|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online September 3, 2008
doi: 10.1242/10.1242/jcs.030056
Research Article |
Department of Biological Sciences, Florida International University, Miami, FL 33199, USA
* Author for correspondence (e-mail: kiml{at}fiu.edu)
Accepted 1 July 2008
| Summary |
|---|
|
|
|---|
Key words: SOD, Ras, PI3K, PtdIns(3,4,5)P3, Chemotaxis, Motility
| Introduction |
|---|
|
|
|---|
Phosphatidylinositol (3,4,5)-trisphosphate [PtdIns(3,4,5)P3] is still an important part of the chemotaxis machinery in some situations, but it is not the molecular compass for gradient sensing, as was suggested initially (Loovers et al., 2006
; Hoeller and Kay, 2007
; Takeda et al., 2007
). Generation of PtdIns(3,4,5)P3 depends heavily on the regulation of PI3Ks. In Dictyostelium, two PI3Ks, PI3K1 and PI3K2, are mostly responsible for chemoattractant cAMP-dependent PtdIns(3,4,5)P3 generation (Zhou et al., 1995
; Huang et al., 2003
). Both kinases can localize either at the cytosol or at the plasma membrane in response to chemoattractant signals. The domains for membrane localization and kinase activation have been clearly defined by serial deletion analysis. The membrane-targeting domain precedes the central Ras-binding domain, which mediates activation of the kinase through Ras (Funamoto et al., 2002
). Previous studies also established that activation of PI3K through small GTPase Ras facilitates PI3K membrane localization of PI3K, and thus forms a positive-feedback loop in both a chemoattractant signal-dependent and -independent manner (Sasaki et al., 2004
; Sasaki et al., 2007
). The latter also explains how the Ras-PI3K loop is involved in the modulation of basic cell motility (Sasaki et al., 2007
).
To identify additional regulators of PtdIns(3,4,5)P3, we performed restriction enzyme mediated insertion (REMI) mutagenesis on cells expressing GFP-PHcrac protein [a pleckstrin homology (PH) domain from the cytosolic regulator of adenylyl cyclase (CRAC) protein fused to the green fluorescent protein (GFP)]. Mutants that exhibit higher levels of GFP-PHcrac at the plasma membrane in the absence of chemoattractant stimulation were isolated by monitoring enhanced plasma membrane localization of GFP-PHcrac proteins. Four of the REMI mutants exhibited insertions at the same locus, which encodes a GPI-anchored superoxide dismutase (SOD) protein, SodC. A previous study using chemical superoxide scavengers suggested that proper control of superoxide radicals plays an important role in Dictyostelium cell aggregation (Bloomfield and Pears, 2003
). The mechanism that underlies radical generation and dismutation, and the cellular targets that are involved in Dictyostelium aggregation have yet to be identified. In this report, we will present the characterization of SodC and the phenotypes of sodC– cells, and will discuss potential roles of SodC in chemotaxis through the regulation of Ras activity and of PI3K.
| Results |
|---|
|
|
|---|
1000 independently isolated insertional mutants, six independent remi clones exhibited elevated level of GFP-PHcrac at the plasma membrane in the absence of chemoattractant stimulation (Fig. 1A). By contrast, GFP-PHcrac proteins were localized uniformly through the cytoplasm and occasionally enriched at the local membrane ruffles and macropinosomes in wild-type cells. It is expected that the mutants displaying higher PtdIns(3,4,5)P3 levels would be severely defective in chemotaxis. One such example is pten cells, which show severe defect in chemotaxis (Funamoto et al., 2002
|
|
|
To confirm that SodC is actually a GPI-anchored membrane protein, a Myc-tag was inserted after the signal peptide of the full-length SodC. Myc-SodC proteins were immunopurified and detected by anti-Myc antibody (Fig. 4A, bottom left). Membrane localization of Myc-SodC was evident from both western blotting of subcellular fractions (Fig. 4A, bottom right) and indirect immunofluorescence microscopy (Fig. 4B). To further test whether there is a GPI anchored SOD activity, wild-type cells were treated with GPI specific phosphatidylinositol-phospholipase C (PI-PLC) (Kondoh et al., 2005
). The media from PI-PLC treated wild-type cells displayed three times higher SOD activity than that of the control (Fig. 4C). By contrast, the media from sodC– cells displayed no measurable amounts of SOD activity under the same experimental conditions.
|
Next, the intracellular superoxide levels were measured using another superoxide sensitive reagent: NBT. Contrary to XTT, NBT becomes an insoluble precipitate upon reduction by superoxide (Choi et al., 2006
). The amount of insoluble NBT trapped inside the sodC– cells was consistently higher (by
18%) than that in the wild type (Fig. 4E). These data suggest that SodC is a GPI-anchored superoxide dismutase that is involved in the regulation of intracellular level of superoxide in Dictyostelium cells.
sodC– cells are defective in chemotaxis but not in development
Like remi56 cells, sodC – cells were severely defective in aggregation (Fig. 5A). However, when plated at high cell densities where chemotaxis is less essential, sodC – cells developed indistinguishably from wild-type cells (Fig. 5B). These data strongly suggest that SodC is essential for chemotaxis but not for development.
|
sodC – cells, after being pulsed for 4 hours, displayed a significantly compromised chemoattractant sensing during the first 20 minutes under both weak and strong cAMP gradients (Fig. 6B,C). However, during the second 20 minutes under both weak and strong cAMP gradients, sodC– cells showed an improvement in cAMP sensing, but only up to
40 % of the wild-type level. In addition, sodC– cells showed severe motility defects, which were worse under weak cAMP gradient (Table 1). Contrary to the chemotaxis index, the speed of motility did not improve during the whole duration of the assay.
|
|
sodC– cells displayed less polarization during the first 20 minutes under both a weak and strong gradient than did wild-type cells. An improvement in the polarity from 0.6 to 0.3 was observed from sodC– cells under a strong gradient during the last 20 minutes, whereas no such improvement was made from sodC– cells under a weak gradient (Fig. 6D). sodC– cells displayed multiple problems in chemotaxis that cannot easily be overcome by a higher concentration of or a longer exposure to chemoattractant cAMP.
Re-introduction of wild-type SodC, not the inactive mutant SodC, partially attenuated the chemotaxis defects of sodC– cells
A previous study showed that substitution of two histidine residues in the Cu2+-binding motif of the SOD domain with arginine and glutamate led to an effective loss of SOD activity (Wang et al., 2002
). Similarly, the catalytically inactive SodC (H245R,H247Q) was generated and expressed in sodC– cells. Levels of SodC transcripts were compared in wild type, in sodC– cells and in sodC– cells expressing wild-type SodC or SodC(H245R,H247Q) by RT-PCR (as shown in Fig. 7A). A clear SodC message was detected from wild-type cells, but not from sodC – cells. SodC cells expressing wild-type SodC or SodC(H245R,H247Q) displayed a comparable level of SodC message, which is higher than that of the endogenous SodC messages.
|
90% of the wild-type level, and their speed improved to
40% of the wild-type level. By contrast, the chemotaxis index of sodC– cells expressing SodC(H245R, H247Q) was similar to that of the parental sodC– cells (Fig. 7). Although the complementation was less than complete, there was a clear improvement in chemotaxis and cell polarization by wild-type SodC expression but not by the mutant SodC in sodC– cells (Table 2; Fig. 7C).
|
sodC– cells pretreated with PI3K inhibitor LY294002 exhibited improved chemotaxis
To determine whether sodC– cells are defective in chemotaxis mainly because of the presence of an excessive PtdIns(3,4,5)P3, cells expressing PtdIns(3,4,5)P3 marker GFP-PHcrac were pulsed for 4 hours with 50 nM cAMP, and either left in DB buffer or treated with 15 µM or 50 µM of PI3K inhibitor LY294002 (LY) for 20 minutes. sodC– cells expressing GFP-PHcrac showed aberrant plasma membrane localization, which decreased significantly at the plasma membrane after treatment with 15 µM or 50 µM LY294002 (Fig. 8A). However, LY294002-treated sodC– cells still displayed PtdIns(3,4,5)P3 enriched macropinosomes and local ruffles, indicating that PtdIns(3,4,5)P3 levels were attenuated but not completely depleted (Fig. 8A).
|
Then, wild-type and sodC– cells were incubated with 15 µM LY294002 for 20 minutes, and challenged with micropipette filled with 10 µM cAMP for 20 minutes. Wild-type cells showed comparable chemotaxis indices and speeds irrespective of 15 µM LY294002 treatment (Fig. 8). Untreated sodC – cells almost completely failed to respond to a micropipette filled with 10 µM cAMP (Fig. 8). By contrast, sodC– cells pretreated with LY294002 displayed a near wild-type level of gradient sensing, significantly improved speed of motility and cell polarization (Table 3; Fig. 8C). By contrast, the restoration of the speed of locomotion by LY treatment was lesser (Table 3).
|
sodC– cells displayed aberrant PI3K regulation
Regulation of PI3K1 and PI3K2, the two major enzymes largely responsible for chemoattractant-induced PtdIns(3,4,5)P3 generation in Dictyostelium, is complex. Through a yet to be identified mechanism, cells control membrane and cytoplasmic localization of PI3K (Funamoto et al., 2003). In addition, activation of Ras proteins leads to an enhanced PI3K activity. Subsequently, more PtdIns(3,4,5)P3 will accumulate, which in turn stimulate membrane localization of PI3K through a F-Actin-dependent mechanism (Sasaki et al., 2004
). In the absence of chemoattractant stimulation, wild-type cells maintain a minor, but detectible, fraction of PI3K at the plasma membrane (Han et al., 2006
; Sasaki et al., 2004
).
sodC– cells displayed N-PI3K1-GFP proteins localized uniformly throughout the plasma membrane, whereas wild-type cells displayed a strong enrichment at the leading front (Fig. 9A). This was further confirmed by western blot analysis on the membranous and cytosolic fractions prepared from cells expressing equivalent amount of N-PI3K1-GFP proteins (Fig. 9B). Localization of the other major regulator of PtdIns(3,4,5)P3, PTEN, was also examined. No significant difference in the localization of GFP-fused PTEN proteins was observed from wild-type and sodC– cells (Fig. 9A). The aberrancy in the localization of N-PI3K1-GFP in sodC– cells was further highlighted when examined upon global stimulation with cAMP. Instead of a transient membrane localization observed in wild type, N-PI3K1-GFP showed membrane localization before the stimulation, which almost failed to change in response to global cAMP stimulation (Fig. 9C). sodC– cells consistently displayed less polarized cell shapes.
|
20% higher basal F-Actin level compared with that of the wild type, but showed no further increase in response to cAMP stimulation (Fig. 9E).
SodC regulates Ras, an upstream regulator of PI3K
Ras is an upstream regulator of PI3K, and subject to regulation by superoxide in vitro (Sasaki et al., 2004
; Cox and Der, 2003
; Heo and Campbell, 2005
). We tested whether Ras is aberrantly regulated in sodC– cells by using GFP-RBD (Ras-Binding Domain) protein, which was previously used as an active Ras marker in Dictyostelium cells (Sasaki et al., 2004
). Active Ras proteins in cells were indirectly visualized by monitoring GFP-RBD proteins after 4 hours of pulsing. As shown in Fig. 10A, wild-type cells almost always showed polarized GFP-RBD localization after 4 hours of cAMP pulsing. Cells with sodC background, by contrast, displayed strikingly disorganized pattern of GFP-RBD protein (Fig. 10A). Furthermore, more active Ras proteins were detected from sodC– cells than wild-type cells by GST-RBD pull-down assay (Fig. 10B) (Sasaki et al., 2004
). In addition, when stimulated globally with 10 µM cAMP, sodC– cells displayed higher basal Ras proteins than wild-type cells with no further increase in the active Ras level. By contrast, wild-type cells displayed the transient Ras activation as expected (Fig. 10C).
|
Next, the identity of aberrantly activated Ras species in sodC– cells was determined. A previous study identified that RasG is one of the major Ras proteins that regulates chemotaxis and is capable of binding to the human Raf1-RBD when activated (Sasaki et al., 2004
). Consistent with this, basal activity of GFP-RasG was identified to be higher in sodC– cells than in wild-type cells (Fig. 10E). In addition, stimulation of wild-type cells with the CM showed a modest increase in the level of active GFP-RasG, which was susceptible to XTT treatment (Fig. 10F). By contrast, sodC– cells displayed higher basal level of active GFP-RasG, which was not responsive to the stimulation with the CM but was susceptible to XTT treatment (Fig. 10F).
| Discussion |
|---|
|
|
|---|
18% compared with wild-type cells. Considering that this modest increase was the average value within the cell, the local level at the near vicinity of the plasma membrane could be considerably to be higher than locations deeper inside, where a number of intracellular SOD proteins exist. Thus, SodC, being localized on the outer leaflet of the plasma membrane, may regulate the level of extracellular superoxide radicals and/or the flux of the radical into the cell. A previous study has shown that superoxide radicals could rapidly become neutralized by protonation and permeable to the plasma membrane (Korshunov and Imlay, 2002
Furthermore, the finding that chemotactic defects of sodC– cells were alleviated by expression of wild-type SodC but not with the catalytically inactive mutant SodC strongly suggests that the dismutation of the radical by SodC is indeed important in the regulation of Dictyostelium chemotaxis.
The previous study of pten cell chemotaxis showed that alleviation of excessive PtdIns(3,4,5)P3 by LY294002 treatment could significantly improve chemoattractant sensing (Chen et al., 2003). Consistent with the previous study, LY294002-treated sodC– cells displayed near wild-type-like efficiency in chemoattractant sensing. Under the same experimental conditions, wild-type cells displayed no significant change in gradient sensing and only a minor decrease in motility, which were comparable with previous reports (Loovers et al., 2006
; Takeda et al., 2007
). Contrary to the chemotaxis index, the speed of locomotion was only partially restored from LY294002-treated sodC– cells. Considering that 15 µM of LY294002 treatment did not completely deplete PtdIns(3,4,5)P3 (Fig. 8A), an excessive PtdIns(3,4,5)P3 depletion is unlikely to be the reason for the incomplete restoration of chemotaxis of sodC– cells by LY294002 treatment. The presence of high level of active Ras proteins in sodC– cells would have prevented more complete rescue after LY294002 treatment.
Previous studies have uncovered that Ras proteins, probably RasG, activate PI3K, which in turn controls a PtdIns(3,4,5)P3-dependent cascade that involves extracellular cAMP production through adenylyl cyclase activation (Sasaki et al., 2004
). RasG is also known to control cytoskeletal remodeling independently of cAMP production (Zhang et al., 1999
). A later study also suggests that Ras proteins, most likely RasG, control actin cytoskeletal remodeling through the TORC2 complex, in addition to the PtdIns(3,4,5)P3 pathway (Lee et al., 2005
). In addition, cells with a constitutively high level of active RasG(G12T) displayed numerous fine filopodial extensions, membrane ruffles and decreased cell motility (Khosla et al., 1996
; Zhang et al., 1999
), which are also prominent in sodC– cells. Furthermore, both Ras and F-Actin levels are constitutively higher, and no further activation was observed in response to cAMP stimulation in sodC– cells. Under chronic activation of Ras proteins, sodC– cells seem to lose their ability to regulate PI3K (Fig. 9C) and F-Actin synthesis correctly (Fig. 9E) in response to cAMP.
A previous study has indicated that the majority of the Ras-GTP bound to the human Raf1-RBD in aggregation-competent cells was RasG (Sasaki et al., 2004
). Consistent with this, we discovered that GFP-RasG was aberrantly activated in sodC– cells when assayed with the human Raf1-RBD (Fig. 10E). Furthermore, incubation of sodC– cells with superoxide scavenger XTT lowered the level of active endogenous Ras proteins and of GFP-RasG (Fig. 10D,F). Wild-type cells also displayed increases in endogenous Ras and GFP-RasG levels in a superoxide scavenger XTT-sensitive manner (Fig. 10D,F). We therefore propose that SodC indirectly suppresses the level of active Ras proteins by lowering superoxide level. Considering that RasG functions upstream of not only PI3K but also of other pathways, such as TORC2, an indirect regulation of RasG by SodC-mediated regulation of superoxide thus seems to be essential for proper chemoattractant sensing, cell polarization and motility.
| Materials and Methods |
|---|
|
|
|---|
Generation of the full-length SodC, GFP-SodC and myc-SodC constructs
The full-length SodC was cloned by RT-PCR using the primer set 5'-ATGAGACTTTTATCTGTATTAG-3' and 5'-TTAAAGCAAAGCAAAGATAATTG-3', and confirmed by sequencing. GFP-SOD was constructed by excising the SOD domain from full-length SodC in the TOPO-TA vector by HinCII digestion and subcloned into the PGEX-4T-2 vector (Pharmacia). The SOD domain was then excised using EcoRI and AccI, and subcloned in-frame into the Dictyostelium GFP expression vector pDEXH-GFP (Faix et al., 1992
). The construct was confirmed by sequencing, and expression was verified by western blotting with anti-GFP antibody (1:1000, Covance).
Myc-SodC expression plasmid was constructed as follows. The full-length SodC cDNA in TOPO vector was amplified with M13 primer and a primer encoding SodC Signal Peptide (SP)/Myc sequence and NdeI site (CCATATGTTAAATCTTCTTCTGAAATTAATTTTTGTTCAAAAGCATATTGGTAATCGGCTTTTGCAATGGAAATAC3'), subcloned into a TOPO vector (pTOTP-SP-Myc-NdeI), and confirmed by sequencing. Both pTOPO-SodC and pTOPO-SP-Myc-NdeI were digested with XhoI (TOPO vector) and NdeI (at 211th bp of SodC) and gel purified. The SP-Myc-Nde1 (153bp) insert was ligated to the digested vector to create Topo-SP-Myc-SodC, in which a Myc epitope replaced 124 bp (76
210 nucleotides) of SodC. After sequence confirmation, the SP-Myc-SodC was released with EcoRI digestion and ligated to EcoRI-digested pExp4 vector to create SP-Myc-SodC.
A SodC mutant with a disrupted copper-binding site (SodC(H245R, H247Q)) (Wang et al., 2002
) was generated with a mutant primer (ccggtttatcttatcaagctcatggtttc AGAgttcAACaatttggtgatgtttcatcgg, where capital letters denotes mutations) and the Quickchange site-directed mutagenesis kit (Stratagene).
SOD activity assay
SOD activity was measured using the SOD assay kit (Dojindo) according to the manufacturer's instructions. WST-1 solution (200 µl) was mixed with the xanthine oxidase-containing enzyme mix (20 µl) and the SOD-containing samples (20 µl) and were incubated at 25°C for 15 minutes. The relative superoxide levels were determined by measuring the OD450 of the reaction mix after 20 minutes at 25°C. WST-1 formazan has a molar absorption of 3.7x10 at 450 nm. Mean values from three independent experiments are shown with error bars representing standard deviations.
For testing GPI cleavage of SodC, cells were treated with phosphatidylinositol-specific phospholipase C (PI-PLC, Molecular Probes) prior to the SOD assay. For these, 1x10 log phase cells were washed and resuspended with 200 µl of 1xPBS. PI-PLC (1.0 U, 10 µl) was added to each sample, and the reaction mixtures were incubated at 25°C for 5 minutes. The cell-free media were saved and their SOD activities were measured as described above. Mean values from three independent experiments are shown with error bars representing standard deviations.
Superoxide quantification: XTT and NBT assays
Extracellular superoxide levels were measured by using XTT as described previously (Bloomfield and Pears, 2003
). Ten cells were pulsed with 50 nM cAMP for 4 hours at 20x10 cells/ml. Equivalent amount of cells (
1.5x10) were harvested and resuspended with 0.15 ml of DB containing 0.5 mM XTT for 10 minutes at 22°C. Amount of reduced XTT was measured spectrophotometrically at 470 nm.
Levels of intracellular superoxide were measured by using NBT (Nitro blue tetrazolium salt) as previously described (Choi et al., 2006
). Cells (2.5 ml) at a density of 2x10 cells/ml were pulsed with 50 nM cAMP for 4 hours, and resuspended with 1 ml of DB containing 0.2 mM NBT for 30 minutes at 22°C. Cells were then washed twice with DB, once with methanol and air-dried. Dried pellets were solubilized with 0.24 ml of 2 M KOH and 0.28 ml of DMSO (dimethyl sulfoxide). The intracellular NBT extracted from cells were measured spectrophotometrically at 620 nm.
Submerged aggregation and cAMP chemotaxis assays
For submerged aggregation experiments, log phase cells were harvested, washed and placed under DB at the cell densities of 2.5x10 cells/cm. After 10 hours at 22°C, cell migration, streaming and aggregation were observed.
For chemotaxis assays, log phase cells were differentiated with 50 nM pulses of cAMP for 4 hours. Aggregation-competent cells were plated at a density of 6x10 cells/cm. A micromanipulator with a glass capillary needle (Eppendorf Femtotip) was filled with either 100 nM or 10 µM cAMP solution. The responses of the cells were followed by time-lapse video recording using a CoolSNAP digital camera. The roundness of a chemotaxing cell, which represents polarity of cells, is defined as the ratio of ellipsoidal short radius divided by its long radius was calculated as described elsewhere (Loovers et al., 2006
). The chemotactic index, which is defined as the distance moved in the direction of the pipette divided by the total distance moved, was computed from the centroid positions (Loovers et al., 2006
).
Fractionation of the membrane and cytoplasm
Fractionations of cells expressing GFP-PHCRAC proteins have been described elsewhere (Parent et al., 1998
). Ten vegetative cells were washed and resuspended with 150 µl of membrane lysis buffer [20 mM TrisCl (pH 7.7), 2 mM MgSO4] and filter-lysed into 1 ml of cold PM buffer (5 mM KH2PO4, 5 mM Na2HPO4, 2 mM MgSO4) by filtration through a Nucleopore filter (0.2 µm). Cell lysates were immediately centrifuged at 12,000 g for 1 minute at 4°C to separate the membrane-containing pellets from the cytosolic supernatant fractions. The supernatant was mixed with 4xSDS loading dye and the pellets were solubilized with 50 µl of 1xSDS loading dye. The membranous fractions (10 µl) and 20 µl of the cytosolic fractions were separated on a 4-20% gradient SDS-PAGE. GFP-PHCRAC localization was analyzed by western blotting using an anti-GFP antibody (1:1000, Covance).
The PI3K-containing membranous fractions were prepared according to the published procedures (Han et al., 2006
; Sasaki et al., 2004
). Cells (2.5x10) were resuspended with 200 µl of 1xPBS and mixed with an equal volume of 0.02% of Triton X-100 solution and incubated on ice for 5 minutes. All solutions contained protease inhibitors (Roche, Complete Mini). Mixtures were then centrifuged at 12,000 g for 5 minutes at 4°C. The cytosolic supernatant fractions were separated from the membranous pellet fractions. The supernatants were mixed with 4xSDS loading dye and the pellets were solubilized with 100 µl of 1x SDS loading dye. Membranous fractions (1 µl) and 40 µl of the cytosolic fractions were analyzed by western blot using anti-GFP antibodies described above.
GFP-fusion proteins and immunofluorescence microscopy
The N-PI3K1-GFP and GFP-RBD constructs have been described previously (Sasaki et al., 2004
). All fluorescent images were obtained using a 100x oil-immersion lens on a Leica DM IRB inverted epifluorescence microscope. For indirect fluorescence microscopy, cells were permeabilized with 0.01% Triton X-100 in 1xPBS for 10 minutes, and fixed with 3.7% formaldehyde for an additional 20 minutes at 22°C. Fixed cells were washed twice with 1xPBS, then incubated with an anti-Myc antibody (1:100 dilution, Santa Cruz Biotech) for an additional 2 hours at 22°C, and washed three times with 1xPBST (1xPBS, 0.3% Triton X-100) for 30 minutes at 22°C. Rhodamine-conjugated anti-Rabbit goat IgG (1:200 dilution, Molecular Probes) was used as a secondary antibody.
Antibodies
Anti-GFP antibodies were from Covance for western blot analysis (1:1000 dilution) and from eBioscience for immunoprecipitation (5 µl per each IP). Anti-Myc and anti-Pan-Ras antibodies were from Calbiochem (Ab-3).
Ras-binding assay
Ras assays were as described by Sasaki et al. (Sasaki et al., 2004
). Cells were pulsed with cAMP for 4 hours and then lysed with cell lysis buffer [20 mM TrisCl (pH 7.7), 150 mM NaCl, 1% Triton X-100, 5% glycerol, 1 mM EDTA, 0.1% β-mercaptoethanol and 1x Roche Protease Inhibitor mix]. The whole cell lysates were then mixed with 5 µg of purified GST-RBD (Ras Binding Domain) on Glutathione-sepharose beads for 2 hours at 4°C, and the GST-RBD/active Ras complexes were washed three times with cell lysis buffer. The active Ras proteins bound with GST-RBD were visualized by western blotting with anti-Pan-Ras antibody (Calbiochem, Ab-3). Wild-type and sodC– cells expressing GFP-RBD proteins were pulsed with 50 nM cAMP in DB for 4 hours and monitored under epifluorescent microscope.
Ras activation with conditioned medium (CM)
A previous study has shown cellular superoxide production in response to stimulation with conditioned medium prepared after cAMP pulsing (Bloomfield and Pears, 2003
). One hundred million cells in 5 ml DB were pulsed with 50 nM cAMP pulses for 4 hours, and the supernatant fraction was saved as the conditioned medium (CM) after separation of cells by centrifugation. Ras activation in response to superoxide generation was determined using the GST-RBD assay as described earlier. Superoxide radicals were depleted by incubation with the scavenger XTT (4 mM). Ras activation was measured by GST-RBD assay described earlier.
F-Actin assay
Cells were cAMP pulsed at 2x10 cells/ml for 4 hours, briefly centrifuged and resuspended with PM buffer (5 mM KH2PO4/K2HPO4, 2 mM MgCl2) at 3x10 cells/ml. Cells were stimulated with 10 µM cAMP for times as indicated at the figure legends. At each time point, 100 µl of cells were taken and mixed with 1 ml of actin buffer [3.7% formaldehyde, 10 mM PIPES, 0.1% Triton X-100, 20 mM K2HPO4/KH2PO4, 5 mM EGTA, 2 mM MgCl2, 250 nM TRITC-phalloidin (pH 6.8)]. Cells were fixed and stained for 1 hour at 21°C on an orbital shaker. Cytoskeletal fractions were pelleted by centrifugation and washed with 1 ml of methanol and shaken overnight. Methanol-extracted TRITC-phalloidin was quantified by fluorimetry (540 nm excitation, 575 nm emission).
F-Actin staining with TRITC-phalloidin
Both wild-type and sodC– cells were pulsed at 2x10 cells/ml in DB for 4 hours. Cells were plated on eight-well chambers at a density of 100x10 per cm and incubated for 5 minutes at 22°C. Then cells were washed twice gently with 1xPBS. Fixation was carried out by adding 3.7% formaldehyde in 1xPBS for 10 minutes at 22°C. Subsequently, cells were permeablized with 0.01% Triton X in PBS for 5 minutes at 22°C. The cells were washed three times with 1xPBS before the addition of 1xPBS containing 0.5 µM TRITC-phalloidin and 0.5 % BSA. After 30 minutes of incubation at 22°C, cells were washed three times with PBS and examined under a fluorescent microscope.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Andrew, N. and Insall, R. H. (2007). Chemotaxis in shallow gradients is mediated independently of PI3K by biased choices between random protrusion. Nat. Cell Biol. 9, 193-200.[CrossRef][Medline]
Bloomfield, G. and Pears, C. (2003). Superoxide signalling required for multicellular development of Dictyostelium. J. Cell Sci. 116, 3387-3397.
Chen, L., Iijima, M., Tang, M., Landree, M. A., Huang, Y. E., Xiong, Y., Iglesias, P. A. and Devreotes, P. N. (2007). PLA2 and PI3K/PTEN pathways act in parallel to mediate chemotaxis. Dev. Cell 12, 603-614.[CrossRef][Medline]
Choi, H. S., Cha, Y. N. and Kim, C. K. (2006). Taurine chloramines inhibits PMA-stimulated superoxide production in human neutrophils perhaps by inhibiting phosphorylation and translocation of p47. Int. Immunopharmacol. 6, 1431-1440.[CrossRef][Medline]
Cox, A. D. and Der C. J. (2003). The dark side of Ras: regulation of apoptosis. Oncogene 22, 8999-9006.[CrossRef][Medline]
Droge W. (2002). Free radicals in the physiological control of cell function. Physiol. Rev. 82, 47-95.
Faix, J., Gerisch, G. and Noegel, A. (1992). Overexpression of the csA cell adhesion molecule under its own cAMP-regulated promoter impairs morphogenesis in Dictyostelium. J. Cell Sci. 102, 203-214.
Funamoto, S., Meili, R., Lee, S., Parry, L. and Firtel, R. A. (2002). Spatial and temporal regulation of 3-phosphoinositides by PI 3-kinase and PTEN mediates chemotaxis. Cell 109, 611-623.[CrossRef][Medline]
Han, J. W., Leeper, L., Rivero, F. and Chung, C. Y. (2006). Role of RacC for the regulation of WASP and phosphatidylinositol 3-kinase during chemotaxis of Dictyostelium. J. Biol. Chem. 281, 35224-35234.
Hancock, J. T, Desikan, R. and Neill, S. J. (2001). Role of reactive oxygen species in cell signalling pathways. Biochem. Soc. Trans. 29, 345-350.[CrossRef][Medline]
Heo, J. and Campbell, S. L. (2005). Superoxide anion radical modulates the activity of Ras and Ras-related GTPase by a radical-based mechanism similar to that of nitric oxide. J. Biol. Chem. 280, 12438-12445.
Hoeller, O. and Kay, R. (2007). Chemotaxis in the absence of PIP3 gradients. Curr. Biol. 17, 813-817.[CrossRef][Medline]
Huang, Y. E., Iijima, M., Parent, C. A., Funamoto, S., Firtel, R. A. and Devreotes, P. (2003). Receptor-mediated regulation of PI3Ks confines PI(3,4,5)P3 to the leading edge of chemotaxing cells. Mol. Biol. Cell 14, 1913-1922.
Iijima, M. and Devreotes, P. (2002). Tumor suppressor PTEN mediates sensing of chemoattractant gradients. Cell 109, 599-610.[CrossRef][Medline]
Iranfar, N., Fuller, D. and Loomis, W. F. (2003). Genome-wide expression analyses of gene regulation during early development of Dictyostelium discoideum. Eukaryotic Cell 2, 664-670.
Khosla, M., Spiegelman, G. B. and Weeks, G. (1996). Overexpression of an activated rasG gene during growth blocks the initiation of Dictyostelium development. Mol. Cell. Biol. 16, 4156-4162.[Abstract]
Kondoh, G., Tojo, H., Nakatani, Y., Komazawa, N., Murata, C., Yamagata, K., Maeda, Y., Kinoshita, T., Okabe, M., Taguchi, R. et al. (2005). Angiotensin-converting enzyme is a GPI-anchored protein releasing factor crucial for fertilization. Nat. Med. 11, 160-166.[CrossRef][Medline]
Korshunov, S. S. and Imlay, J. A. (2002). A potential role for periplasmic superoxide dismutase in blocking the penetration of external superoxide into the cytosol of Gram-negative bacteria. Mol. Microbiol. 43, 95-106.[CrossRef][Medline]
Lee, S., Comer, F. I., Sasaki, A., McLeod, I. X., Duong, Y., Okumura, K., Yates, Jr, 3rd, Parent, C. A. and Firtel, R. A. (2005). TOR complex 2 integrates cell movement during chemotaxis and signal relay in Dictyostelium. Mol. Biol. Cell 16, 4572-4583.
Loovers, H. M., Postma, M., Keizer-Gunnink, I., Huang, Y. E., Devreotes, P. N. and van Haastert, P. J. (2006). Distinct roles of PI(3,4,5)P3 during chemoattractant signaling in Dictyostelium: a quantitative in vivo analysis by inhibition of PI3-kinase. Mol. Biol. Cell 17, 1503-1513.
Parent, C. A., Blacklock, B. J., Froehlich, W. M., Murphy, D. B. and Devreotes, P. N. (1998). G protein signaling events are activated at the leading edge of chemotactic cells. Cell 95, 81-91.[CrossRef][Medline]
Sasaki, A. T., Chung, C., Takeda, K. and Firtel, R. A. (2004). Localized Ras signaling at the leading edge regulates PI3K, cell polarity, and directional cell movement. J. Cell Biol. 167, 505-518.
Sasaki, A. T., Janetopoulos, C., Lee, S., Charest, P. G., Takeda, K., Sundheimer, L. W., Meili, R., Devreotes, P. N., Firtel, R. A. (2007). G protein-independent Ras/PI3K/F-actin circuit regulates basic cell motility. J. Cell Biol. 178, 185-191.
Takeda, K., Saito, T., Tanaka, T., Morio, T., Maeda, M., Tanaka, Y. and Ochiai, H. (2003). A novel gene trap method using terminator-REMI and 3' rapid amplification of cDNA ends (RACE) in Dictyostelium. Gene 312, 321-333.[CrossRef][Medline]
Takeda, K., Sasaki, A. T., Ha, H., Seung, H. A. and Firtel, R. A. (2007). Role of phosphatidylinositol 3-kinases in chemotaxis in Dictyostelium. J. Biol. Chem. 282, 11874-11884.
Tsuji, A., Akaza, Y., Nakamura, S., Kodaira, K. and Yasukawa, H. (2003). Multinucleation of the sodC-deficient Dictyostelium discoideum. Biol. Pharm. Bull. 26, 1174-1177.[CrossRef][Medline]
Turner, B. J., Atkin, J. D., Farg, M. A., Zang, D. W., Rembach, A., Lopes, E. C., Patch, J. D., Hill, A. F. and Cheema, S. S. (2005). Impaired extracellular secretion of mutant superoxide dismutase 1 associates with neurotoxicity in familial amyotrophic lateral sclerosis. J. Neurosci. 25, 108-117.
Van Driessche, N., Shaw, C., Katoh, M., Morio, T., Sucgang, R., Ibarra, M., Kuwayama, H., Saito, T., Urushihara, H., Maeda, M. et al. (2002). A transcriptional profile of multicellular development in Dictyostelium discoideum. Development 129, 1543-1552.
van Haastert, P. J., Keizer-Gunnink, I. and Kortholt, A. (2007). Essential role of PI3-kinase and phospholipase A2 in Dictyostelium discoideum chemotaxis. J. Cell Biol. 177, 809-816.
Wang, J., Xu, G., Gonzales, V., Coonfield, M., Fromholt, D., Copeland, N. G., Jenkins, N. A. and Borchelt, D. R. (2002). Fibrillar inclusions and motor neuron degeneration in transgenic mice expressing superoxide dismutase 1 with a disrupted copper-binding site. Neurobiol. Dis. 10, 128-138.[CrossRef][Medline]
Zhang, T., Rebstein, P. J., Khosla, M., Cardelli, J., Buczynski, G., Bush, J., Spiegelman, G. B. and Weeks, G. (1999). A mutation that separates the RasG signals that regulate development and cytoskeletal function in Dictyostelium. Exp. Cell Res. 247, 356-366.[CrossRef][Medline]
Zhou, K., Takegawa, K., Emr, S. D. and Firtel, R. A. (1995). A phosphatidylinositol (PI) kinase gene family in Dictyostelium discoideum: biological roles of putative mammalian p110 and yeast Vps34p PI 3-kinase homologs during growth and development. Mol. Cell. Biol. 15, 5645-5656.[Abstract]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||