spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 28 October 2008
doi: 10.1242/jcs.038950


Journal of Cell Science 121, 3778-3785 (2008)
Published by The Company of Biologists 2008
This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow All Versions of this Article:
jcs.038950v1
121/22/3778    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ayala, Y. M.
Right arrow Articles by Baralle, F. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ayala, Y. M.
Right arrow Articles by Baralle, F. E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Research Article

Structural determinants of the cellular localization and shuttling of TDP-43

Youhna M. Ayala1,*, Paola Zago1,*, Andrea D'Ambrogio1, Ya-Fei Xu2, Leonard Petrucelli2, Emanuele Buratti1 and Francisco E. Baralle1,{ddagger}

1 International Centre for Genetic Engineering and Biotechnology (ICGEB), 34012 Trieste, Italy
2 Department of Neuroscience, Mayo Clinic College of Medicine, Jacksonville, FL 32224, USA

{ddagger} Author for correspondence (e-mail: baralle{at}icgeb.org)

Accepted 19 August 2008


    Summary
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
TDP-43 (also known as TARDBP) regulates different processes of gene expression, including transcription and splicing, through RNA and DNA binding. Moreover, recent reports have shown that the protein interacts with the 3'UTRs of specific mRNAs. The aberrant cellular distribution and aggregation of TDP-43 were recently reported in neurodegenerative diseases, namely frontotemporal lobar degeneration (FTLD) and amyotrophic lateral sclerosis (ALS). A detailed description of the determinants for cellular localization has yet to emerge, including information on how the known functions of TDP-43 and cellular targeting affect each other. We provide the first experimental evidence that TDP-43 continuously shuttles between nucleus and cytoplasm in a transcription-dependent manner. Furthermore, we investigate the role of the functional TDP-43 domains in determining cellular targeting through a combination of immunofluorescence and biochemical fractionation methods. Our analyses indicate that the C-terminus is essential for solubility and cellular localization, because its deletion results in the formation of large nuclear and cytoplasmic aggregates. Disruption of the RNA-recognition domain required for RNA and DNA binding, however, alters nuclear distribution by decreasing TDP-43 presence in the nucleoplasm. Our findings suggest that TDP-43 solubility and localization are particularly sensitive to disruptions that extend beyond the newly found nuclear localization signal and depend on a combination of factors that are closely connected to the functional properties of this protein.

Key words: hnRNP, Nuclear-cytoplasmic shuttling, RNA recognition motifs


    Introduction
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
The TAR DNA-binding protein (TARDBP, hereafter referred to as TDP-43) is a highly conserved heterogeneous nuclear ribonucleoprotein (hnRNP) (Krecic and Swanson, 1999Go) that controls the transcription, splicing and RNA stability of specific genes (for a review, see Buratti and Baralle, 2008Go). The protein associates with single-stranded RNA and DNA sequences, and exhibits remarkable specificity for UG/TG dinucleotide repeats (Ayala et al., 2005Go; Buratti and Baralle, 2001Go). Previously, we have shown that TDP-43 strongly inhibits exon splicing through the specific recruitment to 3' splice sites (for a review see Buratti and Baralle, 2008Go). In addition, our recent findings have indicated that TDP-43 downregulates cyclin-dependent kinase 6 (CDK6) transcript and protein levels in human cells. This interaction is possibly mediated by the 3' untranslated region (3' UTR) of the CDK6 mRNA (Ayala et al., 2008Go). Regulation of the human low-molecular-weight neurofilament (hNFL) by TDP-43 has also been reported to occur through 3' UTR recruitment (Strong et al., 2007Go). Evidence that TDP-43 is the major protein in inclusions from patients suffering from frontotemporal lobar degeneration (FTLD) with ubiquitin-positive inclusions and amyotrophic lateral sclerosis (ALS) has prompted intense investigation into the determinants of the subcellular localization of this protein (Neumann et al., 2006Go; Arai et al., 2006Go). TDP-43 is predominantly nuclear, but in cases of neurodegenerative TDP-43 proteinopathies it is present as cytoplasmic aggregates, presumably containing post-translational modifications.

TDP-43 comprises two RNA recognition motifs (RRMs) followed by a glycine-rich C-terminal domain. The presence of the RRMs is a distinguishing feature of hnRNP proteins and, in general, these regions are known to mediate RNA recognition as well as protein-protein interactions. The first RRM (RRM-1) is necessary and sufficient to bind specific RNA or DNA sequences (Buratti and Baralle, 2001Go). The C-terminal tail of TDP-43 does not bind RNA but is necessary to modulate the splicing of CFTR exon 9, probably through the recruitment of an hnRNP complex. In fact, TDP-43 associates with hnRNP A isoforms (i.e. hnRNP A1 and hnRNP A2/B1) through this region specifically. The functional importance of this domain in additional biological properties is highlighted by studies on the regulation of the spermatid-specific SP-10 gene (also known as ACRV1) (Abhyankar et al., 2007Go). Transcriptional inhibition of SP-10 by TDP-43 depends on the presence of the carboxyl domain and RRM-1 of the protein. Moreover, the presence of C-terminal fragments is a characteristic feature of the affected tissues and/or neurons in ALS and FTLD. The mechanisms that result in TDP-43 degradation are still unknown, although it has been recently demonstrated that, in FTLD cases associated with mutations in the progranulin gene, these fragments may be generated by caspase activation (Zhang et al., 2007Go). Finally, the potential existence of a close link between this region and disease is underlined by increasing reports of mutations within this domain that are associated with familiar and sporadic cases of ALS and FTLD (Kabashi et al., 2008Go; Sreedharan et al., 2008Go; Van Deerlin et al., 2008Go; Yokoseki et al., 2008Go).

Elucidating the mechanism(s) that control cellular TDP-43 localization is of paramount importance to describe TDP-43 function and its role in pathogenesis. The sequences and regions of hnRNPs that control their cellular localization differ greatly among members of the family. For instance, distribution of hnRNP A1 is determined by the M9 sequence near the C-terminus (Michael et al., 1995Go; Siomi and Dreyfuss, 1995Go); a nuclear retention signal within the auxiliary domain of hnRNP C1 restricts the protein to the nucleus (Nakielny and Dreyfuss, 1996Go); whereas hnRNP K contains a classic bipartite nuclear localization signal (NLS) and a separate unique sequence that promotes bidirectional nuclear transport (Michael et al., 1997Go). A bipartite classic NLS has recently been identified at the N-terminus of TDP-43 composed of K82RK84 (NLS1) and K95VKR98 (NLS2) (Winton et al., 2008Go). Replacement of the basic residues in either or both NLSs with alanine were observed to promote cytoplasmic TDP-43 localization. Contemporarily, human wild-type (wt) and mutant forms of TDP-43 were expressed in a yeast model system to replicate the protein aggregation and abnormal cellular localization observed in disease (Johnson et al., 2008Go).

This study shows that the predominantly nuclear TDP-43 constantly travels between the nucleus and the cytoplasm. At the same time, we investigate the effect that each functionally defined region of TDP-43 has upon subcellular distribution, by combining biochemical cellular fractionation and immunofluorescence methods. We find that disruption of the nucleic-acid-binding ability of TDP-43 or removal of its C-terminal tail interfere with the correct nuclear and cellular distribution of the protein.


Figure 1
View larger version (43K):
[in this window]
[in a new window]

 
Fig. 1. Cellular distribution of endogenous and wt FLAG-TDP-43. (A) Diagram of wt TDP-43 showing the mutations introduced in the nuclear localization signal (NLS1 and NLS2). Other distinguishing features of TDP-43 are the two RRM domains (RRM-1 and RRM-2) and the putative nuclear export signal (NES, light green). (B) Distribution of wt TDP-43 and mutant TDP-43 in the nucleus (N) and cytoplasm (C), in non-transfected (endogenous) HeLa cells and HeLa cells and transiently transfected with FLAG-tagged wt and Myc-tagged mutant TDP-43. The detection of p84 and tubulin was carried out as control for nuclear and/or cytoplasmic contamination of the two fractions. (C) Indirect immunofluorescence of U2OS cells non-transfected (endogenous) and transiently transfected with FLAG-TDP-43. wtTDP-43 showed nuclear localization with foci formation, whereas – as expected – disruption of either NLS resulted in cytoplasmic accumulation of the mutants. Similar results were obtained in HeLa cells. The endogenous protein was visualized using anti-TDP-43 polyclonal antibody (ProteinTech) and FITC-conjugated secondary antibody; transfected TDP-43 was detected using either anti-FLAG or anti-Myc monoclonal antibodies and Texas-Red-conjugated secondary antibody. The nuclear membrane was seen using either anti-lamin A/C polyclonal antibody or anti-LAP2β polyclonal antibody, and Texas-Red- or FITC-conjugated secondary antibodies. Scale bars: 10 µm.

 

    Results
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Biochemical and immunofluorescence studies on the cellular localization of wt TDP-43 and NLS mutants
The distribution of TDP-43 was investigated in HeLa and U2OS cell lines using two independent methods: confocal microscopy and biochemical fractionation of the cytoplasmic and nuclear fractions of transfected cells. Both methods showed that endogenous TDP-43 is predominantly nuclear, although lower levels of the protein are also present in the cytoplasm (Fig. 1B-C). These results are in keeping with previous observations regarding the distribution of endogenous TDP-43 in QBI-293 cells and primary hippocampal neurons (Winton et al., 2008Go). Transient transfection of a FLAG-tagged wild-type TDP-43 protein (wt TDP-43) did not significantly change cellular distribution. The overexpression of wt TDP-43 is probably responsible for the slight increase of TDP-43 in the cytoplasmic fraction (Fig. 1B). To rule out eventual nuclear and/or cytoplasmic contamination during cellular fractionation, we included cytoplasm-specific (tubulin) and nucleus-specific controls in the immunoblots of all samples (Fig. 1B, bottom). The yeast HPR1 homologue protein p84 (also known as THOC1) was used as nuclear marker (Durfee et al., 1994Go). We also assayed two mutants carrying mutations in the newly found nuclear localization sequences (NLSs) between amino acid residues 82 and 98 of TDP-43 (Fig. 1A) (Winton et al., 2008Go). As expected, disruption of either NLS1 or NLS2 of TDP-43 resulted in the accumulation of the protein in the cytoplasm, as seen by immunofluorescence (Fig. 1C) and biochemical fractionation (Fig. 1B). The constructs helped us to validate this system as a suitable model to investigate TDP-43 distribution between nuclear and cytoplasmic compartments. Nevertheless, our immunofluorescence experiments consistently showed the presence of the mutants in the nucleus, although at substantially lower amounts when compared with wt TDP-43. Disruption of both nuclear localization signals, NLS1 and NLS2, caused a substantial reduction in mutant TDP-43 in the nucleus, suggesting that the nuclear targeting signals are additive (supplementary material Fig. S1). However, the nuclei of cells expressing the double NLS1 mutant were not completely devoid of FLAG-tagged protein; we still observed the nuclear foci typical of wt TDP-43. These results indicate that additional factors are involved in the nuclear import of TDP-43. Alternatively, expression of tagged TDP-43 (wt or mutant) in the presence of endogenous TDP-43 might result in protein interactions, such as oligomerization, that affect the targeting of either form. TDP-43 oligomerization was already observed in vitro (Ayala et al., 2005Go). Recent data suggest that the process may also occur in cells as sequestration of endogenous TDP-43 or exogenous wt TDP-43 by NLS mutants in the cytoplasm was seen 72 hours post transfection (Winton et al., 2008Go).

The biochemical and immunofluorescence methods were used in parallel to obtain a comprehensive indication of TDP-43 distribution both at the single-cell and overall cell population levels. In some cases, such as with the NLS mutants shown in Fig. 1, the results obtained using both techniques were entirely consistent. However, as described below, accurate interpretation of experimental data obtained with other mutants benefited from these complementary techniques.

TDP-43 shuttles between the nucleus and cytoplasm
Recent findings that TDP-43 interacts with the 3'UTR of specific genes and the fact that it forms cytoplasmic inclusions in pathologies such as FTLD and ALS, indicated a function of TDP-43 through its localization in the cytoplasm (Ayala et al., 2008Go; Strong et al., 2007Go). Related proteins of the hnRNP family, such as hnRNP A1 and HuR, whose functions require nuclear as well as cytoplasmic localization have been shown to travel between the two compartments (Fan and Steitz, 1998Go; Piñol-Roma and Dreyfuss, 1992Go). The presence of TDP-43 in the cytoplasm under normal conditions, or its movement in and out of the nucleus has not been shown previously. We performed interspecies heterokaryon assays, commonly used to study hnRNP transport, to investigate TDP-43 nuclear-cytoplasmic shuttling. Under conditions of protein synthesis inhibition, transiently transfected human cells were fused with NIH-3T3 cells whose nuclei are readily distinguished by intense foci of DNA staining. As controls, we used two proteins whose shuttling – or lack of shuttling activity – is well established. The first hnRNP that was shown to shuttle, by using similar heterokaryon assays, was hnRNP A1, whereas hnRNP C1/C2 was not seen to translocate under the same experimental conditions (Piñol-Roma and Dreyfuss, 1992Go) (Fig. 2C,D). We observed that FLAG-tagged TDP-43 was present in mouse nuclei of fused cells, indicating that TDP-43 continuously travels in and out of the nucleus (Fig. 2, arrows indicating mouse nuclei). Like TDP-43, hnRNP A1 – but not hnRNP C1/C2 – was found in the nuclei of NIH-3T3 cells, confirming the validity of our experimental procedure (Fig. 2C,D). As further control, FLAG-tagged hnRNP C1/C2 was co-transfected with GFP-tagged TDP-43 to visualize specific nuclear translocation of both proteins in the same cells. Fig. 2D shows that GFP-TDP-43 is present in the mouse nuclei whereas hnRNP C1/C2 is completely absent. TDP-43 shuttling was seen with GFP- or FLAG-tagged protein in HeLa and U2OS cell lines. These results confirmed that TDP-43 travels rapidly and continuously in and out of the nucleus.


Figure 2
View larger version (50K):
[in this window]
[in a new window]

 
Fig. 2. TDP-43 nuclear-cytoplasmic shuttling seen by interspecies heterokaryon assays. Transiently transfected U2OS cells were fused with mouse NIH-3T3 cells upon cycloheximide treatment. Arrows indicate mouse nuclei of the fused cell, distinguished from human nuclei using DAPI staining. (A,B) GFP-tagged as well as FLAG-tagged TDP-43 were analyzed in transfected U2OS or HeLa cells. (C,D) FLAG-tagged hnRNP A1 and hnRNP C1/C2 were used as a controls for protein shuttling. In the case of hnRNP C1/C2, GFP-TDP-43 and FLAG-hnRNP C1/C2 were co-transfected to observe specific TDP-43 shuttling in the same fused cell. Scale bars: 10 µm.

 

Not all shuttling hnRNPs have been observed to accumulate in the nuclei in a transcription-dependent manner (Sarkar et al., 2003Go). To test whether ongoing transcription is required for TDP-43 import to the nucleus, we treated cells with actinomycin D at concentrations that mainly inhibit RNA polymerase II activity. Actinomycin D treatment of HeLa or U2OS cells led to a substantial increase in cytoplasmic endogenous TDP-43 as compared with control cells (supplementary material Fig. S2). The same was true in the case of FLAG-tagged TDP-43 (supplementary material Fig. S2B). Again, we used FLAG-tagged-hnRNP A1 and hnRNP C1/C2 as controls. As previously reported (Piñol-Roma and Dreyfuss, 1992Go), hnRNP A1 accumulated in the cytoplasm upon actinomycin D treatment, whereas distribution of hnRNP C1/C2 was not affected (supplementary material Fig. S2C,D).

Altered nuclear distribution of TDP-43 mutants {Delta}RRM-1 and F147L/F149L
We next tested the role of the functional regions of TDP-43 in cellular localization. The two most structurally defined domains of TDP-43 are RRM-1 and RRM-2. Previous studies highlighted the fundamental role of RRM-1 regarding the tight and highly specific binding of TDP-43 to UG repeats (Ayala et al., 2005Go; Buratti and Baralle, 2001Go). Two mutants were constructed to disrupt TDP-43 association with its target sequence. The first mutant carries two single-amino-acid substitutions F147L and F149L (F147L/F149L) that have previously been shown to abolish binding to UG-repeat sequences (Buratti and Baralle, 2001Go); the second mutant {Delta}RRM-1 lacks the entire RRM-1 domain (including amino acid residues 106 to 175). Neither of the mutants resulted in their selective export to the cytoplasm, suggesting that diminished RNA/DNA binding does not affect nuclear targeting. Accordingly, biochemical fractionation did not reveal any significant differences between wt TDP-43 and {Delta}RRM-1 distribution (Fig. 3B). The fractionation experiments, however, reflected a moderate increase of F147L/F149L in the cytoplasmic fraction when compared to wt. The same was not observed by immunofluorescence suggesting that factors inherent to this particular mutant may affect its distribution in the biochemical fractions. During the immunofluorescence analyses of these mutants we immediately noticed that deletion of the entire RRM-1 region caused the formation of nuclear bodies that were substantially larger and more numerous when compared to endogenous or FLAG-tagged wt TDP-43 (compare Fig. 3C and Fig. 3D). At the same time, ~20% of the F147L/F149L-transfected cells showed nuclear bodies similar to those seen with {Delta}RRM-1 (Fig. 3C-D).


Figure 3
View larger version (48K):
[in this window]
[in a new window]

 
Fig. 3. Effect of mutations in RRM-1. (A) Positions of the F147L/F149L and {Delta}RRM-1 mutations. (B) Nuclear-cytoplasmic distribution of the mutants as determined by western blotting. Detection of p84 and tubulin was carried out to check for nuclear (p84) or cytoplasmic (tubulin) contamination of the two fractions. (C) Localization of both mutants detected by immunofluorescence microscopy in U2OS cells using anti-FLAG monoclonal antibody. The nuclear membrane was visualized using anti-LAP2β polyclonal antibody. (D) Typical nuclei of transfected cells are shown in detail, similar results were seen in HeLa cells. Scale bars: 10 µm.

 

Chromatin distribution of the RRM-1 mutants
A recent report has shown that TDP-43, acting as a transcriptional insulator at the promoter of the spermatid-specific SP-10 gene, is predominantly present in the nuclear matrix fraction (Abhyankar et al., 2007Go). We wanted to test whether removal of TDP-43 disrupted chromatin organization. HeLa cells were depleted of TDP-43 by RNA interference (supplementary material Fig. S3B) as previously described (Arrisi-Mercado et al., 2004Go; Ayala et al., 2006Go). Both mock-depleted and TDP-43-depleted HeLa cells were treated with micrococcal nuclease and subsequent extractions were performed according to standard protocols (Martic et al., 2005Go). We obtained three sequential fractions: S1 (chromatin soluble in divalent ions, depleted of H1), S2 (EDTA soluble, more compact chromatin), and P (chromatin enriched in actively transcribed genes and nuclear matrix components) (Fig. 4). As shown by the DNA analysis reported in supplementary material Fig. S3, the nucleosomal profiles of the S1 and S2 fractions were similar in both mock-treated and TDP-43-depleted cells, suggesting that removal of TDP-43 does not have a drastic effect on nucleosomal ladder formation.


Figure 4
View larger version (34K):
[in this window]
[in a new window]

 
Fig. 4. Chromatin fractionation of cells expressing endogenous and wt TDP-43, {Delta}RRM-1 and F147L/F149L. Nuclei from transfected cells were digested with micrococcal nuclease and separated into fractions S1, S2 (supernatant) and P (pellet). The distribution of endogenous and wt TDP-43, F147L/F149L and {Delta}RRM1 TDP-43 into the different nuclear fractions was detected by western blotting using antibodies against endogenous TDP-43 and FLAG-tagged transfected proteins. Histone H1 detection was used as control for the different nuclear fractions.

 
We then looked for changes in the distribution of {Delta}RRM-1 and F147L/F149L upon chromatin fractionation with respect to wt TDP-43 because these mutants caused alterations in the nuclear localization pattern. In agreement with previous studies (Abhyankar et al., 2007Go) we found that endogenous TDP-43 accumulated in the nucleoplasm and nuclear matrix portions (Fig. 4, upper panel). Western blot analysis showed that, similar to the endogenous protein, FLAG-tagged TDP-43 expressed in HeLa cells was evenly distributed between the S1 and P fractions, and almost absent in the S2 fraction. As control we looked at the distribution of histone H1 which, as expected, was enriched in the S2 and P fractions (Fig. 4, bottom panel) (Martic et al., 2005Go). Strikingly, the distribution of {Delta}RRM-1 and F147L/F149L was strictly confined to the P fraction (Fig. 4, center panels). These results indicate that the distribution of TDP-43 between the soluble nucleoplasm and the structure-bound portion of the nucleus changes upon disruption of RNA and/or DNA binding. The incremental accumulation of {Delta}RRM-1 and F147L/F149L in the chromatin and/or nuclear matrix fraction may well have the same biological effect as a loss-of-function mutation. At the same time, these observations suggest that the cellular mobility of TDP-43 largely depends on RNA and/or DNA association or on protein interactions mediated by RRM-1.

Aberrant cellular localization of C-terminal deletion mutants
The C-terminal tail of TDP-43 promotes interactions with hnRNPs – as seen in vitro (Buratti et al., 2005Go). Moreover, this domain is required for the regulation of alternative splicing, as seen both in vitro and in transfected human cells (Ayala et al., 2005Go; Buratti et al., 2005Go) (and our unpublished results). Mutants that gradually shorten the C-terminal tail of TDP-43 (amino acid sequences 1-366, 1-315, and {Delta}C truncated at residue 261) were engineered to investigate the importance of the C-terminus in cellular targeting. We were also curious to test whether the complex formed by TDP-43 and the other hnRNPs has a role in cellular targeting (Fig. 5A). Biochemical fractionation of cells expressing the different mutants showed that the {Delta}C and 1-315 truncations caused a progressive shift toward cytoplasmic localization (Fig. 5B). The immunofluorescence experiments performed in U2OS cells, however, revealed a picture in which the 1-315 and {Delta}C localization patterns were variable, ranging from nuclear wt-like distribution to cytoplasmic localization (Fig. 6). Moreover, we observed that a fraction of {Delta}C-transfected cells contained large nuclear inclusions that corresponded to hollow spaces in DAPI staining (Fig. 6B, central panels), suggesting dense and insoluble bodies. The number of cells showing inclusion bodies increased proportionally with the amount of protein expressed. Transfection of similar amounts of wt protein, however, did not result in similar changes (data not shown). In the case of HeLa cells, higher amounts of the truncated {Delta}C protein were required to obtain cytoplasmic localization and inclusion bodies, as observed by immunofluorescence microscopy.


Figure 5
View larger version (16K):
[in this window]
[in a new window]

 
Fig. 5. Biochemical fractionation of the C-terminally truncated mutants of TDP-43. (A) Diagram of the different mutants 1-366, 1-315 and {Delta}C. (B) Nuclear-cytoplasmic fractionation of HeLa cells expressing the different C-terminus mutants as detected by immunoblotting. Detection of p84 and tubulin was carried out to check for nuclear (p84) or cytoplasmic (tubulin) contamination of the two fractions.

 

Figure 6
View larger version (47K):
[in this window]
[in a new window]

 
Fig. 6. Immunofluorescence images of U2OS cells transiently transfected with different C-terminal mutations of TDP-43 (1-366, 1-315 and {Delta}C). (A) Anti-FLAG monoclonal antibody and staining of the nuclear membrane were visualized with anti-LAP2β polyclonal antibody. (B) Detection of FLAG-tagged {Delta}C together with DAPI staining of the nuclei. Scale bars: 10 µm.

 

Heterokaryon assays with mutant TDP-43
Once the subcellular distribution of the mutant TDP-43 forms was investigated, we tested their ability to shuttle between nuclear and cytoplasmic compartments. As expected, disruption of the bipartite nuclear localization signal inhibited the ability of NLS1 and NLS2 to be imported into the mouse nuclei. Most of the detectable TDP-43 mutants remained in the cytoplasm of the heterologous nuclei, in agreement with the requirement of this amino-terminal sequence to allow nuclear entry (supplementary material Fig. S4A,B). Mutants {Delta}RRM-1 and F147L/F149 showed shuttling activity, but at reduced levels when compared with wt TDP-43 (data not shown). In the case of the mutant lacking the C-terminus of TDP-43, we observed shuttling in cells where the human donor nuclei presented a wt pattern (supplementary material Fig. S4C). No translocation of {Delta}C into the mouse nuclei was observed in the presence of cytoplasmic localization or inclusion bodies (supplementary material Fig. S4D). These last observations are in agreement with a decrease in TDP-43 mobility upon removal of the C-terminal region.


    Discussion
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Until recently, TDP-43 has been mainly studied in connection to the abnormal splicing of the cystic fibrosis transmembrane conductance regulator (CFTR) exon 9, an event that is closely associated with the occurrence of cystic fibrosis (Delaney et al., 1993Go; Strong et al., 1993Go). Subsequently, aberrantly localized and post-translationally modified forms of TDP-43 were found to represent the main accumulating protein in neuronal cytoplasmic inclusions in patients affected by two neurodegenerative diseases, frontotemporal dementias (FTDs) and ALS (Neumann et al., 2006Go; Arai et al., 2006Go). The pathological role of TDP-43 in these neurodegenerative diseases is still not understood. As with other neurodegenerative pathologies characterized by intracellular protein aggregation, the cause and effect relationship between TDP-43 inclusions and disease is unknown. In particular, it remains to be established whether TDP-43 inclusions are inherently toxic, or whether the sequesteration of TDP-43 during aggregation is the pathogenic event. Formation of TDP-43 inclusions in the affected cells is accompanied by depletion of the protein from the nucleus, suggesting that the various regulatory activities carried out by TDP-43, namely splicing, transcription and the more recently described role in cell-cycle control, are disrupted by aberrant TDP-43 aggregation (Ayala et al., 2008Go; Buratti and Baralle, 2008Go). Further details on the determinants for correct localization and the connection between cellular targeting and protein activity are required to better understand TDP-43 function and its role in neurodegenerative diseases.

Our present work shows that, although predominantly nuclear, TDP-43 continuously travels between the nucleus and cytoplasm. The nuclear-cytoplasmic shuttling activity of other proteins, such as hnRNP A1 and SFRS1 (also known as SF2 or ASF), is consistent with their various functions in both cellular compartments. Likewise, TDP-43 would require similar mobility to carry out functions including interactions with introns, 3' UTR, and the processing of microRNA (Ayala et al., 2008Go) (and our unpublished work). In the case of almost all shuttling hnRNPs and SR proteins, transcription inhibition has been used to decrease nuclear import as an alternative means of visualizing protein permanence in the cytoplasm. According to our results, TDP-43 also accumulates in the cytoplasm upon inhibition of RNA polymerase II following treatment with actinomycin D. As in the case of the other shuttling hnRNPs, whose cellular distribution is affected by actinomycin D, the mechanism by which transcription inhibition affects the nuclear recruitment of TDP-43 is unknown (see Piñol-Roma and Dreyfuss, 1993Go). We can only speculate that continuous mRNA synthesis is required to signal TDP-43 import via RNA or protein-protein interactions.

Our results on the cellular distribution of the carboxy-domain mutants reveal that disruptions in this region affect normal targeting of TDP-43 to the nucleus and cytoplasm. The observed heterogeneity of cellular targeting of the {Delta}C-truncated mutant, however, suggests that lack of the C-terminal domain does not affect a single localization signal for nuclear import, export or nuclear retention. This mutant shows cytoplasmic localization despite the presence of the recently described NLS at the N-terminus (Winton et al., 2008Go). The fact that {Delta}C TDP-43 forms cytoplasmic and nuclear inclusion bodies strongly points to a role of the C-terminal tail in TDP-43 solubility. Decreased mobility of the mutant might cause aberrant nuclear or cytoplasmic retention. In fact, heterokaryon assays show greatly decreased nuclear import of {Delta}C TDP-43 in fused cells where the mutant is outside the nucleus and/or forms inclusion bodies (supplementary material Fig. S4C,D). From a functional point of view, the C-terminal region of TDP-43 is necessary to promote splicing and transcriptional inhibition of TDP-43 target genes (Abhyankar et al., 2007Go; Ayala et al., 2005Go; Buratti et al., 2005Go). This region has been shown to associate with hnRNP A/B isoforms in RNA-bound and -unbound forms (Buratti et al., 2005Go). Collectively, these results suggest that TDP-43 solubility depends on the association with these additional factors through its C-terminal tail region. Regarding the potential effects on the cellular environment, high expression of {Delta}C isoforms are likely to reduce cell viability – as observed in the case of polyglutamine protein aggregation (Welch and Diamond, 2001Go). In contrast to our observations, most of the C-terminal-truncated mutants expressed in the yeast model are reported to be present in the nucleus and to cause no aggregation (Johnson et al., 2008Go). We do not have an explanation for this discrepancy yet, although it is possible that TDP-43 expression in yeast undergoes different transport dynamics than in human cells.

The RRM-1 region of TDP-43 has been well characterized in terms of protein function and nucleic acid interactions. In addition to disrupting RNA binding (Buratti and Baralle, 2001Go), RRM-1 mutants fail to regulate alternative splicing (our unpublished observations). We showed that although disruption of RNA and/or DNA binding does not change the predominantly nuclear targeting of TDP-43, the deletion of the N-terminal RRM-1 ({Delta}RRM-1) domain or point mutations therein (F147L/F149L) seem to alter TDP-43 dynamics in the nucleus. In fact, the {Delta}RRM-1 bodies observed by immunofluorescence are clearly distinct from the foci formed by wt TDP-43; they are larger and more numerous. The chromatin fractionation studies confirm that the nuclear distribution of the mutants is different from wt TDP-43. The fact that expression of both RRM-1-deletion mutants and the more conservative point mutants result in similar nuclear localization and chromatin fractionation patterns argues against protein insolubility of these mutants. As summarized in Fig. 7, endogenous and FLAG-tagged TDP-43 are present in both soluble and chromatin/nuclear matrix bound fractions, whereas {Delta}RRM-1 and F147L/F149L are almost entirely associated with the nuclear matrix. These results suggest that functions associated with RRM-1, such as (UG)n RNA binding, confer TDP-43 mobility in the nucleus. The function of RRM-2 remains elusive because it is dispensable for targeted RNA binding. The strong nuclear-matrix–scaffold association displayed by mutants that lack functional RRM-1 may imply a role for RRM-2 in chromatin organization.


Figure 7
View larger version (31K):
[in this window]
[in a new window]

 
Fig. 7. Disruption of RRM-1 increases TDP-43 binding to the chromatin and/or nuclear matrix. Under normal conditions, TDP-43 is found in the soluble nuclear fraction (S1) and bound to the nuclear matrix portion. Deletion of RRM-1 or mutation of key RNA and/or DNA-binding residues, shifts the equilibrium towards the bound fraction. RNA and/or DNA-binding mediated through RRM-1 may require protein mobility in the soluble fraction of the nucleus, whereas RRM-2 mediates recruitment to chromatin and/or the nuclear matrix.

 

In conclusion, here we show that the different nuclear and cytoplasmic functions of TDP-43 can easily perturb its cellular distribution and solubility. Thus, insight into the possible links between TDP-43 function and certain diseases will probably derive from studies that focus on how the disease-related TDP-43 mutations affect TDP-43 function.


    Materials and Methods
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Plasmid construction
FLAG-tagged TDP-43 was generated by PCR amplification from the previously described vector pGEX3X-TDP43 (Buratti et al., 2001Go) using primers 1 and 2 (see below) to clone the sequence between the HindIII-BamHI sites of pFLAG-CMV-2 (Sigma). TDP-43 was cloned into eGFP-N1 vector (Clontech) between HindIII-BamHI sites. NLS1 and NLS2 were expressed from a Myc-tagged vector pcDNA3.1(+)/Myc-His A (Invitrogen). The TDP-43 sequence was cloned using BamHI-XbaI sites. pF-{Delta}RRM1 was amplified by PCR from pGEX3X-{Delta}RRM1 (Buratti and Baralle, 2001Go) using primers 1 and 3 to clone between HindIII-KpnI. Point mutations F147L/F149L were introduced by PCR using primers 4 and 5, and cloned between HindIII-KpnI sites. FLAG-tagged C-terminal truncation mutants were constructed by PCR amplification and cloned between HindIII-KpnI sites using the following oligonucleotides: pF-{Delta}C (1 and 6), 1-315 (1 and 7), and 1-366 (1 and 8). FLAG-tagged hnRNP A1 and hnRNP C1/C2 were cloned by PCR amplification using primers 9 and 10, and 11 and 12, respectively, between KpnI-BamHI sites. cDNA from HeLa cells was used as template. Primer sequences are: (1) pFHindwtFW_cccaagctttctgaatatattcgggtaaccg; (2) pFBamwtRV_cgcggatccctacattccccagccagaagacttag; (3) pFKpnwtRV_cggggtaccctacattccccagccagaagacttag; (4) F147L/F149LFW_aaggggttgggcttggttcgtttt; (5) F147L/F149LFW_aaaacgaaccaagcccaacccctt; (6) pFKpnDCRV_cggggtaccctaggcattggatatatgaacgctg; (7) pFKpn315RV_ggggtacctcacgcaccaaagttcatcccaccacc; (8) pFKpn366RV_ggggtacctcaggcctggtttggctccctctg; (9) KpnA1FW_cggggtaccatctaagtcagagtctcctaaag; (10) BamHA1RV_cgcggatccttaaaatcttctgccactgcc; (11) KpnC1FW_cggggtaccagccagcaacgttaccaacaag; (12) BamHC1RV_cgcggatccttaagagtcatcctcgccattg.

Cell culture, transient transfection and RNA interference
Human HeLa and U2OS, and mouse NIH-3T3 cell lines were grown in DMEM-Glutamax-I (GIBCO) supplemented with 10% fetal bovine serum (EuroClone) and antibiotic-antimycotic-stabilized suspension (Sigma). Cells were grown overnight and transfected with Effectene transfection reagent (Qiagen). Cell electroporation of U2OS cells was carried out using 0.5x106 cells in 0.7 ml of PBS at room temperature in a Gene Pulser/MicroPulser, using a 0.4-cm gap cuvette (Bio-Rad) at 250 V, 975 µF with a Gene Pulser II (Bio-Rad). Depletion of TDP-43 by RNA interference for the chromatin-fractionation studies was carried out as previously described (Arrisi-Mercado et al., 2004Go; Ayala et al., 2006Go). Transcription-inhibition experiments were performed by treating cells with 5 µg/ml of actinomycin D for 3 hours.

Heterokaryon assays
Assays were carried out as previously described (Caceres et al., 1998Go; Piñol-Roma and Dreyfuss, 1992Go), fixing cells for 1 hour after cell fusion that was carried out 24 hours post transfection.

Subcellular fractionation
Two 100-mm confluent dishes were harvested and washed in PBS by repeated centrifugation. The protocol was carried out at 4°C. The pellet was resuspended in five volumes of buffer N [15 mM Tris-HCl pH 7.5, 60 mM KCl, 15 mM NaCl, 5 mM MgCl2, 1 mM CaCl2, 1 mM DTT, 2 mM Na3VO4, 1 mM PMSF, 0.25 M sucrose, Complete Protease Inhibitor Cocktail (Roche Applied Science)]. Cell lysis was obtained by adding an equal amount of buffer N plus 0.6% NP-40. Following 5 minutes of incubation nuclei were pelleted and gently resuspended in 1 ml of buffer N. The nuclei were again pelleted and lysed using an equal volume of solution 2 (10 mM HEPES pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.1 mM EGTA, 0.1 mM DTT, 0.5 mM PMSF, 5% glycerol, 0.4 M NaCl). The nuclear fraction was cleared by centrifugation following 30 minutes of incubation. Nuclear and cytoplasmic fractions were quantified (Bradford Protein Assay, Bio-Rad) and visualized by SDS-PAGE and western blotting on a nitrocellulose membrane.

Chromatin fractionation
S1, S2 and P chromatin fractions from HeLa-cell nuclei were prepared according to previously described procedures (Martic et al., 2005Go; Rose and Garrard, 1984Go), with minor modifications. HeLa cells were grown overnight to confluence in a 100-mm dish. The harvested cells were washed with PBS followed by a wash with hypotonic buffer A (20 mM HEPES pH 7.9, 20 mM NaCl, 5 mM MgCl2, 1 mM ATP) and incubated on ice for 15 minutes in the same buffer. Lysis of the cytoplasmic membrane was achieved with 20 strokes in a 15-ml cell douncer (Wheaton) using the type B pestle. The nuclear pellet was obtained by centrifugation and was then resuspended in buffer B (20 mM HEPES pH 7.9, 0.15 M NaCl, 0.5 mM MgCl2, 0.3 mM sucrose, 2 mM CaCl2, 1 mM ATP, and 0.5% NP-40), incubated for 30 minutes at 4°C and centrifuged to obtain a total chromatin fraction and a soluble nuclear fraction. The chromatin fraction was resuspended in buffer B without NP-40 and incubated for 4 minutes at 16°C with 1 unit of micrococcal nuclease (Sigma). The solution was centrifuged to obtain the supernatant (S1). The pellet was resuspended in 8 mM EDTA, incubated at 4°C for 15 minutes, and centrifugated to obtain the chromatin fraction (P) and supernatant (S2). The proteins contained in each fraction were separated by 12% SDS-PAGE and detected by western blotting.

Immunofluorescence microscopy
Indirect immunofluorescence was carried out as previously described (Ayala et al., 2008Go). Cells were observed on a Zeiss LSM 510 confocal microscope.

Antibodies
Endogenous TDP-43 was detected using rabbit anti-TDP43 polyclonal antibodies (Buratti et al., 2001Go) and ProteinTech (10782-2). Anti-FLAG M2 monoclonal antibody was from Sigma (F1804), mouse anti-Myc monoclonal antibody (9B11) from Cell Signaling, goat anti-Lamin A/C polyclonal antibody from Santa Cruz Biotechnology (sc-6215) and anti-LAP2β was kindly provided Tom Misteli (NCI NIH, Bethesda, MD). Antibodies used for the fractionation controls included mouse anti-tubulin monoclonal (Sigma; T5168), rabbit anti-histone H1 polyclonal (Santa Cruz Biotechnology; sc-10806), and mouse anti-p84 monoclonal (Abcam; ab487). HRP-conjugated secondary antibodies (Dako) were used for immunoblotting, and FITC- or Texas-Red-conjugated secondary antibodies (Jackson ImmunoResearch) were used for immunofluorescence detection.


    Acknowledgments
 
This work was supported by Telethon Onlus Foundation (Italy) (GGP06147), FIRB (RBNE01W9PM), and by a European community grant (EURASNET-LSHG-CT-2005-518238). We also wish to thank Monica Caggiano for technical help and Maurizio Romano (ICGEB, Trieste, Italy) for the eGFP-TDP43 vector.


    Footnotes
 
Supplementary material available online at http://jcs.biologists.org/cgi/content/full/121/22/3778/DC1

* These authors contributed equally to this work Back


    References
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 

Abhyankar, M. M., Urekar, C. and Reddi, P. P. (2007). A novel CpG-free vertebrate insulator silences the testis-specific SP-10 gene in somatic tissues: role for TDP-43 in insulator function. J. Biol. Chem. 282, 36143-36154.[Abstract/Free Full Text]

Arai, T., Hasegawa, M., Akiyama, H., Ikeda, K., Nonaka, T., Mori, H., Mann, D., Tsuchiya, K., Yoshida, M., Hashizume, Y. et al. (2006). TDP-43 is a component of ubiquitin-positive tau-negative inclusions in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Biochem. Biophys. Res. Commun. 351, 602-611.[CrossRef][Medline]

Arrisi-Mercado, P., Romano, M., Muro, A. F. and Baralle, F. E. (2004). An exonic splicing enhancer offsets the atypical GU-rich 3' splice site of human apolipoprotein A-II exon 3. J. Biol. Chem. 279, 39331-39339.[Abstract/Free Full Text]

Ayala, Y. M., Pantano, S., D'Ambrogio, A., Buratti, E., Brindisi, A., Marchetti, C., Romano, M. and Baralle, F. E. (2005). Human, Drosophila, and C.elegans TDP43: nucleic acid binding properties and splicing regulatory function. J. Mol. Biol. 348, 575-588.[CrossRef][Medline]

Ayala, Y. M., Pagani, F. and Baralle, F. E. (2006). TDP43 depletion rescues aberrant CFTR exon 9 skipping. FEBS Lett. 580, 1339-1344.[CrossRef][Medline]

Ayala, Y. M., Misteli, T. and Baralle, F. E. (2008). TDP-43 regulates retinoblastoma protein phosphorylation through the repression of cyclin-dependent kinase 6 expression. Proc. Natl. Acad. Sci. USA 105, 3785-3789.[Abstract/Free Full Text]

Buratti, E. and Baralle, F. E. (2001). Characterization and functional implications of the RNA binding properties of nuclear factor TDP-43, a novel splicing regulator of CFTR exon 9. J. Biol. Chem. 276, 36337-36343.[Abstract/Free Full Text]

Buratti, E. and Baralle, F. E. (2008). Multiple roles of TDP-43 in gene expression, splicing regulation, and human disease. Front. Biosci. 13, 867-878.[CrossRef][Medline]

Buratti, E., Dork, T., Zuccato, E., Pagani, F., Romano, M. and Baralle, F. E. (2001). Nuclear factor TDP-43 and SR proteins promote in vitro and in vivo CFTR exon 9 skipping. EMBO J. 20, 1774-1784.[CrossRef][Medline]

Buratti, E., Brindisi, A., Giombi, M., Tisminetzky, S., Ayala, Y. M. and Baralle, F. E. (2005). TDP-43 binds heterogeneous nuclear ribonucleoprotein A/B through its C-terminal tail: an important region for the inhibition of cystic fibrosis transmembrane conductance regulator exon 9 splicing. J. Biol. Chem. 280, 37572-37584.[Abstract/Free Full Text]

Caceres, J. F., Screaton, G. R. and Krainer, A. R. (1998). A specific subset of SR proteins shuttles continuously between the nucleus and the cytoplasm. Genes Dev. 12, 55-66.[Abstract/Free Full Text]

Delaney, S. J., Rich, D. P., Thomson, S. A., Hargrave, M. R., Lovelock, P. K., Welsh, M. J. and Wainwright, B. J. (1993). Cystic fibrosis transmembrane conductance regulator splice variants are not conserved and fail to produce chloride channels. Nat. Genet. 4, 426-431.[CrossRef][Medline]

Durfee, T., Mancini, M. A., Jones, D., Elledge, S. J. and Lee, W. H. (1994). The amino-terminal region of the retinoblastoma gene product binds a novel nuclear matrix protein that co-localizes to centers for RNA processing. J. Cell Biol. 127, 609-622.[Abstract/Free Full Text]

Fan, X. C. and Steitz, J. A. (1998). HNS, a nuclear-cytoplasmic shuttling sequence in HuR. Proc. Natl. Acad. Sci. USA 95, 15293-15298.[Abstract/Free Full Text]

Johnson, B. S., McCaffery, J. M., Lindquist, S. and Gitler, A. D. (2008). A yeast TDP-43 proteinopathy model: exploring the molecular determinants of TDP-43 aggregation and cellular toxicity. Proc. Natl. Acad. Sci. USA 105, 6439-6444.[Abstract/Free Full Text]

Kabashi, E., Valdmanis, P. N., Dion, P., Spiegelman, D., McConkey, B. J., Vande Velde, C., Bouchard, J. P., Lacomblez, L., Pochigaeva, K., Salachas, F. et al. (2008). TARDBP mutations in individuals with sporadic and familial amyotrophic lateral sclerosis. Nat. Genet. 40, 572-574.[CrossRef][Medline]

Krecic, A. M. and Swanson, M. S. (1999). hnRNP complexes: composition, structure, and function. Curr. Opin. Cell Biol. 11, 363-371.[CrossRef][Medline]

Martic, G., Karetsou, Z., Kefala, K., Politou, A. S., Clapier, C. R., Straub, T. and Papamarcaki, T. (2005). Parathymosin affects the binding of linker histone H1 to nucleosomes and remodels chromatin structure. J. Biol. Chem. 280, 16143-16150.[Abstract/Free Full Text]

Michael, W. M., Choi, M. and Dreyfuss, G. (1995). A nuclear export signal in hnRNP A1: a signal-mediated, temperature-dependent nuclear protein export pathway. Cell 83, 415-422.[CrossRef][Medline]

Michael, W. M., Eder, P. S. and Dreyfuss, G. (1997). The K nuclear shuttling domain: a novel signal for nuclear import and nuclear export in the hnRNP K protein. EMBO J. 16, 3587-3598.[CrossRef][Medline]

Nakielny, S. and Dreyfuss, G. (1996). The hnRNP C proteins contain a nuclear retention sequence that can override nuclear export signals. J. Cell Biol. 134, 1365-1373.[Abstract/Free Full Text]

Neumann, M., Sampathu, D. M., Kwong, L. K., Truax, A. C., Micsenyi, M. C., Chou, T. T., Bruce, J., Schuck, T., Grossman, M., Clark, C. M. et al. (2006). Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science 314, 130-133.[Abstract/Free Full Text]

Piñol-Roma, S. and Dreyfuss, G. (1992). Shuttling of pre-mRNA binding proteins between nucleus and cytoplasm. Nature 355, 730-732.[CrossRef][Medline]

Piñol-Roma, S. and Dreyfuss, G. (1993). hnRNP proteins: localization and transport between the nucleus and the cytoplasm. Trends Cell Biol. 3, 151-155.[CrossRef][Medline]

Rose, S. M. and Garrard, W. T. (1984). Differentiation-dependent chromatin alterations precede and accompany transcription of immunoglobulin light chain genes. J. Biol. Chem. 259, 8534-8544.[Abstract/Free Full Text]

Sarkar, B., Lu, J. and Schneider, R.J. (2003). Nuclear import and export function in the different isoforms of the AUF1/heterogeneous nuclear ribonucleoprotein protein family. J. Biol. Chem. 278, 20700-20707.[Abstract/Free Full Text]

Siomi, H. and Dreyfuss, G. (1995). A nuclear localization domain in the hnRNP A1 protein. J. Cell Biol. 129, 551-560.[Abstract/Free Full Text]

Sreedharan, J., Blair, I. P., Tripathi, V. B., Hu, X., Vance, C., Rogelj, B., Ackerley, S., Durnall, J. C., Williams, K. L., Buratti, E. et al. (2008). TDP-43 mutations in familial and sporadic amyotrophic lateral sclerosis. Science 319, 1668-1672.[Abstract/Free Full Text]

Strong, M. J., Volkening, K., Hammond, R., Yang, W., Strong, W., Leystra-Lantz, C. and Shoesmith, C. (2007). TDP43 is a human low molecular weight neurofilament (hNFL) mRNA-binding protein. Mol. Cell Neurosci. 35, 320-327.[CrossRef][Medline]

Strong, T. V., Wilkinson, D. J., Mansoura, M. K., Devor, D. C., Henze, K., Yang, Y., Wilson, J. M., Cohn, J. A., Dawson, D. C., Frizzell, R. A. et al. (1993). Expression of an abundant alternatively spliced form of the cystic fibrosis transmembrane conductance regulator (CFTR) gene is not associated with a cAMP-activated chloride conductance. Hum. Mol. Genet. 2, 225-230.[Abstract/Free Full Text]

Van Deerlin, V. M., Leverenz, J. B., Bekris, L. M., Bird, T. D., Yuan, W., Elman, L. B., Clay, D., Wood, E. M., Chen-Plotkin, A. S., Martinez-Lage, M. et al. (2008). TARDBP mutations in amyotrophic lateral sclerosis with TDP-43 neuropathology: a genetic and histopathological analysis. Lancet Neurol. 7, 409-416.[CrossRef][Medline]

Welch, W. J. and Diamond, M. I. (2001). Glucocorticoid modulation of androgen receptor nuclear aggregation and cellular toxicity is associated with distinct forms of soluble expanded polyglutamine protein. Hum. Mol. Genet. 10, 3063-3074.[Abstract/Free Full Text]

Winton, M. J., Igaz, L. M., Wong, M. M., Kwong, L. K., Trojanowski, J. Q. and Lee, V. M. (2008). Disturbance of nuclear and cytoplasmic TAR DNA-binding protein (TDP-43) induces disease-like redistribution, sequestration, and aggregate formation. J. Biol. Chem. 283, 13302-13309.[Abstract/Free Full Text]

Yokoseki, A., Shiga, A., Tan, C. F., Tagawa, A., Kaneko, H., Koyama, A., Eguchi, H., Tsujino, A., Ikeuchi, T., Kakita, A. et al. (2008). TDP-43 mutation in familial amyotrophic lateral sclerosis. Ann. Neurol. 63, 538-542.[CrossRef][Medline]

Zhang, Y. J., Xu, Y. F., Dickey, C. A., Buratti, E., Baralle, F., Bailey, R., Pickering-Brown, S., Dickson, D. and Petrucelli, L. (2007). Progranulin mediates caspase-dependent cleavage of TAR DNA binding protein-43. J. Neurosci. 27, 10530-10534.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
A. D'Ambrogio, E. Buratti, C. Stuani, C. Guarnaccia, M. Romano, Y. M. Ayala, and F. E. Baralle
Functional mapping of the interaction between TDP-43 and hnRNP A2 in vivo
Nucleic Acids Res., May 8, 2009; (2009) gkp342v1.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Y.-J. Zhang, Y.-F. Xu, C. Cook, T. F. Gendron, P. Roettges, C. D. Link, W.-L. Lin, J. Tong, M. Castanedes-Casey, P. Ash, et al.
Aberrant cleavage of TDP-43 enhances aggregation and cellular toxicity
PNAS, May 5, 2009; 106(18): 7607 - 7612.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. M. Igaz, L. K. Kwong, A. Chen-Plotkin, M. J. Winton, T. L. Unger, Y. Xu, M. Neumann, J. Q. Trojanowski, and V. M.-Y. Lee
Expression of TDP-43 C-terminal Fragments in Vitro Recapitulates Pathological Features of TDP-43 Proteinopathies
J. Biol. Chem., March 27, 2009; 284(13): 8516 - 8524.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow All Versions of this Article:
jcs.038950v1
121/22/3778    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ayala, Y. M.
Right arrow Articles by Baralle, F. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ayala, Y. M.
Right arrow Articles by Baralle, F. E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?