|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 19 February 2008
doi: 10.1242/jcs.019166
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
during axonal extension in hippocampal neurons
1 MRC Centre for Developmental Neurobiology, King's College London, London, SE1 1UL, UK
2 Department of Physiology, University College London, London, WC1E 6JJ, UK
3 Wolfson Centre for Age-Related Diseases, King's College London, London, SE1 1UL, UK
* Author for correspondence (e-mail: Britta.J.Eickholt{at}kcl.ac.uk)
Accepted 17 December 2007
| Summary |
|---|
|
|
|---|
is enriched in specific areas of the postnatal and adult brain, including the hippocampus and cerebellum. Overexpression of PITP
, but not PITPβ or a PITP
mutant deficient in binding PtdIns, enhances laminin-dependent extension of axonal processes in hippocampal neurons, whereas knockdown of PITP
protein by siRNA suppresses laminin and BDNF-induced axonal growth. PITP
-mediated axonal outgrowth is sensitive to phosphoinositide 3-kinase (PI3K) inhibition and shows dependency on the Akt/GSK-3/CRMP-2 pathway. We conclude that PITP
controls the polarized extension of axonal processes through the provision of PtdIns for localized PI3K-dependent signalling.
Key words: PITP, Axonal elongation, Phosphoinositide 3-kinase, Hippocampal neurons
| Introduction |
|---|
|
|
|---|
The substrate of PI3K, PtdIns(4,5)P2 (PIP2), is synthesized from phosphatidylinositol (PtdIns) by sequential phosphorylation steps that are mediated by PI4K and PI(4)P5-kinase. As PtdIns is synthesized in the endoplasmic reticulum, mechanisms for the transport of PtdIns to its sites of use at the membrane have been proposed. Phosphatidylinositol transfer proteins (PITP
and β) possess the unique ability to specifically bind PtdIns or phosphatidylcholine (PtdCho) (Tilley et al., 2004
; Yoder et al., 2001
), and to facilitate their transfer between membrane compartments (Cockcroft, 1998
; Wirtz, 1991
). The PtdIns transfer activities of PITPs have been shown to be required for both PI3K- and PLC-mediated signalling, and during PLC signalling, PITPs are thought to function by replenishing the plasma membrane pool of inositol lipids with PtdIns from its intracellular site of synthesis as PIP2 is consumed (Kular et al., 1997
; Thomas et al., 1993
). Thus, it can be speculated that PITPs may play a role in the development of the nervous system, given the evidence that both PI3K and PLC activity can modulate neurite outgrowth responses (Ming et al., 1999
). In this context, PITP
has indeed been shown to be an essential component during netrin-1-induced PLC signalling and neurite outgrowth (Xie et al., 2005
; Xie et al., 2006
) – by contrast, whether PITPs also controls PI3K-dependent signalling events during neurite remodelling is currently unknown.
| Results |
|---|
|
|
|---|
for nervous system development and/or function is indicated in the vibrator mutation, which causes neurodegeneration due to a five-fold reduction in PITP
levels (Hamilton et al., 1997
knockout mice (Alb Jr et al., 2003
in neurons. Analysis of PITP
expression by western blotting revealed the highest expression in the brain (Fig. 1A; see Fig. S1 in the supplementary material), supporting previously reported mRNA distributions (Imai et al., 1997
(Fig. 1A; see Fig. S1 in the supplementary material). Histochemical analysis in the adult mouse cerebellum showed restricted PITP
expression in the molecular layer and punctuate immunoreactivity in the granule cell layer (Fig. 1B). Although low signals are detected in the white matter tract of the adult mouse cerebellum, an axonal distribution in this region at P15 suggests a requirement for PITP
in developmental events contributing to the establishment of neuronal connectivity (Fig. 1C). In the hippocampus of adult (Fig. 1D,E) and P15 mice (Fig. 1F), PITP
was broadly expressed; again, specific synaptic contacts were enriched in the stratum radiatum (Fig. 1E).
|
We examined the distribution of PITP
during neuronal maturation in embryonic day 18 (E18) rat hippocampal neurons that were cultured in vitro for up to 21 days. At day 2, the majority of hippocampal neurons acquired the characteristic stage 3 morphology with one long process (axon) and several minor processes (immature dendrites) (Dotti et al., 1988
). At this stage, the anti-PITP
antibody labelled the axonal processes and their growth cones (Fig. 2A-C). Little or no staining was present in the remaining shorter processes, including their growth cones. This distribution was observed in approximately 70% of hippocampal neurons that had acquired a stage 3 morphology (Fig. 2D). The axonal accumulation was specific to PITP
, as PITPβ appeared to be enriched in the perinuclear Golgi region of the neuronal soma (Fig. 2E). At day 5 (stage 4 neurons), PITP
immunostaining was detected in both axons and dendrites (Fig. 2F), and at day 14, strong, punctate PITP
signals showed a degree of co-localization with the pre-synaptic marker synaptophysin (Fig. 2G). These results manifest a dynamic distribution and a steady increase in expression of PITP
during neuronal maturation, which we also observed by western blot analysis (Fig. 2H).
|
is required for neuronal development, we perturbed the levels of endogenous PITP
by overexpression and by reduction of PITP
levels using siRNA. Overexpression of PITP
was achieved by nucleofection, which resulted in an approximately twofold increase in PITP
protein levels at day 2 (see Fig. S2 in the supplementary material). GFP alone localized throughout the neuron (Fig. 3A), whereas PITP
-GFP showed similar localization to endogenous PITP
with an enrichment in axonal processes (Fig. 3B; see Fig. S3A,B in the supplementary material). We assessed neuronal morphology at 2 days after nucleofection. Although neuronal polarization was not affected (see Fig. S4 in the supplementary material), overexpression of PITP
-GFP led to a significant increase in axonal, but not dendritic, length (Fig. 3C,E). PITP
can bind to either PtdIns or PtdCho and facilitate lipid transfer. PtdIns binding to PITP
is dependent on four amino acid residues that form specific hydrogen bonds with the hydroxyl groups on the inositol ring of PtdIns. Previously, we have shown that a PITP
-K61A mutant is unable to bind PtdIns and to facilitate its transfer, without affecting its ability to bind and transfer PtdCho (Tilley et al., 2004
-K61A-GFP in hippocampal neurons did not cause an increase in axonal length (Fig. 3E), demonstrating a dependency on PtdIns binding and transfer during PITP
-induced axonal elongation. In addition to PITP
, the related protein PITPβ is effective for PtdIns transfer (Allen-Baume et al., 2002
-GFP (Fig. 3D); however, the beta isoform did not cause an increase in axonal length (Fig. 3E).
|
We examined the requirement of PITP
to support neurite elongation under laminin-stimulated growth conditions, by interference of PITP
protein using specific siRNAs. Nucleofection of siRNAs targeting the transfer protein led to a strong suppression of approximately 70% at day 2 (Fig. 4A) and resulted in reduced axonal length without affecting neuronal polarization (Fig. 4B; see Fig. S4A in the supplementary material). By contrast, scrambled siRNAs did not affect PITP
protein levels or process elongation at any stage (Fig. 4A,B). The reduction in PITP
protein was also reflected in the staining profile using specific antibodies (Fig. 4C).
|
increases the extension of axonal processes in hippocampal neurons and that PITP
is necessary to support efficient axon growth without displaying noticeable effects on process formation and/or elongation per se. Therefore, we tested whether the effects of PITP
on axon growth can be linked to its established function in delivering PtdIns to membrane domains of specific phosphoinositide (PI)-dependent signalling necessary for axonal elongation. In this context, it has been shown that localized laminin stimulation at the neurite tips of hippocampal neurons induces localized activation of PI3K, which is followed by rapid process elongation (Menager et al., 2004
-GFP-expressing hippocampal neurons on a substrate consisting of poly-lysine only and determined axonal length as previously. As shown in Fig. 5A, axons are insensitive to PITP
-increased elongation in the absence of laminin. To test whether the effect on axonal elongation involves PI3K, we applied LY294002 to PITP
-GFP-overexpressing neurons at day 1 and incubated further to day 2. Under these culture conditions, PITP
-mediated increases in axonal extension were fully antagonized and indistinguishable from control, LY294002-treated neurons (Fig. 5A). Axonal extension in hippocampal neurons is also increased by application of growth factors, an effect that is thought to involve PI3K and its pivotal downstream target Akt, which has been shown to mediate axon elongation and morphological responses induced by neurotrophins in sensory neurons (Da Silva et al., 2005
is required during BDNF-induced axonal growth in hippocampal neurons. Application of BDNF to hippocampal neurons increased axonal length as previously described (Yoshimura et al., 2005
(Fig. 5B). These results indicate an essential requirement of PITP
during growth-factor-induced axon outgrowth. It is interesting to note that the BDNF effect on axonal branch formation in PITP
siRNA-treated neurons was not reduced (Yoshimura et al., 2005
|
Next, we examined whether overexpression or reduction of PITP
protein directly affects PI3K signalling by analysis of the phosphorylation state of Akt. Overexpression of PITP
-GFP in hippocampal neurons increased pAkt levels by approximately 50%, as confirmed by western blotting (Fig. 4C,D). We additionally examined the consequence of PITP
-GFP overexpression on Akt phosphorylation in hippocampal neurons by immunocytochemistry and found significant increases in relative fluorescence intensity of pAkt labelling in axonal growth cones (Fig. 5E,F,G), whereas overall growth cone morphologies were not affected by overexpression of PITP
-GFP (data not shown). In summary, these results suggest that PITP
is essential during axonal growth responses accelerated by laminin and BDNF through its ability to augment PI3K signalling.
PI3K activity has previously been shown to be required for accelerated growth responses in hippocampal neurons (Menager et al., 2004
; Shi et al., 2003
; Yoshimura et al., 2006
). Localized, PI3K/AKT-dependent signalling reduces GSK-3β activity towards microtubule-binding proteins including CRMP-2 and promotes axon outgrowth (see Fig. 6A) (Jiang et al., 2005
; Yoshimura et al., 2006
; Yoshimura et al., 2005
; Zhou et al., 2004
). To investigate the possibility of whether GSK-3β functions downstream of PITP
-induced axon outgrowth, we co-nucleofected Ha-tagged, constitutive active GSK-3β (GSK-3β S9A) with PITP
-GFP and determined axonal length as previously (Fig. 6B). PITP
-increased axonal growth was significantly reduced in the presence of GSK-3β S9A (Fig. 6C), suggesting that inhibition of GSK-3β is a crucial signalling component involved in mediating PITP
-induced axon growth. We employed a second strategy to elucidate the possible downstream signalling components involved during PITP
-induced axon growth. Hippocampal neuron cultures were established as previously and transfected using Lipofectamine (Shi et al., 2004
; Shi et al., 2003
). Comparable to the results obtained following nucleofection, overexpression of PITP
substantially increased axonal elongation by approximately 50%, which, again, was sensitive to PI3K inhibition (Fig. 6D). To directly determine the involvement of Akt during PITP
-stimulated axonal elongation, we co-transfected PITP
with dominant-negative Akt (Akt K179M). In the presence of Akt K179M, PITP
-increased axonal length was suppressed, and co-expression of CRMP-2 T514D, a mutant thought to mimic the GSK-3β-phosphorylated form of CRMP-2 (Yoshimura et al., 2005
), reduced PITP
-induced axonal growth similar to co-expression of GSK-3β S9A (Fig. 5D). These results demonstrate that PITP
regulates axonal outgrowth, at least partially by acting through the PI3K/Akt/GSK-3β/CRMP-2 pathway.
|
| Discussion |
|---|
|
|
|---|
and PITPβ protein isoforms is not available, although evidence has been presented for an enriched mRNA expression of both isoforms in the brain (Imai et al., 1997
protein in the nervous system at embryonic and adult stages. PITP
is present in developing neurons concomitant with the extension and guidance of neurites in the central and peripheral nervous systems (Fig. 1). It is generally of note that the expression in axonal tracts decreases to low levels in the adult, at which stage PITP
protein is enriched in dendritic and synaptic regions of the brain. This dynamic expression corroborated the distribution of PITP
we observed in hippocampal neurons cultured in vitro, where PITP
was present early in axons, at later stages in axons and dendrites, and in mature hippocampal neurons in pre-synaptic terminals.
Our results demonstrate that in early hippocampal neurons, PITP
is essential for axonal extension induced in a ligand-dependent manner. PITP
localizes predominantly to the axons of stage 3 hippocampal neurons and overexpression of PITP
increases axonal length, provided that neurons are cultured on laminin. Although increases in elongation of a neuronal process has been shown to lead to its specification into an axon (Bradke and Dotti, 2000
; Da Silva et al., 2005
; Esch et al., 1999
), changes in PITP
expression – either by overexpression or knockdown – never affected neuronal polarization. This is in contrast to a number of axon-specification molecules, which have been characterized by their ability to induce the formation of multiple axons upon overexpression and/or changes in their activity state (Inagaki et al., 2001
; Jiang et al., 2005
; Nishimura et al., 2004
; Schwamborn and Puschel, 2004
; Shi et al., 2004
; Shi et al., 2003
). The effect of PITP
on axonal elongation could be suppressed by PI3K inhibition, suggesting that PITP
might be an important component for PtdIns delivery to plasma membrane domains with increased activity of PI3K. This idea is supported by our observations that absence of PITP
renders neurons insensitive to BDNF, a growth factor known to stimulate axonal elongation in a PI3K-dependent manner (Ip et al., 1993
; Labelle and Leclerc, 2000
; Yoshimura et al., 2005
). Likewise, loss of PITP
reduces axonal elongation on laminin back to non-stimulated outgrowth, masking again an effect that involves PI3K signalling (Menager et al., 2004
). Thus, our data suggest that PITP
modulates the receptor-stimulated, PI3K-dependent component of axonal growth only, without affecting the basal machinery of polarization and of axonal development.
The mechanisms underlying the functional interaction between PITP
-mediated PtdIns transfer and PI3K signalling remains unclear. PI3K generates PIP3 from PIP2 and PITP
has indeed been shown to couple PtdIns delivery to the synthesis of PIP2 during cell signalling (Allen-Baume et al., 2002
; Cockcroft, 2001
). In addition, studies in fMLP-stimulated neutrophils suggest that the generation of PIP3 by PI3K activity requires PITP
(Kular et al., 1997
). However, PIP2 is unlikely to be rate-limiting for PI3K activity as it is present in excess. Following overexpression of PITP
we demonstrate increased pAkt levels in the growth cone (as a readout for PI3K activity), which indicates that PITP
has the capacity to function during signalling events upstream of PI3Ks. Conceivably, PITP
might be required as a co-factor of enzymatic activities that control membranous levels of PIP3. An alternative mechanism is that PITP
might interface delivery of vesicles essential during membrane expansion at the growth cone during axonal growth. In either model, PITP
binding to PtdIns is essential, as the K61A mutant is unable to support PITP
-induced increases in axonal elongation.
Downstream of PI3K, PITP
-mediated axonal outgrowth requires an intact Akt/GSK-3β/CRMP-2 pathway. Co-expression of PITP
with dominant-negative Akt, constitutive active GSK-3β or a CRMP-2 mutant that mimics the GSK-3β-phosphorylated form of CRMP-2, attenuated PITP
-induced axonal elongation. At first glance, it seems unlikely that a pathway known to mediate the establishment of neuronal polarization can be a component of the exclusive effect on axonal growth by PITP
. However, although activation of different components of this pathway have indeed been shown to induce the formation of multiple axons (Inagaki et al., 2001
; Jiang et al., 2005
; Yoshimura et al., 2006
; Yoshimura et al., 2005
), inhibition is not consistently linked with the reverse effect, i.e. neurons with no axons. In this respect, overexpression of dominant-negative Akt in hippocampal neurons has no effect on either axonal elongation or polarization (Yoshimura et al., 2006
), whereas overexpression of constitutively active GSK-3β disrupts elongation of axonal processes, with only 15% of neurons demonstrating defects in axon formation (Yoshimura et al., 2005
). In this context it is interesting to note that expression of constitutively active GSK-3β selectively antagonized PITP
-induced axonal growth, without affecting neuronal polarity (now shown here). This indicates that regulation of GSK-3β is a crucial requirement downstream of PITP
-induced axonal growth, but also that PITP
and/or increases in PI3K signalling lie downstream of GSK-3β-dependent changes in neuronal polarization.
Recently, PITP
was shown to be crucial during netrin-1-induced neurite outgrowth responses in cortical explants (Xie et al., 2005
). In this study it was demonstrated that the netrin receptors DCC and neogenin interact with PITP
in a ligand-dependent manner and increase both PITP
transfer activity and PIP2 hydrolysis. In addition, cortical explants obtained from mice in which PITP
levels are reduced by approximately 80% (the vibrator mice) show decreased extension of neurites in response to netrin-1 (Xie et al., 2005
). Similar to our results, there were no apparent differences between neurite elongation in wild-type and mutant explants under basal, non-stimulated outgrowth conditions, which is in line with the idea that PITP
participates during axonal growth in receptor-stimulated downstream signalling only.
In summary, our results demonstrate that PITP
contributes to the molecular machinery underlying axonal extension accelerated by PI3K and provides further evidence for the conserved nature of PITPs to control polarized membrane growth through regulation of PI-dependent signalling.
| Materials and Methods |
|---|
|
|
|---|
(target sequence: AATGCCTACCCTTACTGCAGA) or non-silencing scrambled control siRNA (target sequence: AATTCTCCGAACGTGTCACGT) (Qiagen) was added to neuron-nucleofector solution mixture. The neuron/DNA (siRNA) mixture was then nucleofected using program O-03 (Nucleofector, Amaxa Biosystems). For transfection by lipofection, cells were plated as previously described, and after 6 hours in culture the medium was replaced and cells left for 30 minutes to recover. The conditioned medium was kept and sterile filtered. The DNA/Lipofectamine mix was added to neuronal cultures and incubated for 30 minutes before being replaced into the conditioned media for continued incubation. The PITP
-GFP, PITPβ-GFP and PITP
K61A-GFP constructs were developed in the Cockcroft lab (Tilley et al., 2004
-GFP-expressing neurons using morphological criteria and Tau staining revealed no differences (74.7±1.78 as shown in supplementary material Fig. S4, compared to 76±2.69).
Immunostaining
Rabbit anti-PITP
polyclonal antibody and mouse anti-PITPβ monoclonal antibody were raised in-house and characterized using recombinant proteins for isoform specificity. Anti-synaptophysin antibody was obtained from ICN. Fluorophore-conjugated Phalloidin was from Molecular Probes. Anti-pAkt antibody was obtained from Cell Signalling Technologies, the anti-Tau antibody from Chemicon and the anti-βIII-tubulin antibody from Covance. Neuronal cultures were fixed with 4% paraformaldehyde and permeabilized for 10 minutes using 1% Triton X-100 in PBS. Cells were then blocked for 0.5 hours in blocking buffer (2% BSA, 0.5% Triton X-100 in PBS) and incubated with the primary antibody diluted in blocking buffer overnight at 4°C. After three washes in PBS, cultures were incubated with the appropriate secondary antibody diluted in blocking buffer for 1 hour at room temperature. For quantitative immunocytochemistry, axonal growth cones were selected at random from stage 3 hippocampal neurons stained with Phalloidin for F-actin. Growth cones were imaged at
60 on a Nikon inverted fluorescent microscope, taking care to avoid pixel saturation. The growth cone outline was traced using the actin image and superimposed on the fluorescent image. The fluorescence intensities of individual growth cones were measured digitally using SimplePCI software, yielding values of pixel intensity per unit area. The background fluorescence was measured by placing the outline of the growth cone in an adjacent area devoid of cellular material and subtracted from the growth cone values to give a background-corrected intensity value. For presentation of the data, the fluorescence intensity values were normalized to the respective control experiments that were performed in parallel. For paraffin wax sectioning, paraformaldehyde-fixed mouse tissue was embedded in wax, cut into 6 µm sections and processed as described by Bancroft and Stevens (Bancroft and Stevens, 1996
).
Western blot analysis
Neuronal cultures in each treatment or rat tissue were lysed in cold 1% NP-40 and the lysate was pelleted and the soluble extract was used for western blot analysis. Equal amounts of proteins from neuronal extracts were separated on 10% polyacrylamide gels and proteins were transferred to nitrocellulose or PVDF membranes. These were blocked for 1 hour in 5% milk/TBST and incubated with primary antibody in blocking buffer for 3 hours. The primary antibodies used were: anti-PITP
, anti-pAkt (Ser 473) (Cell Signalling Technologies), anti-Akt (Cell Signalling Technologies), anti-pGSK-3β (Ser 9) (Cell Signalling Technologies), anti-GSK-3β (Transduction Laboratories), anti-GFP (Molecular Probes), anti-Ha (Roche) and anti-β-actin (Chemicon). After three washes with TBST, the blots were probed with HRP-conjugated secondary antibody (Vector Labs) in blocking buffer for 1 hour. Membranes were then developed using an ECL Advance system (Amersham Pharmacia). In order to quantify protein phosphorylation levels, band density was analysed using Phoretix software and normalized to total protein levels or actin loading control.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Adler, C. E., Fetter, R. D. and Bargmann, C. I. (2006). UNC-6/Netrin induces neuronal asymmetry and defines the site of axon formation. Nat. Neurosci. 9, 511-518.[CrossRef][Medline]
Alb, J. G., Jr, Cortese, J. D., Phillips, S. E., Albin, R. L., Nagy, T. R., Hamilton, B. A. and Bankaitis, V. A. (2003). Mice lacking phosphatidylinositol transfer protein-alpha exhibit spinocerebellar degeneration, intestinal and hepatic steatosis, and hypoglycemia. J. Biol. Chem. 278, 33501-33518.
Alb, J. G., Jr, Phillips, S. E., Wilfley, L. R., Philpot, B. D. and Bankaitis, V. A. (2007). The pathologies associated with functional titration of phosphatidylinositol transfer protein {alpha} activity in mice. J. Lipid Res. 48, 1857-1872.
Allen-Baume, V., Segui, B. and Cockcroft, S. (2002). Current thoughts on the phosphatidylinositol transfer protein family. FEBS Lett. 531, 74-80.[CrossRef][Medline]
Arimura, N. and Kaibuchi, K. (2007). Neuronal polarity: from extracellular signals to intracellular mechanisms. Nat. Rev. Neurosci. 8, 194-205.[CrossRef][Medline]
Bancroft, J. and Stevens, A. (1996). Theory and Practice of Histological Techniques. London: Churchill Livingstone, Harcourt.
Bradke, F. and Dotti, C. G. (2000). Differentiated neurons retain the capacity to generate axons from dendrites. Curr. Biol. 10, 1467-1470.[CrossRef][Medline]
Chadborn, N. H., Ahmed, A. I., Holt, M. R., Prinjha, R., Dunn, G. A., Jones, G. E. and Eickholt, B. J. (2006). PTEN couples Sema3A signalling to growth cone collapse. J. Cell Sci. 119, 951-957.
Chang, C., Adler, C. E., Krause, M., Clark, S. G., Gertler, F. B., Tessier-Lavigne, M. and Bargmann, C. I. (2006). MIG-10/lamellipodin and AGE-1/PI3K promote axon guidance and outgrowth in response to slit and netrin. Curr. Biol. 16, 854-862.[CrossRef][Medline]
Cockcroft, S. (1998). Phosphatidylinositol transfer proteins: a requirement in signal transduction and vesicle traffic. BioEssays 20, 423-432.[CrossRef][Medline]
Cockcroft, S. (2001). Phosphatidylinositol transfer proteins couple lipid transport to phosphoinositide synthesis. Semin. Cell Dev. Biol. 12, 183-191.[CrossRef][Medline]
Cosker, K. E. and Eickholt, B. J. (2007). Phosphoinositide 3-kinase signalling events controlling axonal morphogenesis. Biochem. Soc. Trans. 35, 207-210.[CrossRef][Medline]
Da Silva, J. S., Hasegawa, T., Miyagi, T., Dotti, C. G. and Abad-Rodriguez, J. (2005). Asymmetric membrane ganglioside sialidase activity specifies axonal fate. Nat. Neurosci. 8, 606-615.[CrossRef][Medline]
Dotti, C. G., Sullivan, C. A. and Banker, G. A. (1988). The establishment of polarity by hippocampal neurons in culture. J. Neurosci. 8, 1454-1468.[Abstract]
Eickholt, B. J., Walsh, F. S. and Doherty, P. (2002). An inactive pool of GSK-3 at the leading edge of growth cones is implicated in Semaphorin 3A signaling. J. Cell Biol. 157, 211-217.
Esch, T., Lemmon, V. and Banker, G. (1999). Local presentation of substrate molecules directs axon specification by cultured hippocampal neurons. J. Neurosci. 19, 6417-6426.
Hamilton, B. A., Smith, D. J., Mueller, K. L., Kerrebrock, A. W., Bronson, R. T., van Berkel, V., Daly, M. J., Kruglyak, L., Reeve, M. P., Nemhauser, J. L. et al. (1997). The vibrator mutation causes neurodegeneration via reduced expression of PITP alpha: positional complementation cloning and extragenic suppression. Neuron 18, 711-722.[CrossRef][Medline]
Imai, H., Tanaka, S., Fukusato, T., Yamashita, S. and Hosaka, K. (1997). Differential distribution of mRNAs encoding phosphatidylinositol transfer proteins alpha and beta in the central nervous system of the rat. Brain Res. Mol. Brain Res. 46, 256-264.[CrossRef][Medline]
Inagaki, N., Chihara, K., Arimura, N., Menager, C., Kawano, Y., Matsuo, N., Nishimura, T., Amano, M. and Kaibuchi, K. (2001). CRMP-2 induces axons in cultured hippocampal neurons. Nat. Neurosci. 4, 781-782.[CrossRef][Medline]
Ip, N. Y., Li, Y., Yancopoulos, G. D. and Lindsay, R. M. (1993). Cultured hippocampal neurons show responses to BDNF, NT-3, and NT-4, but not NGF. J. Neurosci. 13, 3394-3405.[Abstract]
Jiang, H., Guo, W., Liang, X. and Rao, Y. (2005). Both the establishment and the maintenance of neuronal polarity require active mechanisms: critical roles of GSK-3beta and its upstream regulators. Cell 120, 123-135.[Medline]
Kular, G., Loubtchenkov, M., Swigart, P., Whatmore, J., Ball, A., Cockcroft, S. and Wetzker, R. (1997). Co-operation of phosphatidylinositol transfer protein with phosphoinositide 3-kinase gamma in the formylmethionyl-leucylphenylalanine-dependent production of phosphatidylinositol 3,4,5-trisphosphate in human neutrophils. Biochem. J. 325, 299-301.[Medline]
Labelle, C. and Leclerc, N. (2000). Exogenous BDNF, NT-3 and NT-4 differentially regulate neurite outgrowth in cultured hippocampal neurons. Brain Res. Dev. Brain Res. 123, 1-11.[CrossRef][Medline]
Markus, A., Zhong, J. and Snider, W. D. (2002). Raf and akt mediate distinct aspects of sensory axon growth. Neuron 35, 65-76.[CrossRef][Medline]
Menager, C., Arimura, N., Fukata, Y. and Kaibuchi, K. (2004). PIP3 is involved in neuronal polarization and axon formation. J. Neurochem. 89, 109-118.[CrossRef][Medline]
Ming, G., Song, H., Berninger, B., Inagaki, N., Tessier-Lavigne, M. and Poo, M. (1999). Phospholipase C-gamma and phosphoinositide 3-kinase mediate cytoplasmic signaling in nerve growth cone guidance. Neuron 23, 139-148.[CrossRef][Medline]
Nishimura, T., Kato, K., Yamaguchi, T., Fukata, Y., Ohno, S. and Kaibuchi, K. (2004). Role of the PAR-3-KIF3 complex in the establishment of neuronal polarity. Nat. Cell Biol. 6, 328-334.[CrossRef][Medline]
Schwamborn, J. C. and Puschel, A. W. (2004). The sequential activity of the GTPases Rap1B and Cdc42 determines neuronal polarity. Nat. Neurosci. 7, 923-929.[CrossRef][Medline]
Shi, S. H., Jan, L. Y. and Jan, Y. N. (2003). Hippocampal neuronal polarity specified by spatially localized mPar3/mPar6 and PI 3-kinase activity. Cell 112, 63-75.[CrossRef][Medline]
Shi, S. H., Cheng, T., Jan, L. Y. and Jan, Y. N. (2004). APC and GSK-3beta are involved in mPar3 targeting to the nascent axon and establishment of neuronal polarity. Curr. Biol. 14, 2025-2032.[CrossRef][Medline]
Thomas, G. M., Cunningham, E., Fensome, A., Ball, A., Totty, N. F., Truong, O., Hsuan, J. J. and Cockcroft, S. (1993). An essential role for phosphatidylinositol transfer protein in phospholipase C-mediated inositol lipid signaling. Cell 74, 919-928.[CrossRef][Medline]
Tilley, S. J., Skippen, A., Murray-Rust, J., Swigart, P. M., Stewart, A., Morgan, C. P., Cockcroft, S. and McDonald, N. Q. (2004). Structure-function analysis of human [corrected] phosphatidylinositol transfer protein alpha bound to phosphatidylinositol. Structure 12, 317-326.[Medline]
Utsunomiya, A., Owada, Y., Yoshimoto, T. and Kondo, H. (1997). Localization of gene expression for phosphatidylinositol transfer protein in the brain of developing and mature rats. Brain Res. Mol. Brain Res. 45, 349-352.[CrossRef][Medline]
Wirtz, K. W. (1991). Phospholipid transfer proteins. Annu. Rev. Biochem. 60, 73-99.[CrossRef][Medline]
Xie, Y., Ding, Y. Q., Hong, Y., Feng, Z., Navarre, S., Xi, C. X., Zhu, X. J., Wang, C. L., Ackerman, S. L., Kozlowski, D. et al. (2005). Phosphatidylinositol transfer protein-alpha in netrin-1-induced PLC signalling and neurite outgrowth. Nat. Cell Biol. 7, 1124-1132.[CrossRef][Medline]
Xie, Y., Hong, Y., Ma, X. Y., Ren, X. R., Ackerman, S., Mei, L. and Xiong, W. C. (2006). DCC-dependent phospholipase C signaling in netrin-1-induced neurite elongation. J. Biol. Chem. 281, 2605-2611.
Yoder, M. D., Thomas, L. M., Tremblay, J. M., Oliver, R. L., Yarbrough, L. R. and Helmkamp, G. M., Jr (2001). Structure of a multifunctional protein. Mammalian phosphatidylinositol transfer protein complexed with phosphatidylcholine. J. Biol. Chem. 276, 9246-9252.
Yoshimura, T., Kawano, Y., Arimura, N., Kawabata, S., Kikuchi, A. and Kaibuchi, K. (2005). GSK-3beta regulates phosphorylation of CRMP-2 and neuronal polarity. Cell 120, 137-149.[CrossRef][Medline]
Yoshimura, T., Arimura, N. and Kaibuchi, K. (2006). Signaling networks in neuronal polarization. J. Neurosci. 26, 10626-10630.
Zhou, F. Q., Zhou, J., Dedhar, S., Wu, Y. H. and Snider, W. D. (2004). NGF-induced axon growth is mediated by localized inactivation of GSK-3beta and functions of the microtubule plus end binding protein APC. Neuron 42, 897-912.[CrossRef][Medline]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||