodC cells was consistently higher (by ~18%) than that in the wild type (Fig. 4E). These data suggest that SodC is a GPI-anchored superoxide dismutase that is involved in the regulation of intracellular level of superoxide in Dictyostelium cells.

sodC cells are defective in chemotaxis but not in development
Like remi56 cells, sodC cells were severely defective in aggregation (Fig. 5A). However, when plated at high cell densities where chemotaxis is less essential, sodC cells developed indistinguishably from wild-type cells (Fig. 5B). These data strongly suggest that SodC is essential for chemotaxis but not for development.


Figure 5
View larger version (62K):
[in this window]
[in a new window]

 
Fig. 5. sodC cells were defective in aggregation, but not in development. (A) sodC cells failed to aggregate in submerged culture at low cell density (2.5x10 cells/cm), where wild-type cells aggregate normally. (B) sodC cells displayed normal development when plated at high cell densities (1.25x10 cells/cm) at which chemotaxis can be bypassed.

 

sodC cells, after being pulsed for 4 hours, displayed a significantly compromised chemoattractant sensing during the first 20 minutes under both weak and strong cAMP gradients (Fig. 6B,C). However, during the second 20 minutes under both weak and strong cAMP gradients, sodC cells showed an improvement in cAMP sensing, but only up to ~40 % of the wild-type level. In addition, sodC cells showed severe motility defects, which were worse under weak cAMP gradient (Table 1). Contrary to the chemotaxis index, the speed of motility did not improve during the whole duration of the assay.


Figure 6
View larger version (13K):
[in this window]
[in a new window]

 
Fig. 6. sodC cells were defective in chemotaxis. (A-C) Cells were challenged with a point source of either 0.1 µM or 10 µM cAMP. Tracing images of chemotaxing cells were arranged to demonstrate relative directional movement, cell shape and distances traveled towards the cAMP point source (circle). Superimposed tracing images were grouped as early (0 to 20 minutes) and late (21-40 minutes) duration as marked. Each tracing image is a 1-minute interval. (D) The roundness of chemotaxing cells is summarized as defined in the Materials and Methods.

 

View this table:
[in this window]
[in a new window]

 
Table 1. Summary of chemotactic indices and motilities of sodC cells

 

sodC cells displayed less polarization during the first 20 minutes under both a weak and strong gradient than did wild-type cells. An improvement in the polarity from 0.6 to 0.3 was observed from sodC cells under a strong gradient during the last 20 minutes, whereas no such improvement was made from sodC cells under a weak gradient (Fig. 6D). sodC cells displayed multiple problems in chemotaxis that cannot easily be overcome by a higher concentration of or a longer exposure to chemoattractant cAMP.

Re-introduction of wild-type SodC, not the inactive mutant SodC, partially attenuated the chemotaxis defects of sodC cells
A previous study showed that substitution of two histidine residues in the Cu2+-binding motif of the SOD domain with arginine and glutamate led to an effective loss of SOD activity (Wang et al., 2002Go). Similarly, the catalytically inactive SodC (H245R,H247Q) was generated and expressed in sodC cells. Levels of SodC transcripts were compared in wild type, in sodC cells and in sodC cells expressing wild-type SodC or SodC(H245R,H247Q) by RT-PCR (as shown in Fig. 7A). A clear SodC message was detected from wild-type cells, but not from sodC cells. SodC cells expressing wild-type SodC or SodC(H245R,H247Q) displayed a comparable level of SodC message, which is higher than that of the endogenous SodC messages.


Figure 7
View larger version (21K):
[in this window]
[in a new window]

 
Fig. 7. Defects in sodC cells were partially rescued by SodC but not by a SodC(H245R,H247Q) double-point mutation. (A) RT-PCR experiment with a primer set specific for SodC was used to detect the level of SodC transcript. A specific RT-PCR product was obtained from wild type, but not from sodC cells as expected. Ig7 transcripts were used as a control. Similar levels of the transcripts were observed in sodC cells expressing wild-type SodC and the SodC(H245R,H247Q) mutant under Actin-15 promoter. (B) sodC cells expressing wild-type SodC and SodC(H245R,H247Q) mutant were challenged with a micropipette filled with 0.1 µM cAMP for 20 minutes. Twenty stacks of tracing images are shown with a 100 µm scale bar. Summary of the roundness (C) is shown.

 
sodC cells with this level of re-introduced SodC messages were challenged with a micropipette filled with 0.1 µM cAMP for 20 minutes. The chemotaxis index of sodC cells expressing full-length SodC was near ~90% of the wild-type level, and their speed improved to ~40% of the wild-type level. By contrast, the chemotaxis index of sodC cells expressing SodC(H245R, H247Q) was similar to that of the parental sodC cells (Fig. 7). Although the complementation was less than complete, there was a clear improvement in chemotaxis and cell polarization by wild-type SodC expression but not by the mutant SodC in sodC cells (Table 2; Fig. 7C).


View this table:
[in this window]
[in a new window]

 
Table 2. Summary of chemotactic indices and motilities of sodC cells expressing either wild-type SodC or the SodC(H245R,H247Q) double-point mutant

 

sodC cells pretreated with PI3K inhibitor LY294002 exhibited improved chemotaxis
To determine whether sodC cells are defective in chemotaxis mainly because of the presence of an excessive PtdIns(3,4,5)P3, cells expressing PtdIns(3,4,5)P3 marker GFP-PHcrac were pulsed for 4 hours with 50 nM cAMP, and either left in DB buffer or treated with 15 µM or 50 µM of PI3K inhibitor LY294002 (LY) for 20 minutes. sodC cells expressing GFP-PHcrac showed aberrant plasma membrane localization, which decreased significantly at the plasma membrane after treatment with 15 µM or 50 µM LY294002 (Fig. 8A). However, LY294002-treated sodC cells still displayed PtdIns(3,4,5)P3 enriched macropinosomes and local ruffles, indicating that PtdIns(3,4,5)P3 levels were attenuated but not completely depleted (Fig. 8A).


Figure 8
View larger version (25K):
[in this window]
[in a new window]

 
Fig. 8. LY294002 treatment attenuated chemotaxis defects of sodC cells. (A) Cells expressing the PtdIns(3,4,5)P3 marker GFP-PHcrac were pulsed for 4 hours with 50 nM cAMP, and either left in DB buffer or treated with 15 µM or 50 µM LY294002 (LY) for 20 minutes. GFP-PHcrac aberrantly localized at the plasma membrane of sodC cells but not of wild type. Membrane localization of GFP-PHcrac in sodC cells largely disappeared after LY treatment. GFP signals at the membrane of sodC cells were reminiscent of fine filopodial extensions, which also disappeared after LY treatment. (B) Wild-type and sodC cells were pulsed for 4 hours with 50 nM cAMP, and treated with and without 15 µM LY294002 (LY) for 20 minutes. Cells were then challenged with micropipettes filled with 10 µM cAMP for 20 minutes. Twenty stacks of cell tracing images 1 minute apart, are shown with a 100 µm scale bar. (C) Roundness values of the analyzed cells are shown.

 

Then, wild-type and sodC cells were incubated with 15 µM LY294002 for 20 minutes, and challenged with micropipette filled with 10 µM cAMP for 20 minutes. Wild-type cells showed comparable chemotaxis indices and speeds irrespective of 15 µM LY294002 treatment (Fig. 8). Untreated sodC cells almost completely failed to respond to a micropipette filled with 10 µM cAMP (Fig. 8). By contrast, sodC cells pretreated with LY294002 displayed a near wild-type level of gradient sensing, significantly improved speed of motility and cell polarization (Table 3; Fig. 8C). By contrast, the restoration of the speed of locomotion by LY treatment was lesser (Table 3).


View this table:
[in this window]
[in a new window]

 
Table 3. Summary of chemotactic indices and motilities of wild-type and sodC cells treated with LY294002

 

sodC cells displayed aberrant PI3K regulation
Regulation of PI3K1 and PI3K2, the two major enzymes largely responsible for chemoattractant-induced PtdIns(3,4,5)P3 generation in Dictyostelium, is complex. Through a yet to be identified mechanism, cells control membrane and cytoplasmic localization of PI3K (Funamoto et al., 2003). In addition, activation of Ras proteins leads to an enhanced PI3K activity. Subsequently, more PtdIns(3,4,5)P3 will accumulate, which in turn stimulate membrane localization of PI3K through a F-Actin-dependent mechanism (Sasaki et al., 2004Go). In the absence of chemoattractant stimulation, wild-type cells maintain a minor, but detectible, fraction of PI3K at the plasma membrane (Han et al., 2006Go; Sasaki et al., 2004Go).

sodC cells displayed N-PI3K1-GFP proteins localized uniformly throughout the plasma membrane, whereas wild-type cells displayed a strong enrichment at the leading front (Fig. 9A). This was further confirmed by western blot analysis on the membranous and cytosolic fractions prepared from cells expressing equivalent amount of N-PI3K1-GFP proteins (Fig. 9B). Localization of the other major regulator of PtdIns(3,4,5)P3, PTEN, was also examined. No significant difference in the localization of GFP-fused PTEN proteins was observed from wild-type and sodC cells (Fig. 9A). The aberrancy in the localization of N-PI3K1-GFP in sodC cells was further highlighted when examined upon global stimulation with cAMP. Instead of a transient membrane localization observed in wild type, N-PI3K1-GFP showed membrane localization before the stimulation, which almost failed to change in response to global cAMP stimulation (Fig. 9C). sodC cells consistently displayed less polarized cell shapes.


Figure 9
View larger version (55K):
[in this window]
[in a new window]

 
Fig. 9. Aberrant localization of PI3K in sodC cells. (A) The membrane localization domain of PI3K1 (N-PI3K1) fused with GFP was expressed in wild-type and sodC cells. Aggregation-competent polarized wild-type cells clearly demonstrated localized PI3K membrane translocation at the leading edge, whereas sodC cells showed no PI3K polarization around the membrane. By contrast, GFP-PTEN localization was indistinguishable between wild-type and sodC cells. (B) 0.01% Triton X100 fraction showed that more N-PI3K1-GFP proteins were aberrantly enriched in the membrane fraction of sodC cells than of wild-type cells. (C) Cells expressing PI3K1-LD-GFP proteins were pulsed with 50 nM cAMP for 4 hours, and stimulated with 10 µM cAMP. Membrane translocation of PI3K1-LD protein was recorded at 10-second intervals. Clear membrane localization of PI3K1-LD was observed in wild-type cells, but no such changes were seen in sodC cells. (D) Cells were pulsed for 4 hours, fixed and stained with TRITC-phalloidin, as described in the Materials and Methods. Two representative images are shown for each wild-type and sodC cell. Wild-type cells displayed more polarized cell bodies with a leading edge enriched with F-Actin. By contrast, sodC cells were much more round than the wild type and showed numerous filopodia-like structures instead of a dominant pseudopodium. (E) Pulsed cells were stimulated with 10 µM cAMP as indicated, and lysed with a F-Actin buffer containing 0.2 % of Triton X-100 and TRITC-phalloidin, and the F-Actin levels were measured as described in the Materials and Methods. sodC cells displayed a higher basal level of F-Actin compared with wild type, but no wild-type-like response was observed after cAMP stimulation.

 
To examine the F-Actin organization in camp-pulsed sodC cells, cells were stained with TRITC-phalloidin (Fig. 9D). Although polarized wild-type cells showed a dominant leading front enriched with F-Actin, sodC cells exhibited numerous filopodial extensions and membrane ruffles around their more round cell bodies. When stimulated with 10 µM cAMP, wild-type cells displayed a twofold increase in F-Actin level after 5 seconds of stimulation, which rapidly decreased close to the basal level. By contrast, sodC cells exhibited ~20% higher basal F-Actin level compared with that of the wild type, but showed no further increase in response to cAMP stimulation (Fig. 9E).

SodC regulates Ras, an upstream regulator of PI3K
Ras is an upstream regulator of PI3K, and subject to regulation by superoxide in vitro (Sasaki et al., 2004Go; Cox and Der, 2003Go; Heo and Campbell, 2005Go). We tested whether Ras is aberrantly regulated in sodC cells by using GFP-RBD (Ras-Binding Domain) protein, which was previously used as an active Ras marker in Dictyostelium cells (Sasaki et al., 2004Go). Active Ras proteins in cells were indirectly visualized by monitoring GFP-RBD proteins after 4 hours of pulsing. As shown in Fig. 10A, wild-type cells almost always showed polarized GFP-RBD localization after 4 hours of cAMP pulsing. Cells with sodC background, by contrast, displayed strikingly disorganized pattern of GFP-RBD protein (Fig. 10A). Furthermore, more active Ras proteins were detected from sodC cells than wild-type cells by GST-RBD pull-down assay (Fig. 10B) (Sasaki et al., 2004Go). In addition, when stimulated globally with 10 µM cAMP, sodC cells displayed higher basal Ras proteins than wild-type cells with no further increase in the active Ras level. By contrast, wild-type cells displayed the transient Ras activation as expected (Fig. 10C).


Figure 10
View larger version (52K):
[in this window]
[in a new window]

 
Fig. 10. Ras proteins were not properly regulated in sodC cells. (A) Active Ras proteins are visualized by GFP-RBD signals on the plasma membrane. Wild-type cells often displayed well-organized RBD signal on one side of a cell, whereas sodC exhibited broad GFP-RBD signal around cellular peripheries. Images were captured after 4 hours of cAMP pulsing. (B) A significantly higher basal level of active Ras was detected in extracts from sodC cells compared with wild-type cells after 4 hours of pulsing. (C) Cells were pulsed with 50nM cAMP for 4 hours, and then stimulated with 10 µM cAMP as indicated. Total Ras protein levels were first normalized by western blot using anti-Pan-Ras antibody. Active Ras proteins were determined by GST-RBD assay (Sasaki et al., 2004Go). (D) A higher basal level of active Ras in sodC cells was significantly decreased upon depletion of superoxide by incubation with radical scavenger XTT (4 mM) for 10 minutes at room temperature. As in C, wild-type cells showed a lower level of active Ras. (E) sodC cells displayed higher basal level of active GFP-RasG than did wild-type cells. (F) GFP-RasG was modestly activated by conditioned medium (CM) and was susceptible to XTT in wild-type cells. In sodC cells, GFP-RasG showed higher basal activity and was susceptible to XTT, but no further stimulation of GFP-RasG was observed with CM.

 
To further determine whether the loss of SodC directly affect Ras activity or indirectly through regulating superoxide level, cells were stimulated with conditioned medium with or without a superoxide scavenger XTT. A previous study has shown that conditioned medium prepared by cAMP pulsing stimulates cellular superoxide generation (Bloomfield and Pears, 2003Go). sodC cells displayed a higher basal level of active Ras (as expected), but showed a significant decrease in active Ras levels upon depletion of superoxide by incubation with radical scavenger XTT (4 mM) for 10 minutes at room temperature (Fig. 10D). A much lower level of active endogenous Ras was observed from wild-type cells, which was also susceptible to XTT treatment (Fig. 10D).

Next, the identity of aberrantly activated Ras species in sodC cells was determined. A previous study identified that RasG is one of the major Ras proteins that regulates chemotaxis and is capable of binding to the human Raf1-RBD when activated (Sasaki et al., 2004Go). Consistent with this, basal activity of GFP-RasG was identified to be higher in sodC cells than in wild-type cells (Fig. 10E). In addition, stimulation of wild-type cells with the CM showed a modest increase in the level of active GFP-RasG, which was susceptible to XTT treatment (Fig. 10F). By contrast, sodC cells displayed higher basal level of active GFP-RasG, which was not responsive to the stimulation with the CM but was susceptible to XTT treatment (Fig. 10F).


    Discussion
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
The majority of superoxide radicals are generated either during the oxidative respiration in the mitochondria, or as products of the NADPH oxidase complex at the plasma membrane (Hancock et al., 2001Go; Droge, 2002Go). Currently, the mechanism of superoxide generation in Dictyostelium is not clear, but a previous report has shown that Dictyostelium cells produce superoxide radicals in a cAMP-independent mechanism (Bloomfield and Pears, 2004). We found that sodC cells maintained extracellular superoxide, similar to wild-type cells, but the total intracellular superoxide level was increased by up to ~18% compared with wild-type cells. Considering that this modest increase was the average value within the cell, the local level at the near vicinity of the plasma membrane could be considerably to be higher than locations deeper inside, where a number of intracellular SOD proteins exist. Thus, SodC, being localized on the outer leaflet of the plasma membrane, may regulate the level of extracellular superoxide radicals and/or the flux of the radical into the cell. A previous study has shown that superoxide radicals could rapidly become neutralized by protonation and permeable to the plasma membrane (Korshunov and Imlay, 2002Go).

Furthermore, the finding that chemotactic defects of sodC cells were alleviated by expression of wild-type SodC but not with the catalytically inactive mutant SodC strongly suggests that the dismutation of the radical by SodC is indeed important in the regulation of Dictyostelium chemotaxis.

The previous study of pten cell chemotaxis showed that alleviation of excessive PtdIns(3,4,5)P3 by LY294002 treatment could significantly improve chemoattractant sensing (Chen et al., 2003). Consistent with the previous study, LY294002-treated sodC cells displayed near wild-type-like efficiency in chemoattractant sensing. Under the same experimental conditions, wild-type cells displayed no significant change in gradient sensing and only a minor decrease in motility, which were comparable with previous reports (Loovers et al., 2006Go; Takeda et al., 2007Go). Contrary to the chemotaxis index, the speed of locomotion was only partially restored from LY294002-treated sodC cells. Considering that 15 µM of LY294002 treatment did not completely deplete PtdIns(3,4,5)P3 (Fig. 8A), an excessive PtdIns(3,4,5)P3 depletion is unlikely to be the reason for the incomplete restoration of chemotaxis of sodC cells by LY294002 treatment. The presence of high level of active Ras proteins in sodC cells would have prevented more complete rescue after LY294002 treatment.

Previous studies have uncovered that Ras proteins, probably RasG, activate PI3K, which in turn controls a PtdIns(3,4,5)P3-dependent cascade that involves extracellular cAMP production through adenylyl cyclase activation (Sasaki et al., 2004Go). RasG is also known to control cytoskeletal remodeling independently of cAMP production (Zhang et al., 1999Go). A later study also suggests that Ras proteins, most likely RasG, control actin cytoskeletal remodeling through the TORC2 complex, in addition to the PtdIns(3,4,5)P3 pathway (Lee et al., 2005Go). In addition, cells with a constitutively high level of active RasG(G12T) displayed numerous fine filopodial extensions, membrane ruffles and decreased cell motility (Khosla et al., 1996Go; Zhang et al., 1999Go), which are also prominent in sodC cells. Furthermore, both Ras and F-Actin levels are constitutively higher, and no further activation was observed in response to cAMP stimulation in sodC cells. Under chronic activation of Ras proteins, sodC cells seem to lose their ability to regulate PI3K (Fig. 9C) and F-Actin synthesis correctly (Fig. 9E) in response to cAMP.

A previous study has indicated that the majority of the Ras-GTP bound to the human Raf1-RBD in aggregation-competent cells was RasG (Sasaki et al., 2004Go). Consistent with this, we discovered that GFP-RasG was aberrantly activated in sodC cells when assayed with the human Raf1-RBD (Fig. 10E). Furthermore, incubation of sodC cells with superoxide scavenger XTT lowered the level of active endogenous Ras proteins and of GFP-RasG (Fig. 10D,F). Wild-type cells also displayed increases in endogenous Ras and GFP-RasG levels in a superoxide scavenger XTT-sensitive manner (Fig. 10D,F). We therefore propose that SodC indirectly suppresses the level of active Ras proteins by lowering superoxide level. Considering that RasG functions upstream of not only PI3K but also of other pathways, such as TORC2, an indirect regulation of RasG by SodC-mediated regulation of superoxide thus seems to be essential for proper chemoattractant sensing, cell polarization and motility.


    Materials and Methods
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Generation of restriction enzyme mediated insertion (REMI) mutants and sodC cells
Remi clones were generated following the terminator trapping REMI protocol (Takeda et al., 2003Go) from Ax3 cells expressing the GFP-PHcrac protein. Individual Remi clones were identified using the 3' Race Core Kit (TAKARA): the cDNAs were generated from RNA by RT-PCR with the oligo dT-3 sites adaptor primer from the 3' Race kit, and then amplified by PCR using a Blasticidin-specific primer (5'-CGAGTGGTAAGTCCTTGT GG-3') and the oligo dT-3 adaptor primer. The Blasticidin cassette was identified at the 1004th nucleotide of the SodC open reading frame in remi56. Three other independent Remi clones also contained the Blasticidin cassette at the identical position of SodC. sodC cells were generated by homologous recombination from a wild-type cell (JH10), and confirmed by genomic PCR using a primer set (5'-GGTGGTGTTGAAGGTATT-3' and 5'-TTCAACATTACCACCATTTGC-3'). The absence of SodC transcript was confirmed by RT-PCR using the following primer set: 5'-ATGAGACTTTTATCTGTATTAG-3' and 5'-TTAAAGCAAAGCAAAGATAATTG-3'.

Generation of the full-length SodC, GFP-SodC and myc-SodC constructs
The full-length SodC was cloned by RT-PCR using the primer set 5'-ATGAGACTTTTATCTGTATTAG-3' and 5'-TTAAAGCAAAGCAAAGATAATTG-3', and confirmed by sequencing. GFP-SOD was constructed by excising the SOD domain from full-length SodC in the TOPO-TA vector by HinCII digestion and subcloned into the PGEX-4T-2 vector (Pharmacia). The SOD domain was then excised using EcoRI and AccI, and subcloned in-frame into the Dictyostelium GFP expression vector pDEXH-GFP (Faix et al., 1992Go). The construct was confirmed by sequencing, and expression was verified by western blotting with anti-GFP antibody (1:1000, Covance).

Myc-SodC expression plasmid was constructed as follows. The full-length SodC cDNA in TOPO vector was amplified with M13 primer and a primer encoding SodC Signal Peptide (SP)/Myc sequence and NdeI site (CCATATGTTAAATCTTCTTCTGAAATTAATTTTTGTTCAAAAGCATATTGGTAATCGGCTTTTGCAATGGAAATAC3'), subcloned into a TOPO vector (pTOTP-SP-Myc-NdeI), and confirmed by sequencing. Both pTOPO-SodC and pTOPO-SP-Myc-NdeI were digested with XhoI (TOPO vector) and NdeI (at 211th bp of SodC) and gel purified. The SP-Myc-Nde1 (153bp) insert was ligated to the digested vector to create Topo-SP-Myc-SodC, in which a Myc epitope replaced 124 bp (76~210 nucleotides) of SodC. After sequence confirmation, the SP-Myc-SodC was released with EcoRI digestion and ligated to EcoRI-digested pExp4 vector to create SP-Myc-SodC.

A SodC mutant with a disrupted copper-binding site (SodC(H245R, H247Q)) (Wang et al., 2002Go) was generated with a mutant primer (ccggtttatcttatcaagctcatggtttc AGAgttcAACaatttggtgatgtttcatcgg, where capital letters denotes mutations) and the Quickchange site-directed mutagenesis kit (Stratagene).

SOD activity assay
SOD activity was measured using the SOD assay kit (Dojindo) according to the manufacturer's instructions. WST-1 solution (200 µl) was mixed with the xanthine oxidase-containing enzyme mix (20 µl) and the SOD-containing samples (20 µl) and were incubated at 25°C for 15 minutes. The relative superoxide levels were determined by measuring the OD450 of the reaction mix after 20 minutes at 25°C. WST-1 formazan has a molar absorption of 3.7x10 at 450 nm. Mean values from three independent experiments are shown with error bars representing standard deviations.

For testing GPI cleavage of SodC, cells were treated with phosphatidylinositol-specific phospholipase C (PI-PLC, Molecular Probes) prior to the SOD assay. For these, 1x10 log phase cells were washed and resuspended with 200 µl of 1xPBS. PI-PLC (1.0 U, 10 µl) was added to each sample, and the reaction mixtures were incubated at 25°C for 5 minutes. The cell-free media were saved and their SOD activities were measured as described above. Mean values from three independent experiments are shown with error bars representing standard deviations.

Superoxide quantification: XTT and NBT assays
Extracellular superoxide levels were measured by using XTT as described previously (Bloomfield and Pears, 2003Go). Ten cells were pulsed with 50 nM cAMP for 4 hours at 20x10 cells/ml. Equivalent amount of cells (~1.5x10) were harvested and resuspended with 0.15 ml of DB containing 0.5 mM XTT for 10 minutes at 22°C. Amount of reduced XTT was measured spectrophotometrically at 470 nm.

Levels of intracellular superoxide were measured by using NBT (Nitro blue tetrazolium salt) as previously described (Choi et al., 2006Go). Cells (2.5 ml) at a density of 2x10 cells/ml were pulsed with 50 nM cAMP for 4 hours, and resuspended with 1 ml of DB containing 0.2 mM NBT for 30 minutes at 22°C. Cells were then washed twice with DB, once with methanol and air-dried. Dried pellets were solubilized with 0.24 ml of 2 M KOH and 0.28 ml of DMSO (dimethyl sulfoxide). The intracellular NBT extracted from cells were measured spectrophotometrically at 620 nm.

Submerged aggregation and cAMP chemotaxis assays
For submerged aggregation experiments, log phase cells were harvested, washed and placed under DB at the cell densities of 2.5x10 cells/cm. After 10 hours at 22°C, cell migration, streaming and aggregation were observed.

For chemotaxis assays, log phase cells were differentiated with 50 nM pulses of cAMP for 4 hours. Aggregation-competent cells were plated at a density of 6x10 cells/cm. A micromanipulator with a glass capillary needle (Eppendorf Femtotip) was filled with either 100 nM or 10 µM cAMP solution. The responses of the cells were followed by time-lapse video recording using a CoolSNAP digital camera. The roundness of a chemotaxing cell, which represents polarity of cells, is defined as the ratio of ellipsoidal short radius divided by its long radius was calculated as described elsewhere (Loovers et al., 2006Go). The chemotactic index, which is defined as the distance moved in the direction of the pipette divided by the total distance moved, was computed from the centroid positions (Loovers et al., 2006Go).

Fractionation of the membrane and cytoplasm
Fractionations of cells expressing GFP-PHCRAC proteins have been described elsewhere (Parent et al., 1998Go). Ten vegetative cells were washed and resuspended with 150 µl of membrane lysis buffer [20 mM TrisCl (pH 7.7), 2 mM MgSO4] and filter-lysed into 1 ml of cold PM buffer (5 mM KH2PO4, 5 mM Na2HPO4, 2 mM MgSO4) by filtration through a Nucleopore filter (0.2 µm). Cell lysates were immediately centrifuged at 12,000 g for 1 minute at 4°C to separate the membrane-containing pellets from the cytosolic supernatant fractions. The supernatant was mixed with 4xSDS loading dye and the pellets were solubilized with 50 µl of 1xSDS loading dye. The membranous fractions (10 µl) and 20 µl of the cytosolic fractions were separated on a 4-20% gradient SDS-PAGE. GFP-PHCRAC localization was analyzed by western blotting using an anti-GFP antibody (1:1000, Covance).

The PI3K-containing membranous fractions were prepared according to the published procedures (Han et al., 2006Go; Sasaki et al., 2004Go). Cells (2.5x10) were resuspended with 200 µl of 1xPBS and mixed with an equal volume of 0.02% of Triton X-100 solution and incubated on ice for 5 minutes. All solutions contained protease inhibitors (Roche, Complete Mini). Mixtures were then centrifuged at 12,000 g for 5 minutes at 4°C. The cytosolic supernatant fractions were separated from the membranous pellet fractions. The supernatants were mixed with 4xSDS loading dye and the pellets were solubilized with 100 µl of 1x SDS loading dye. Membranous fractions (1 µl) and 40 µl of the cytosolic fractions were analyzed by western blot using anti-GFP antibodies described above.

GFP-fusion proteins and immunofluorescence microscopy
The N-PI3K1-GFP and GFP-RBD constructs have been described previously (Sasaki et al., 2004Go). All fluorescent images were obtained using a 100x oil-immersion lens on a Leica DM IRB inverted epifluorescence microscope. For indirect fluorescence microscopy, cells were permeabilized with 0.01% Triton X-100 in 1xPBS for 10 minutes, and fixed with 3.7% formaldehyde for an additional 20 minutes at 22°C. Fixed cells were washed twice with 1xPBS, then incubated with an anti-Myc antibody (1:100 dilution, Santa Cruz Biotech) for an additional 2 hours at 22°C, and washed three times with 1xPBST (1xPBS, 0.3% Triton X-100) for 30 minutes at 22°C. Rhodamine-conjugated anti-Rabbit goat IgG (1:200 dilution, Molecular Probes) was used as a secondary antibody.

Antibodies
Anti-GFP antibodies were from Covance for western blot analysis (1:1000 dilution) and from eBioscience for immunoprecipitation (5 µl per each IP). Anti-Myc and anti-Pan-Ras antibodies were from Calbiochem (Ab-3).

Ras-binding assay
Ras assays were as described by Sasaki et al. (Sasaki et al., 2004Go). Cells were pulsed with cAMP for 4 hours and then lysed with cell lysis buffer [20 mM TrisCl (pH 7.7), 150 mM NaCl, 1% Triton X-100, 5% glycerol, 1 mM EDTA, 0.1% β-mercaptoethanol and 1x Roche Protease Inhibitor mix]. The whole cell lysates were then mixed with 5 µg of purified GST-RBD (Ras Binding Domain) on Glutathione-sepharose beads for 2 hours at 4°C, and the GST-RBD/active Ras complexes were washed three times with cell lysis buffer. The active Ras proteins bound with GST-RBD were visualized by western blotting with anti-Pan-Ras antibody (Calbiochem, Ab-3). Wild-type and sodC cells expressing GFP-RBD proteins were pulsed with 50 nM cAMP in DB for 4 hours and monitored under epifluorescent microscope.

Ras activation with conditioned medium (CM)
A previous study has shown cellular superoxide production in response to stimulation with conditioned medium prepared after cAMP pulsing (Bloomfield and Pears, 2003Go). One hundred million cells in 5 ml DB were pulsed with 50 nM cAMP pulses for 4 hours, and the supernatant fraction was saved as the conditioned medium (CM) after separation of cells by centrifugation. Ras activation in response to superoxide generation was determined using the GST-RBD assay as described earlier. Superoxide radicals were depleted by incubation with the scavenger XTT (4 mM). Ras activation was measured by GST-RBD assay described earlier.

F-Actin assay
Cells were cAMP pulsed at 2x10 cells/ml for 4 hours, briefly centrifuged and resuspended with PM buffer (5 mM KH2PO4/K2HPO4, 2 mM MgCl2) at 3x10 cells/ml. Cells were stimulated with 10 µM cAMP for times as indicated at the figure legends. At each time point, 100 µl of cells were taken and mixed with 1 ml of actin buffer [3.7% formaldehyde, 10 mM PIPES, 0.1% Triton X-100, 20 mM K2HPO4/KH2PO4, 5 mM EGTA, 2 mM MgCl2, 250 nM TRITC-phalloidin (pH 6.8)]. Cells were fixed and stained for 1 hour at 21°C on an orbital shaker. Cytoskeletal fractions were pelleted by centrifugation and washed with 1 ml of methanol and shaken overnight. Methanol-extracted TRITC-phalloidin was quantified by fluorimetry (540 nm excitation, 575 nm emission).

F-Actin staining with TRITC-phalloidin
Both wild-type and sodC cells were pulsed at 2x10 cells/ml in DB for 4 hours. Cells were plated on eight-well chambers at a density of 100x10 per cm and incubated for 5 minutes at 22°C. Then cells were washed twice gently with 1xPBS. Fixation was carried out by adding 3.7% formaldehyde in 1xPBS for 10 minutes at 22°C. Subsequently, cells were permeablized with 0.01% Triton X in PBS for 5 minutes at 22°C. The cells were washed three times with 1xPBS before the addition of 1xPBS containing 0.5 µM TRITC-phalloidin and 0.5 % BSA. After 30 minutes of incubation at 22°C, cells were washed three times with PBS and examined under a fluorescent microscope.


    Acknowledgments
 
We thank Peter Devreotes, Richard Firtel, Carole Parent and the Dictyostelium stock center for providing various GFP-constructs. We thank Tong Sun and Osmin Anis for technical assistance. S.V. is a FIU presidential fellow.


    References
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 

Andrew, N. and Insall, R. H. (2007). Chemotaxis in shallow gradients is mediated independently of PI3K by biased choices between random protrusion. Nat. Cell Biol. 9, 193-200.[CrossRef][Medline]

Bloomfield, G. and Pears, C. (2003). Superoxide signalling required for multicellular development of Dictyostelium. J. Cell Sci. 116, 3387-3397.[Abstract/Free Full Text]

Chen, L., Iijima, M., Tang, M., Landree, M. A., Huang, Y. E., Xiong, Y., Iglesias, P. A. and Devreotes, P. N. (2007). PLA2 and PI3K/PTEN pathways act in parallel to mediate chemotaxis. Dev. Cell 12, 603-614.[CrossRef][Medline]

Choi, H. S., Cha, Y. N. and Kim, C. K. (2006). Taurine chloramines inhibits PMA-stimulated superoxide production in human neutrophils perhaps by inhibiting phosphorylation and translocation of p47. Int. Immunopharmacol. 6, 1431-1440.[CrossRef][Medline]

Cox, A. D. and Der C. J. (2003). The dark side of Ras: regulation of apoptosis. Oncogene 22, 8999-9006.[CrossRef][Medline]

Droge W. (2002). Free radicals in the physiological control of cell function. Physiol. Rev. 82, 47-95.[Abstract/Free Full Text]

Faix, J., Gerisch, G. and Noegel, A. (1992). Overexpression of the csA cell adhesion molecule under its own cAMP-regulated promoter impairs morphogenesis in Dictyostelium. J. Cell Sci. 102, 203-214.[Abstract/Free Full Text]

Funamoto, S., Meili, R., Lee, S., Parry, L. and Firtel, R. A. (2002). Spatial and temporal regulation of 3-phosphoinositides by PI 3-kinase and PTEN mediates chemotaxis. Cell 109, 611-623.[CrossRef][Medline]

Han, J. W., Leeper, L., Rivero, F. and Chung, C. Y. (2006). Role of RacC for the regulation of WASP and phosphatidylinositol 3-kinase during chemotaxis of Dictyostelium. J. Biol. Chem. 281, 35224-35234.[Abstract/Free Full Text]

Hancock, J. T, Desikan, R. and Neill, S. J. (2001). Role of reactive oxygen species in cell signalling pathways. Biochem. Soc. Trans. 29, 345-350.[CrossRef][Medline]

Heo, J. and Campbell, S. L. (2005). Superoxide anion radical modulates the activity of Ras and Ras-related GTPase by a radical-based mechanism similar to that of nitric oxide. J. Biol. Chem. 280, 12438-12445.[Abstract/Free Full Text]

Hoeller, O. and Kay, R. (2007). Chemotaxis in the absence of PIP3 gradients. Curr. Biol. 17, 813-817.[CrossRef][Medline]

Huang, Y. E., Iijima, M., Parent, C. A., Funamoto, S., Firtel, R. A. and Devreotes, P. (2003). Receptor-mediated regulation of PI3Ks confines PI(3,4,5)P3 to the leading edge of chemotaxing cells. Mol. Biol. Cell 14, 1913-1922.[Abstract/Free Full Text]

Iijima, M. and Devreotes, P. (2002). Tumor suppressor PTEN mediates sensing of chemoattractant gradients. Cell 109, 599-610.[CrossRef][Medline]

Iranfar, N., Fuller, D. and Loomis, W. F. (2003). Genome-wide expression analyses of gene regulation during early development of Dictyostelium discoideum. Eukaryotic Cell 2, 664-670.[Abstract/Free Full Text]

Khosla, M., Spiegelman, G. B. and Weeks, G. (1996). Overexpression of an activated rasG gene during growth blocks the initiation of Dictyostelium development. Mol. Cell. Biol. 16, 4156-4162.[Abstract/Free Full Text]

Kondoh, G., Tojo, H., Nakatani, Y., Komazawa, N., Murata, C., Yamagata, K., Maeda, Y., Kinoshita, T., Okabe, M., Taguchi, R. et al. (2005). Angiotensin-converting enzyme is a GPI-anchored protein releasing factor crucial for fertilization. Nat. Med. 11, 160-166.[CrossRef][Medline]

Korshunov, S. S. and Imlay, J. A. (2002). A potential role for periplasmic superoxide dismutase in blocking the penetration of external superoxide into the cytosol of Gram-negative bacteria. Mol. Microbiol. 43, 95-106.[CrossRef][Medline]

Lee, S., Comer, F. I., Sasaki, A., McLeod, I. X., Duong, Y., Okumura, K., Yates, Jr, 3rd, Parent, C. A. and Firtel, R. A. (2005). TOR complex 2 integrates cell movement during chemotaxis and signal relay in Dictyostelium. Mol. Biol. Cell 16, 4572-4583.[Abstract/Free Full Text]

Loovers, H. M., Postma, M., Keizer-Gunnink, I., Huang, Y. E., Devreotes, P. N. and van Haastert, P. J. (2006). Distinct roles of PI(3,4,5)P3 during chemoattractant signaling in Dictyostelium: a quantitative in vivo analysis by inhibition of PI3-kinase. Mol. Biol. Cell 17, 1503-1513.[Abstract/Free Full Text]

Parent, C. A., Blacklock, B. J., Froehlich, W. M., Murphy, D. B. and Devreotes, P. N. (1998). G protein signaling events are activated at the leading edge of chemotactic cells. Cell 95, 81-91.[CrossRef][Medline]

Sasaki, A. T., Chung, C., Takeda, K. and Firtel, R. A. (2004). Localized Ras signaling at the leading edge regulates PI3K, cell polarity, and directional cell movement. J. Cell Biol. 167, 505-518.[Abstract/Free Full Text]

Sasaki, A. T., Janetopoulos, C., Lee, S., Charest, P. G., Takeda, K., Sundheimer, L. W., Meili, R., Devreotes, P. N., Firtel, R. A. (2007). G protein-independent Ras/PI3K/F-actin circuit regulates basic cell motility. J. Cell Biol. 178, 185-191.[Abstract/Free Full Text]

Takeda, K., Saito, T., Tanaka, T., Morio, T., Maeda, M., Tanaka, Y. and Ochiai, H. (2003). A novel gene trap method using terminator-REMI and 3' rapid amplification of cDNA ends (RACE) in Dictyostelium. Gene 312, 321-333.[CrossRef][Medline]

Takeda, K., Sasaki, A. T., Ha, H., Seung, H. A. and Firtel, R. A. (2007). Role of phosphatidylinositol 3-kinases in chemotaxis in Dictyostelium. J. Biol. Chem. 282, 11874-11884.[Abstract/Free Full Text]

Tsuji, A., Akaza, Y., Nakamura, S., Kodaira, K. and Yasukawa, H. (2003). Multinucleation of the sodC-deficient Dictyostelium discoideum. Biol. Pharm. Bull. 26, 1174-1177.[CrossRef][Medline]

Turner, B. J., Atkin, J. D., Farg, M. A., Zang, D. W., Rembach, A., Lopes, E. C., Patch, J. D., Hill, A. F. and Cheema, S. S. (2005). Impaired extracellular secretion of mutant superoxide dismutase 1 associates with neurotoxicity in familial amyotrophic lateral sclerosis. J. Neurosci. 25, 108-117.[Abstract/Free Full Text]

Van Driessche, N., Shaw, C., Katoh, M., Morio, T., Sucgang, R., Ibarra, M., Kuwayama, H., Saito, T., Urushihara, H., Maeda, M. et al. (2002). A transcriptional profile of multicellular development in Dictyostelium discoideum. Development 129, 1543-1552.[Abstract/Free Full Text]

van Haastert, P. J., Keizer-Gunnink, I. and Kortholt, A. (2007). Essential role of PI3-kinase and phospholipase A2 in Dictyostelium discoideum chemotaxis. J. Cell Biol. 177, 809-816.[Abstract/Free Full Text]

Wang, J., Xu, G., Gonzales, V., Coonfield, M., Fromholt, D., Copeland, N. G., Jenkins, N. A. and Borchelt, D. R. (2002). Fibrillar inclusions and motor neuron degeneration in transgenic mice expressing superoxide dismutase 1 with a disrupted copper-binding site. Neurobiol. Dis. 10, 128-138.[CrossRef][Medline]

Zhang, T., Rebstein, P. J., Khosla, M., Cardelli, J., Buczynski, G., Bush, J., Spiegelman, G. B. and Weeks, G. (1999). A mutation that separates the RasG signals that regulate development and cytoskeletal function in Dictyostelium. Exp. Cell Res. 247, 356-366.[CrossRef][Medline]

Zhou, K., Takegawa, K., Emr, S. D. and Firtel, R. A. (1995). A phosphatidylinositol (PI) kinase gene family in Dictyostelium discoideum: biological roles of putative mammalian p110 and yeast Vps34p PI 3-kinase homologs during growth and development. Mol. Cell. Biol. 15, 5645-5656.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?



This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Veeranki, S.
Right arrow Articles by Kim, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Veeranki, S.
Right arrow Articles by Kim, L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?