|
|
![]() |
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 26 February 2008
doi: 10.1242/jcs.021584
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
1 Cell cycle control laboratory, ISREC, 1066 Epalinges, Switzerland
2 Faculty of Life Sciences, Ecole Polytechnique Fédérale de Lausanne, Switzerland
3 Department of Chemistry, University of Wisconsin-Oshkosh, 800 Algoma Boulevard, Oshkosh, WI 54901, USA
* Author for correspondence (e-mail: viesturs.simanis{at}epfl.ch)
Accepted 24 December 2007
| Summary |
|---|
|
|
|---|
Key words: Chemical genetics, Cell cycle, cdc2, Cytokinesis, Yeast
| Introduction |
|---|
|
|
|---|
Cdc2p activity is regulated by association with cyclins and by phosphorylation (Gould, 2004
). Cdc2p is phosphorylated on Thr167 (Gould et al., 1991
) by CDK-activating kinase (Hermand et al., 1998
; Lee et al., 1999
), which promotes association of Cdc2p with the cyclin regulatory subunits, Cdc13p, Cig1p, Cig2p and Puc1p, during vegetative growth. Assembly of the Cdc2p-cyclin complexes is also facilitated by chaperones (Munoz and Jimenez, 1999
; Turnbull et al., 2006
). The cyclin Cig2p promotes S phase (Fisher and Nurse, 1996
; Martin-Castellanos and Moreno, 1996
; Mondesert et al., 1996
), and Puc1p is thought to participate in the G1 size control (Martin-Castellanos et al., 2000
). The B-type cyclin Cdc13p (Booher and Beach, 1988
; Hagan et al., 1988
) is the sole fission yeast cyclin able to promote G2-M transition and can also initiate S-phase (Fisher and Nurse, 1995
; Fisher and Nurse, 1996
). Cdc2p is also phosphorylated on Tyr15 (Gould and Nurse, 1989
) by wee1p (Russell and Nurse, 1987
), which inhibits the Cdc2p-Cdc13p complex during interphase. Mitosis is initiated through dephosphorylation of Tyr15 by the phosphoprotein phosphatase Cdc25p (Russell and Nurse, 1986
). Active Cdc2p-Cdc13p is localised in the nucleus, and also associates with the spindle and spindle poles during mitosis (Alfa et al., 1989
; Alfa et al., 1990
; Decottignies et al., 2001
; Yanagida et al., 1999
).
The use of thermosensitive mutants to study the roles of Cdc2p in the cell cycle is subject to several limitations. The temperature change provokes a heat-shock stress response; thermosensitive mutant alleles may not be inactivated rapidly, complicating the interpretation of experiments conducted over a short time interval. Finally, the range of permissive temperatures of the available collection of thermosensitive mutants may not permit certain processes to be examined. We have therefore used a chemical genetics strategy (Bishop et al., 2000
) to study Cdc2p function, in particular its role as a regulator of SIN proteins, which regulate cytokinesis.
The S. pombe SIN is a signal transduction network that regulates the initiation of septum formation (reviewed by Krapp et al., 2004
; Wolfe and Gould, 2005
). The core of the signalling module comprises three protein kinases and their associated subunits: Cdc7p-Spg1p (Fankhauser and Simanis, 1994
; Schmidt et al., 1997
; Sohrmann et al., 1998
), Sid1p-Cdc14p (Fankhauser and Simanis, 1993
; Guertin et al., 2000
) and Sid2p-Mob1p (Hou et al., 2000
; Salimova et al., 2000
; Sparks et al., 1999
). The SIN is activated by the polo-like kinase Plo1p (Tanaka et al., 2001
), which regulates many aspects of mitosis in addition to cytokinesis. These proteins associate with the spindle pole body (SPB), where they bind to a scaffold comprised of the coiled-coil proteins Cdc11p (Krapp et al., 2001
; Tomlin et al., 2002
), Sid4p (Chang and Gould, 2000
) and Ppc89p (Rosenberg et al., 2006
). Signalling through the pathway is mediated by the nucleotide status of the GTPase Spg1p, which is regulated by the GTPase-activating protein (GAP) Byr4p-Cdc16p (Fankhauser and Simanis, 1993
; Furge et al., 1998
; Song et al., 1996
). The core kinases only associate with the SPB during mitosis (reviewed by Simanis, 2003
). Cdc7p binds to Spg1p-GTP on the SPBs from mitotic entry (Sohrmann et al., 1998
), and becomes asymmetrical after the anaphase A-B transition, localising only to the new SPB (Grallert et al., 2004
). By contrast, Sid1p and Cdc14p associate only with the new SPB and only after the onset of anaphase B (Guertin et al., 2000
). Sid2p and Mob1p are located on both spindle poles throughout mitosis, and also associate with the medially placed contractile ring just prior to septum formation (Hou et al., 2000
; Salimova et al., 2000
; Sparks et al., 1999
). Arresting cells in early mitosis using a β-tubulin mutant prevents Sid1p binding to the SPB (Guertin et al., 2000
) and Sid2p-Mob1p localisation to the contractile ring (Hou et al., 2000
; Salimova et al., 2000
; Sparks et al., 1999
). It is not clear whether the anaphase-specific localisation of SIN proteins is regulated by the anaphase-promoting complex (APC/C), inactivation of mitotic CDK, or both (Chang et al., 2001
).
The data presented here indicate that inactivation of Cdc2p using an inhibitory ATP analogue is sufficient to promote (1) association of Sid1p with one SPB in early mitotic cells, (2) the transition from a symmetrical to an asymmetrical distribution of Cdc7p on the SPBs, and (3) recruitment of Mob1p to the contractile ring, thereby creating what is presumed to be the active configuration of the SIN. Consistent with this, the enzyme Bgs1p, which is required for synthesis of the division septum, is also recruited to the contractile ring, and cells form a division septum without completing mitosis. Thus, we conclude that inactivation of Cdc2p in mitotic cells is sufficient to activate the SIN and promote septum formation.
| Results |
|---|
|
|
|---|
A range of analogue concentrations was added to exponentially growing cdc2-as and cdc2+ cells; cell number was determined, and fixed cells were examined after staining with DAPI and Calcofluor. Analogue concentrations up to 15 µM, or an equivalent volume of its solvent DMSO, had no effect upon the division of wild-type cells (Fig. 1A and not shown). Addition of analogue to 1 µM blocked the division of cdc2-as cells at 25°C within one cell cycle (Fig. 1A). Determination of the execution point from the residual cell number increase after addition of analogue yielded a value of 0.7, consistent with those determined for cdc2 alleles previously (Nasmyth and Nurse, 1981
; Nurse et al., 1976
). Examination of fixed, DAPI-Calcofluor stained cdc2-as cells showed that they became elongated and contained a single nucleus upon treatment with 1 µM analogue (Fig. 1B); no effect was observed in a cdc2+ control. FACS analysis showed that cells arrested with a 2C DNA content (Fig. 1C). As described previously, the FACS profile shifts to the right as cells elongate, owing to an increase in mitochondrial DNA content (Sazer and Sherwood, 1990
).
|
To confirm that the cells were arrested in G2, we stained them with Rhodamine-conjugated phalloidin. This revealed the presence of F-actin patches at both tips of the cell (98% two-end staining, 2% one-end staining and no medial rings; 3.5h after adding analogue), indicating a post-NETO G2 arrest (Fig. 1D). Taken together, these data indicate that cdc2-as arrests predominantly in G2 in the presence of 1 µM analogue.
|
Re-replication of the genome induced by a variety of treatments requires the cyclins Cig1p and Cig2p (Connolly and Beach, 1994
; Snaith and Forsburg, 1999
). Therefore, we treated the triple mutant cdc2-as cig1
cig2
with the analogue. Like the cdc2-as cells, the triple mutant arrested in G2 when treated with 1 µM analogue (Fig. 2B), and in both G1 and G2 when treated with 10 µM analogue. The gradual shift caused by cell elongation is still seen, as in Fig. 1C and Fig. 2A. However, in contrast to Fig. 2A, no increase in ploidy was observed at later time points, indicating that the re-replication requires Cig1p and Cig2p (Fig. 2B).
We also noted a significant tendency for the cdc2-as mutant to become diploid in the stationary phase (Table 1), because 44% of cdc2-as cells were diploid after three days in stationary phase. This suggests that cdc2-as cells may be less competent than cdc2+ in making an orderly exit from the cell cycle into stationary phase even in the absence of analogue.
|
To test whether the kinase activity of Cdc2p was inhibited by the analogue, a kinase assay was performed on protein extracts from either cdc2-as or cdc2+ cells. Addition of analogue at either 1 µM or 10 µM inhibited the kinase activity in cdc2-as extracts, but not cdc2+ extracts (Fig. 2C), consistent with the lack of effect of the analogue on cdc2+ cells in vivo (see above).
In summary, we have constructed a cdc2-as mutant that is specifically inhibited by an ATP analogue. In vitro, addition of analogue inhibits Cdc2p activity, whereas in vivo, cdc2-as cells arrest either in G2, or at both major commitment points in the cell cycle, depending upon the concentration of analogue.
Effects of cdc2-as upon meiosis
Since previous studies had demonstrated that some cdc2 mutants block progression through meiosis II, producing dyads, rather than tetrads (Hayles et al., 1986
; Nakaseko et al., 1984
), we examined whether the cdc2-as mutant had any effects upon meiosis. Crosses between cdc2-as h+ and h– were performed in the absence of analogue at 25°C. After two days, the majority of spore-containing cells (65%) were dyads and only 2% of zygotes in which spores were seen gave rise to tetrads (Fig. 3A). Other phenotypes were also observed, including spores that contained no DAPI-stained material, and nuclei that had failed to become encapsulated into spores (Fig. 3A); the variety of phenotypes probably reflects multiple roles for Cdc2p in meiosis. Control crosses between cdc2+ strains produced >99% tetrads (not shown). To investigate which meiotic division had failed in the dyads, crosses were performed using the centromere-linked lys1-131 mutant in one of the mating partners, followed by dissection of dyads; 94% of dyads in cdc2-as crosses showed a 1:1 lys+:lys– phenotype. This was similar to the result obtained in a similar cross using cdc2-N22 (Nakaseko et al., 1984
), where 96% of dyads showed a 1:1 lys+:lys– phenotype. We conclude that the compromised activity of cdc2-as interferes mainly with meiosis II.
|
Studies in budding yeast have shown that increased expression of mitotic cyclins can rescue heat-sensitive mutants of Cdc28p (Surana et al., 1991
). Therefore, we tested whether the introduction of a plasmid containing a genomic clone of the mitotic cyclin cdc13, expressed from its own promoter, could rescue the thermosensitivity and analogue sensitivity of cdc2-as. We observed that the heat sensitivity of cdc2-as was rescued by cdc13 (Fig. 3C). Treatment of cdc2-as cells expressing cdc13 with 1 µM analogue at 25°C no longer resulted in a cell cycle arrest (Fig. 3D). However, addition of analogue to 10 µM arrested cells both in G1 and G2 (Fig. 3D).
Genetic analysis revealed that the cdc13-117 cdc2-as mutant was inviable at any temperature; the double mutants germinated and died as elongated cells, mostly without dividing (data not shown). This was also true for the tagged cdc13-myc13 allele (Cueille et al., 2001
). Taken together with the synthetic-lethal interaction between cdc13-117 and cdc2-as, these results are consistent with the view that the interaction of Cdc2p with Cdc13p may be compromised in the cdc2-as mutant.
|
Analogue-induced cell cycle arrest is reversible
To test whether treatment with the analogue was reversible, cdc2-as cells were incubated in medium containing 1 µM analogue for 3.5 hours at 25°C, which corresponds to just over one cell cycle. Cells were then washed to remove the analogue, and resuspended in fresh medium. Samples were fixed and stained with DAPI, Calcofluor and Rhodamine-conjugated phalloidin to follow mitotic progression. The results, shown in Fig. 4A,B, indicate that the arrest is reversible and produces a highly synchronous progression through mitosis, comparable with that obtained by cdc25-22 arrest-release (Moreno et al., 1989
). Analogue-induced arrest release therefore provides a method to synchronise cells without the stress of a thermal shock.
Does Cdc2p inhibit the SIN in early mitosis?
SIN proteins display a major change in their localisation that is associated with the anaphase A-B transition. For example, arrest-release experiments using nda3-KM311 have shown that the SIN regulator Sid1p associates with the SPB only when Cdc13p is no longer detectable and Cdc2p kinase has been inactivated (Guertin et al., 2000
). To test whether inactivation of cdc2-as in mitotically arrested cells would promote recruitment of Sid1p to the SPB, GFP-Sid1p cdc2-as cells were transformed with a plasmid expressing mad2, which delays anaphase onset and CDK inactivation by interfering with APC/C function (He et al., 1997
). This allowed us to investigate the effect of inactivating Cdc2p in cells where APC/C activity is reduced without the stress of a temperature shift; note that the delay in entry into mitosis of the nda3-KM311 cdc2-as mutant precludes its use for generating a mitotically arrested population of cells. The mad2 overexpression-induced cell cycle arrest is leaky, therefore cells were synchronised by centrifugal elutriation after induction, to maximise the number of cells in early mitosis (see Materials and Methods). As cells entered mitosis, a sample was removed from the culture and fixed, and then either analogue or DMSO was added to half the remaining culture. After 10 minutes, cells were fixed and the samples were stained with antibodies to
-tubulin and GFP. Since the arrest is leaky, a range of spindle lengths was observed. Before addition of analogue, no association of GFP-Sid1p with spindles
3 µm was observed, and only 5% of 4 µm spindles had GFP-Sid1p on one SPB (Fig. 5A,D,E). By contrast, almost all spindles longer than 6 µm had GFP-Sid1p associated with one SPB (Fig. 5A,D,E). At 10 minutes, the DMSO control showed a similar distribution of GFP-Sid1p (Fig. 5B,D,E). This is consistent with the expectation that GFP-Sid1p only associates with the SPB after the anaphase A-B transition. By contrast, the culture treated with analogue for 10 minutes had GFP-Sid1p associated with more than 80% of spindles that were
3 µm long and 96% of spindles of 3-5 µm length (Fig. 5C,D,E). The distribution of spindle lengths was similar before and after addition of the analogue (data not shown). We therefore conclude that inactivation of Cdc2p-as is sufficient to promote GFP-Sid1p recruitment to the SPB in a cell that has entered mitosis.
|
3 µm had Cdc7p-GFP associated with both SPBs, compared with 75% in the solvent control (Table 2). We also examined Mob1p-GFP, which associates with the medial ring just prior to its contraction, and with the SPBs throughout mitosis. We found that inactivation of Cdc2p-as promoted association of Mob1p-GFP with the medial ring in 80% of cells with short spindles (Table 2; Fig. 6A), compared with 22% in the control. Moreover, we observed that in the cells where Mob1p-GFP associated with the medial ring after addition of analogue, 25% of the Mob1p-GFP signals were split into a double ring, which is usually seen only during septation (Hou et al., 2000
|
|
Next, we investigated whether the APC/CCdc20p substrates Cdc13p and Cut2p were affected by addition of analogue. First, cdc2-as cdc13-GFP overexpressing mad2 was arrested in mitosis, and analogue was added to 1 µM. Indirect immunofluorescence revealed that Cdc13p-GFP was present in the nuclei of analogue-treated cells, indicating that the altered localisation of SIN proteins did not result from degradation of Cdc13p (Fig. 6B). To analyse the behaviour of Cut2p, we used the strain cdc2-as cut2-GFP overexpressing mad2. Technical reasons prevented us from generating cultures of well-synchronised cells (see Materials and Methods), so this strain was examined after induction of mad2 for 22 hours at 25°C, without elutriation. Live cells were examined after the addition of analogue to 1 µM, or DMSO as control. Cut2p-GFP showed strong staining of the early mitotic spindle in living cells (Kumada et al., 1998
). A sample examined just before treatment with analogue revealed that 13% of cells displayed a short spindle strongly stained with Cut2p-GFP (n>500 cells). This percentage did not change significantly 10 minutes after the addition of analogue (13%) or DMSO (12%). Staining of fixed cells with antibody to
-tubulin revealed that the percentage of cells with short spindles (
4 µm) in the population was similar to the number of cells showing spindle-associated Cut2p-GFP. Thus, inactivation of Cdc2p does not promote degradation of Cut2p-GFP in cells overexpressing mad2.
We conclude that inactivation of Cdc2p-as by treatment with 1 µM analogue early in mitosis promotes the configuration of SIN proteins that is seen in late mitosis, which is presumed to correlate with activation of the SIN, the initiation of ring contraction and the onset of septum formation.
The protein kinase Plo1p associates with both SPBs early in mitosis, and the signal then diminishes during anaphase B (Mulvihill et al., 1999
); we observed that only 7% of cells with spindles
3 µm displayed Plo1p-GFP at the SPBs after inactivation of Cdc2p-as, compared with 82% in the solvent control (Table 2). Previous studies have shown that in fission yeast, Plo1p localisation to the SPB at G2-M does not occur in a cdc2 mutant (Mulvihill et al., 1999
). Our data indicate that CDK activity is also required to maintain Plo1p at the SPB during mitosis.
One of the final steps in assembly of the division apparatus is association of the β-(1,3) glucan synthase Bgs1p with the medial ring. This is essential for formation of the division septum, and does not occur until late anaphase (Cortes et al., 2007
; Liu, J. et al., 1999
). Moreover, its localisation depends upon an active SIN (Liu et al., 2002
). Examination of the localisation of Bgs1p revealed that a Bgs1p-GFP ring was present in 78% of cells with spindles
3 µm, compared with 22% in the control (Table 2). Thus, in addition to an active configuration of the SIN, late proteins that are needed for septum synthesis are also recruited to the contractile ring in response to inactivation of Cdc2p. Consistent with this, examination of cells at 20 minutes after addition of analogue showed that 18% of cells had formed a septum, yet they still contained condensed chromosomes in close proximity to the septum, indicating that septation had occurred without completion of mitosis (Fig. 6C). Examination of the solvent control revealed <0.05% of cells with this phenotype. The uncoupling of septum formation from chromosome separation indicates that, not only is the SIN in the active configuration, but also that the cytokinesis machinery has been activated. In other words, inactivation of Cdc2p is sufficient to induce cytokinesis even in the absence of chromatid separation.
Does Flp1p play a role in regulating the localisation of SIN proteins?
CDC14 family phosphoprotein phosphatases have been implicated in mitotic exit, in part by reversal of CDK-mediated phosphorylation earlier in mitosis (Bardin and Amon, 2001
; Seshan and Amon, 2004
; Stegmeier and Amon, 2004
; Trautmann and McCollum, 2002
). The S. pombe member of this protein family is called Flp1p/Clp1p (referred to hereafter as Flp1p). It is not essential, but is required for the function of the cytokinesis checkpoint (Cueille et al., 2001
; Mishra et al., 2004
; Trautmann and McCollum, 2005
; Trautmann et al., 2001
), SIN signalling (Cueille et al., 2001
; Trautmann et al., 2001
), timely elimination of the mitotic inducer Cdc25p (Esteban et al., 2004
; Wolfe and Gould, 2004
) and chromosome segregation (Trautmann et al., 2004
). To determine whether Flp1p was required for the transition of the SIN from the early to late mitotic configuration after inactivation of Cdc2p, we examined the localisation of Cdc7p-GFP and Plo1p-GFP after inactivation of cdc2-as in a flp1 null background. We observed that a significantly higher number of cells retained Cdc7p-GFP on both SPBs (36% of
3 µm spindles, compared with 12% in the flp1+ control; Table 2). This trend was also shown by Plo1p-GFP, which was associated with 28% of SPBs spindle
3 µm, compared with only 7% in the control; Table 2). Thus, we conclude that Flp1p plays a role in promoting the transition of the SIN to the late-anaphase configuration.
| Discussion |
|---|
|
|
|---|
Treatment of cdc2-as cells with 10 µM analogue initially causes a G1-G2 mixed arrest, followed by an increase in DNA content and ploidy. This is reminiscent of the consequences of eliminating Cdc13p from the cell, which allows re-replication of DNA without an intervening mitosis (Broek et al., 1991
; Fisher and Nurse, 1996
). The fact that 1 µM analogue produces a predominantly G2 arrest without an increase in ploidy suggests that at 10 µM the analogue may inhibit Cdc2p-Cdc13p in vivo to a sufficiently great extent that whatever activity remains is no longer sufficient to prevent resetting of origins of replication (Wuarin et al., 2002
). The finding that deletion of cig1 and cig2 prevents re-replication suggests that either Cdc2p-Cig2p, which promotes S-phase, is less sensitive to inhibition by the analogue than Cdc2p-Cdc13p, or that the residual kinase activity of Cdc2p is sufficient to promote S-phase after a delay.
Results in a variety of systems suggest that inactivation of CDK1 (Cdc2p) is sufficient to induce the transition from mitosis to G1 phase (reviewed by Paulson, 2007
). For example, inactivation of Cdc28p in S. cerevisiae arrested by expression of a non-degradable CLB2 promotes mitotic exit and cytokinesis (Ghiara et al., 1991
). Inactivation of CDK1 is also required for localisation of the vesicle fusion machinery to the bud neck during mitotic exit and cytokinesis (VerPlank and Li, 2005
). In S. pombe, increased expression of nondegradable Cdc13p blocks septation (Yamano et al., 1996
) and inactivation of Cdc2p – using a thermosensitive mutant in cells arrested prior to the metaphase-anaphase transition – promotes mitotic exit and septum formation (He et al., 1997
). Studies of cultured vertebrate cells have shown that when nocodazole-arrested mouse FT210 cells, which carry a temperature-sensitive mutation in CDK1, are shifted to their nonpermissive temperature, they exit mitosis (without chromatid segregation or cytokinesis) and are capable of completing another cell cycle (Paulson, 2007
). Furthermore, treatment of mitotically arrested cells with CDK1 inhibitors will induce mitotic exit and cytokinesis. Formation of the cleavage furrow upon CDK1 inhibition occurs even if cells are treated with proteasome inhibitors or express nondegradable cyclin B (Potapova et al., 2006
; Skoufias et al., 2007
). Together, these data from a variety of model systems – ranging from yeast to vertebrate cells – point to a universal requirement for inactivation of CDK1 to promote cytokinesis.
The results presented here demonstrate that inactivation of fission yeast Cdc2p in early mitotic cells by addition of analogue is sufficient to bring about the transition of the SIN, which regulates the onset of septum formation from its early mitotic configuration to that normally found after the anaphase A-B transition. Moreover, proteins such as the β-(1,3) glucan synthase Bgs1p, whose association with the contractile ring depends upon SIN activation, are also recruited, strongly suggesting that the SIN proteins do not simply localise asymmetrically to the SPBs and the contractile ring, but are also activated. Consistently with this, we observed that 20 minutes after addition of analogue, many cells had formed a septum bisecting the unsegregated, condensed chromosomes.
Mitotic exit involves, in part, reversal of CDK-dependent mitotic phosphorylation events. Cdc14 family phosphoprotein phosphatases have been implicated in this process, particularly in budding yeast. Our data suggest that Flp1p, the S. pombe orthologue of S. cerevisiae Cdc14p, plays a role in regulating relocalisation of SIN proteins following inactivation of Cdc2p. Since flp1 is not an essential gene, it is likely that Flp1p co-operates with one or more phosphatases to regulate the SIN. Potential candidates for this would be PP2A-Par1/Pab1, which has been implicated in regulation of the SIN (Jiang and Hallberg, 2000
; Jiang and Hallberg, 2001
; Le Goff et al., 2001
), or the functionally redundant type1 phosphatases Dis2p and Sds21p (Kinoshita et al., 1990
; Ohkura and Yanagida, 1991
). Future studies will investigate the role played by these phosphatases in regulating the localisation of SIN proteins after inactivation of Cdc2p. Another possibility which we have considered is that APC/C-dependent protein ubiquitylation and degradation brings about the relocalisation of SIN proteins we have studied in this paper. However, since APC function is reduced in cells arrested by mad2 overexpression, and Cdc13p-GFP and Cut2p-GFP are still present in cdc2-as cells treated with analogue, we favour the explanation outlined above. The relevant substrate(s) phosphorylated by Cdc2p to prevent activation of the SIN in early mitosis are unknown. By analogy with S. cerevisiae, Cdc7p, the orthologue of Cdc15p (Jaspersen and Morgan, 2000
) and Byr4p, the orthologue of Bfa1p (Hu et al., 2001
; Pereira et al., 2002
) would both be potential candidates. Some of the SIN scaffold proteins, most notably Cdc11p, are multiply phosphorylated during mitosis; however, in a previous study (Morrell et al., 2004
), all the identified Cdc2p sites in Cdc11p were mutagenised without affecting its biological function. This finding makes it less likely that Cdc11p is the key substrate for Cdc2p in SIN regulation. Nonetheless, it is noteworthy that Cdc13p interacts with Cdc11p (Morrell et al., 2004
). It is therefore possible that Cdc11p acts as a scaffold to position Cdc2p-Cdc13p to regulate SIN proteins.
In summary, the cdc2-as mutant has allowed us to explore the effect of rapid, chemically mediated inactivation of Cdc2p upon the localisation and activation of the SIN. Use of this chemical genetic approach should also allow the role of Cdc2p in regulating other cellular events to be evaluated.
| Materials and Methods |
|---|
|
|
|---|
Fission yeast techniques and reagents
GFP-tagged strains used in this study have been described previously (Bahler et al., 1998a
; Guertin et al., 2000
; Liu et al., 2002
; Salimova et al., 2000
; Sohrmann et al., 1998
). In experiments with GFP-Sid1p, the medial ring marker Rlc1p-GFP (Le Goff et al., 2000
) was also included to facilitate identification of cells in mitosis. Standard techniques were used for the growth and manipulation of fission yeast (Moreno et al., 1991
).
Cell synchronisation
Cdc2::ura4+ cdc2-as GFP-SIN cells were transformed with pRep3X-mad2 and selection synchrony was additionally performed as described (Schmidt et al., 1997
) using a Beckman JS 5.0 elutriation system with a 40 ml separation chamber. For experiments involving overexpression of mad2, cells were grown under inducing conditions for 16 hours at 25°C before size selection by centrifugal elutriation, which took approximately 90 minutes for loading and elution. Cells were concentrated by vacuum filtration and resuspended at 3x106 per ml in supplemented EMM2 medium.
Cell biology and image capture
For visualisation of GFP and
-tubulin by indirect immunofluorescence, cells were processed as described (Hagan and Hyams, 1988
). Briefly, cells were fixed by addition of freshly made paraformaldehyde (Sigma) to 3.7% (w/v). Thereafter cells were washed three times with PEM (0.1 M PIPES pH 6.9 1 mM EGTA 10 mM MgSO4) and then digested for 40 minutes at 37°C in PEMS (PEM plus 1.2 M sorbitol) containing 1 mg/ml zymolyase 20T (Seikagaku Corporation, Japan). Cells were washed once in PEMS plus 1% Triton X-100, three times with PEM, resuspended in PEM plus 1% BSA (Sigma), 100 mM lysine hydrochloride, 0.1% sodium azide (PEMBAL) and incubated for 30 minutes on a rotating wheel. Cells were resuspended in PEMBAL containing the primary antibodies and incubated overnight at room temperature. The following primary antibodies were used:
-tubulin was detected using TAT-1 (1:50) (Woods et al., 1989
). GFP was detected by rabbit anti-GFP antibody (1:500) (Krapp et al., 2001
). After three washes in PEMBAL, cells were incubated with PEMBAL containing secondary antibodies [Goat-anti-mouse Cy3 (1:500, Jackson) and goat-anti-rabbit Alexa Fluor 488 (1:500, Molecular Probes)] with end-over-end agitation for 4 hours at 37°C. Cells were then washed once in PEM, once in PBS (pH 8.0) and then resuspended in PBS (pH 8.0) containing 1 µg/ml DAPI. Images were captured using a TILL Olympus IX70 microscope equipped with a SensiCam 12 Bit cooled CCD camera (PCO) and Metamorph 6.3r software. The images shown in Figs 5 and 6 are maximum intensity projections of Z-stacks (11 sections at 0.5 µm). Image J software (v1.37) was used for image processing and measurement of spindle lengths. Contrast and levels adjustments were made using Adobe® Photoshop CS.
Cells were fixed and processed to detect F-actin using Rhodamine-conjugated phalloidin as described (Marks et al., 1986
). DAPI staining was performed as described (Balasubramanian et al., 1997
). Cells were viewed using an Axiophot microscope (Zeiss) with a 100
NA 1.4 lens and images were captured on a Nikon Coolpix 990 camera.
The cut2-GFP allele was created by oligonucleotide-mediated tagging (Bahler et al., 1998b
), using VS425, 5'-GTCGGCGCCCTTTATCTCGTTCTATTCATTCGTTATCATCTTCACGAATTGATTTTTCATCTTTGGATACAGGATTGTTACGGATCCCCGGGTTAATTAA-3' and VS426, 5'-CAAATTAAACAACAAGGGAAATCAAAGCCATCGGAAGAATCATACTTACAATCGTAGAAGCGGAAGCCAGTACGCACGAATTCGAGCTCGTTTAAAC-3'. Colonies resistant to G418 were selected and correct insertion of the tag was verified by PCR. The Cut2-GFP allele is thermosensitive and unable to form colonies at 36°C. The localisation of Cut2p-GFP in vivo recapitulates the published localisation (Kumada et al., 1998
). We were obliged to analyse the Cut2p-GFP signal in living cells, as we were unable to preserve any Cut2p-GFP signal on the mitotic spindle that could be detected by antibodies to GFP after fixation with either paraformaldehyde or paraformaldehyde and glutaraldehyde. The double mutant cdc2-as cut2-GFP shows a mild negative genetic interaction; cells are more elongated than cdc2-as and cannot easily be separated by centrifugal elutriation. For this reason, the localisation of Cut2p-GFP in cells overexpressing mad2 was examined in cells that had not been presynchronised by elutriation. To examine the localisation of Cut2p-GFP, expression of mad2 was induced for 22 hours at 25°C. Fields of cells were photographed using a Zeiss axiovert 200 microscope equipped with a confocal scanner unit model CSU10 (Yokogawa Electric Corporation), a coolSNAPHQ camera (Photometrics) and a 63x NA plan-apo objective. Images were collected using Metamorph software (Universal Imaging). Cells were treated with 1 µM analogue or an equivalent volume of DMSO for 8 minutes before mounting for observation. The total time from the addition of analogue to completion of image capture was 10-15 minutes.
Molecular biology
Standard techniques were used for molecular biology (Sambrook et al., 1989
). The cdc2-as mutant was created by site-directed mutagenesis of Phe84 to Gly by PCR using the following oligonucleotides: forward primer VS 551, 5'-GTTGTATCTTGTTGGTGAGTTTTTAGAC-3' and the reverse primer VS552, 5'-GTCTAAAAACTCACCAACAAGATACAAC-3'. A 3 kb PstI fragment containing the cdc2-as mutation was cloned into the pINTA [pINT5 (Fankhauser and Simanis, 1994
), from which the nmt1 promoter has been removed; a gift from J. Petersen, University of Manchester, Manchester, UK] vector that targets integration at the leu1 gene. Integration was performed in a cdc2+ strain, and the cdc2-as was introduced into a cdc2::ura4+ background by crossing to a cdc2::ura4+ strain that was rescued by human CDC2/CDK1 (Lee and Nurse, 1987
). Integration at the cdc2+ locus was also obtained during this transformation, presumably by gene conversion. The phenotypes of the cdc2::ura4+ leu1::cdc2-as and cdc2-as strains were indistinguishable in either complete (YE) or minimal (EMM2) medium; most experiments described here use cdc2-as. The existence of the as mutation at the sites of integration was verified by sequencing using VS 551/552 primer. DNA-sequencing reactions and oligonucleotide primer synthesis were performed at Microsynth laboratory (Balgach, CH).
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Alfa, C. E., Booher, R., Beach, D. and Hyams, J. S. (1989). Fission yeast cyclin: subcellular localisation and cell cycle regulation. J. Cell Sci. Suppl. 12, 9-19.[Medline]
Alfa, C. E., Ducommun, B., Beach, D. and Hyams, J. S. (1990). Distinct nuclear and spindle pole body population of cyclin-cdc2 in fission yeast. Nature 347, 680-682.[CrossRef][Medline]
Bahler, J., Steever, A. B., Wheatley, S., Wang, Y., Pringle, J. R., Gould, K. L. and McCollum, D. (1998a). Role of polo kinase and Mid1p in determining the site of cell division in fission yeast. J. Cell Biol. 143, 1603-1616.
Bahler, J., Wu, J. Q., Longtine, M. S., Shah, N. G., McKenzie, A., 3rd, Steever, A. B., Wach, A., Philippsen, P. and Pringle, J. R. (1998b). Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 14, 943-951.[CrossRef][Medline]
Balasubramanian, M. K., McCollum, D. and Gould, K. L. (1997). Cytokinesis in fission yeast Schizosaccharomyces pombe. Meth. Enzymol. 283, 494-506.[Medline]
Bardin, A. J. and Amon, A. (2001). Men and sin: what's the difference? Nat. Rev. Mol. Cell Biol. 2, 815-826.[CrossRef][Medline]
Beach, D., Durkacz, B. and Nurse, P. (1982). Functionally homologous cell cycle control genes in budding and fission yeast. Nature 300, 706-709.[CrossRef][Medline]
Berthet, C. and Kaldis, P. (2007). Cell-specific responses to loss of cyclin-dependent kinases. Oncogene 26, 4469-4477.[CrossRef][Medline]
Bishop, A. C., Kung, C.-Y., Shah, K., Witucki, L., Shokat, K. M. and Liu, Y. (1999). Generation of monospecific nanomolar tyrosine kinase inhibitors via a chemical genetic approach. J. Am. Chem. Soc. 121, 627-631.[CrossRef]
Bishop, A. C., Ubersax, J. A., Petsch, D. T., Matheos, D. P., Gray, N. S., Blethrow, J., Shimizu, E., Tsien, J. Z., Schultz, P. G., Rose, M. D. et al. (2000). A chemical switch for inhibitor-sensitive alleles of any protein kinase. Nature 407, 395-401.[CrossRef][Medline]
Booher, R. and Beach, D. (1986). Site-specific mutagenesis of cdc2+, a cell cycle control gene of the fission yeast Schizosaccharomyces pombe. Mol. Cell. Biol. 6, 3523-3530.
Booher, R. and Beach, D. (1988). Involvement of cdc13+ in mitotic control in Schizosaccharomyces pombe: possible interaction of the gene product with microtubules. EMBO J. 7, 2321-2327.[Medline]
Broek, D., Bartlett, R., Crawford, K. and Nurse, P. (1991). Involvement of p34cdc2 in establishing the dependency of S phase on mitosis. Nature 349, 388-393.[CrossRef][Medline]
Chang, L. and Gould, K. L. (2000). Sid4p is required to localize components of the septation initiation pathway to the spindle pole body in fission yeast. Proc. Natl. Acad. Sci. USA 97, 5249-5254.
Chang, L., Morrell, J. L., Feoktistova, A. and Gould, K. L. (2001). Study of cyclin proteolysis in anaphase-promoting complex (APC) mutant cells reveals the requirement for APC function in the final steps of the fission yeast septation initiation network. Mol. Cell. Biol. 21, 6681-6694.
Connolly, T. and Beach, D. (1994). Interaction between the Cig1 and Cig2 B-type cyclins in the fission yeast cell cycle. Mol. Cell. Biol. 14, 768-776.
Cortes, J. C., Konomi, M., Martins, I. M., Munoz, J., Moreno, M. B., Osumi, M., Duran, A. and Ribas, J. C. (2007). The (1,3)beta-D-glucan synthase subunit Bgs1p is responsible for the fission yeast primary septum formation. Mol. Microbiol. 65, 201-217.[CrossRef][Medline]
Cueille, N., Salimova, E., Esteban, V., Blanco, M., Moreno, S., Bueno, A. and Simanis, V. (2001). Flp1, a fission yeast orthologue of the s. cerevisiae CDC14 gene, is not required for cyclin degradation or rum1p stabilisation at the end of mitosis. J. Cell Sci. 114, 2649-2664.[Medline]
Decottignies, A., Zarzov, P. and Nurse, P. (2001). In vivo localisation of fission yeast cyclin-dependent kinase cdc2p and cyclin B cdc13p during mitosis and meiosis. J. Cell Sci. 114, 2627-2640.[Medline]
Esteban, V., Blanco, M., Cueille, N., Simanis, V., Moreno, S. and Bueno, A. (2004). A role for the Cdc14-family phosphatase Flp1p at the end of the cell cycle in controlling the rapid degradation of the mitotic inducer Cdc25p in fission yeast. J. Cell Sci. 117, 2461-2468.
Fankhauser, C. and Simanis, V. (1993). The Schizosaccharomyces pombe cdc14 gene is required for septum formation and can also inhibit nuclear division. Mol. Biol. Cell 4, 531-539.[Abstract]
Fankhauser, C. and Simanis, V. (1994). The cdc7 protein kinase is a dosage dependent regulator of septum formation in fission yeast. EMBO J. 13, 3011-3019.[Medline]
Fisher, D. and Nurse, P. (1995). Cyclins of the fission yeast Schizosaccharomyces pombe. Semin. Cell Biol. 6, 73-78.[Medline]
Fisher, D. L. and Nurse, P. (1996). A single fission yeast mitotic cyclin B p34cdc2 kinase promotes both S-phase and mitosis in the absence of G1 cyclins. EMBO J. 15, 850-860.[Medline]
Furge, K. A., Wong, K., Armstrong, J., Balasubramanian, M. and Albright, C. F. (1998). Byr4 and Cdc16 form a two-component GTPase-activating protein for the Spg1 GTPase that controls septation in fission yeast. Curr. Biol. 8, 947-954.[CrossRef][Medline]
Ghiara, J. B., Richardson, H. E., Sugimoto, K., Henze, M., Lew, D. J., Wittenberg, C. and Reed, S. I. (1991). A cyclin B homolog in S. cerevisiae: chronic activation of the Cdc28 protein kinase by cyclin prevents exit from mitosis. Cell 65, 163-174.[CrossRef][Medline]
Gould, K. (2004). Protein kinases driving the Cell Cycle. In The Molecular Biology of Schizosaccharomyces pombe (ed. R. Egel), pp. 27-40. Heidelberg: Springer-Verlag.
Gould, K. L. and Nurse, P. (1989). Tyrosine phosphorylation of the fission yeast cdc2+ protein kinase regulates entry into mitosis. Nature 342, 39-45.[CrossRef][Medline]
Gould, K. L., Moreno, S., Owen, D. J., Sazer, S. and Nurse, P. (1991). Phosphorylation at Thr167 is required for Schizosaccharomyces pombe p34cdc2 function. EMBO J. 10, 3297-3309.[Medline]
Grallert, A., Krapp, A., Bagley, S., Simanis, V. and Hagan, I. M. (2004). Recruitment of NIMA kinase shows that maturation of the S. pombe spindle-pole body occurs over consecutive cell cycles and reveals a role for NIMA in modulating SIN activity. Genes Dev. 18, 1007-1021.
Guertin, D. A., Chang, L., Irshad, F., Gould, K. L. and McCollum, D. (2000). The role of the sid1p kinase and cdc14p in regulating the onset of cytokinesis in fission yeast. EMBO J. 19, 1803-1815.[CrossRef][Medline]
Hagan, I. M. and Hyams, J. S. (1988). The use of cell division cycle mutants to investigate the control of microtubule distribution in the fission yeast Schizosaccharomyces pombe. J. Cell Sci. 89, 343-357.
Hagan, I., Hayles, J. and Nurse, P. (1988). Cloning and sequencing of the cyclin-related cdc13+ gene and a cytological study of its role in fission yeast mitosis. J. Cell Sci. 91, 587-595.
Hanefeld, U., Rees, C. W., White, A. J. P. and Williams, D. J. (1996). One-pot synthesis of tetrasubstituted pyrazoles-proof of regiochemistry. J. Chem. Soc. Perkin Trans. I 1996, 1545-1552.
Hayles, J., Aves, S. and Nurse, P. (1986). suc1 is an essential gene involved in both the cell cycle and growth in fission yeast. EMBO J. 5, 3373-3379.[Medline]
He, X., Patterson, T. E. and Sazer, S. (1997). The Schizosaccharomyces pombe spindle checkpoint protein mad2p blocks anaphase and genetically interacts with the anaphase-promoting complex. Proc. Natl. Acad. Sci. USA 94, 7965-7970.
Hermand, D., Pihlak, A., Westerling, T., Damagnez, V., Vandenhaute, J., Cottarel, G. and Makela, T. P. (1998). Fission yeast Csk1 is a CAK-activating kinase (CAKAK). EMBO J. 17, 7230-7238.[CrossRef][Medline]
Hou, M. C., Salek, J. and McCollum, D. (2000). Mob1p interacts with the Sid2p kinase and is required for cytokinesis in fission yeast. Curr. Biol. 10, 619-622.[CrossRef][Medline]
Hu, F., Wang, Y., Liu, D., Li, Y., Qin, J. and Elledge, S. J. (2001). Regulation of the Bub2/Bfa1 GAP complex by Cdc5 and cell cycle checkpoints. Cell 107, 655-665.[CrossRef][Medline]
Jaspersen, S. L. and Morgan, D. O. (2000). Cdc14 activates cdc15 to promote mitotic exit in budding yeast. Curr. Biol. 10, 615-618.[CrossRef][Medline]
Jiang, W. and Hallberg, R. (2000). Isolation and characterisation of par1+ and par2+: two Schizosaccharomyces pombe genes encoding B' subunits of protein phosphatase 2A. Genetics 154, 1025-1038.
Jiang, W. and Hallberg, R. L. (2001). Correct regulation of the septation initiation network in Schizosaccharomyces pombe requires the activities of par1 and par2. Genetics 158, 1413-1429.
Kaldis, P. and Aleem, E. (2005). Cell cycle sibling rivalry: Cdc2 vs. Cdk2. Cell Cycle 4, 1491-1494.[Medline]
Kinoshita, N., Ohkura, H. and Yanagida, M. (1990). Distinct, essential roles of type 1 and 2A protein phosphatases in the control of the fission yeast cell division cycle. Cell 63, 405-415.[CrossRef][Medline]
Krapp, A., Schmidt, S., Cano, E. and Simanis, V. (2001). S. pombe cdc11p, together with sid4p, provides an anchor for septation initiation network proteins on the spindle pole body. Curr. Biol. 11, 1559-1568.[CrossRef][Medline]
Krapp, A., Gulli, M. P. and Simanis, V. (2004). SIN and the art of splitting the fission yeast cell. Curr. Biol. 14, R722-R730.[CrossRef][Medline]
Kumada, K., Nakamura, T., Nagao, K., Funabiki, H., Nakagawa, T. and Yanagida, M. (1998). Cut1 is loaded onto the spindle by binding to Cut2 and promotes anaphase spindle movement upon Cut2 proteolysis. Curr. Biol. 8, 633-641.[CrossRef][Medline]
Le Goff, X., Motegi, F., Salimova, E., Mabuchi, I. and Simanis, V. (2000). The S. pombe rlc1 gene encodes a putative myosin regulatory light chain that binds the type II myosins myo3p and myo2p. J. Cell Sci. 113, 4157-4163.[Abstract]
Le Goff, X., Buvelot, S., Salimova, E., Guerry, F., Schmidt, S., Cueille, N., Cano, E. and Simanis, V. (2001). The protein phosphatase 2A B'-regulatory subunit par1p is implicated in regulation of the S. pombe septation initiation network. FEBS Lett. 508, 136-142.[CrossRef][Medline]
Lee, K. M., Saiz, J. E., Barton, W. A. and Fisher, R. P. (1999). Cdc2 activation in fission yeast depends on Mcs6 and Csk1, two partially redundant Cdk-activating kinases (CAKs). Curr. Biol. 9, 441-444.[CrossRef][Medline]
Lee, M. G. and Nurse, P. (1987). Complementation used to clone a human homologue of the fission yeast cell cycle control gene cdc2. Nature 327, 31-35.[CrossRef][Medline]
Liu, J., Tang, X., Wang, H., Oliferenko, S. and Balasubramanian, M. K. (2002). The localization of the integral membrane protein Cps1p to the cell division site is dependent on the actomyosin ring and the septation-inducing network in Schizosaccharomyces pombe. Mol. Biol. Cell 13, 989-1000.
Liu, J., Wang, H., McCollum, D. and Balasubramanian, M. K. (1999). Drc1p/Cps1p, a 1,3-beta-glucan synthase subunit, is essential for division septum assembly in Schizosaccharomyces pombe. Genetics 153, 1193-1203.
Liu, Y., Bishop, A., Witucki, L., Kraybill, B., Shimizu, E., Tsien, J., Ubersax, J., Blethrow, J., Morgan, D. O. and Shokat, K. M. (1999). Structural basis for selective inhibition of Src family kinases by PP1. Chem. Biol. 6, 671-678.[CrossRef][Medline]
MacNeill, S. A. and Nurse, P. (1993). Mutational analysis of the fission yeast p34cdc2 protein kinase gene. Mol. Gen. Genet. 236, 415-426.[CrossRef][Medline]
MacNeill, S. A., Creanor, J. and Nurse, P. (1991). Isolation, characterisation and molecular cloning of new mutant alleles of the fission yeast p34cdc2+ protein kinase gene: identification of temperature-sensitive G2-arresting alleles. Mol. Gen. Genet. 229, 109-118.[Medline]
Malumbres, M. and Barbacid, M. (2005). Mammalian cyclin-dependent kinases. Trends Biochem. Sci. 30, 630-641.[CrossRef][Medline]
Marks, J., Hagan, I. M. and Hyams, J. S. (1986). Growth polarity and cytokinesis in fission yeast: the role of the cytoskeleton. J. Cell Sci. Suppl. 5, 229-241.[Medline]
Martin-Castellanos, C. and Moreno, S. (1996). Regulation of G1 progression in fission yeast by the rum1+ gene product. Prog. Cell Cycle Res. 2, 29-35.[Medline]
Martin-Castellanos, C., Blanco, M. A., de Prada, J. M. and Moreno, S. (2000). The puc1 cyclin regulates the G1 phase of the fission yeast cell cycle in response to cell size. Mol. Biol. Cell 11, 543-554.
Mishra, M., Karagiannis, J., Trautmann, S., Wang, H., McCollum, D. and Balasubramanian, M. K. (2004). The Clp1p/Flp1p phosphatase ensures completion of cytokinesis in response to minor perturbation of the cell division machinery in Schizosaccharomyces pombe. J. Cell Sci. 117, 3897-3910.
Mondesert, O., McGowan, C. H. and Russell, P. (1996). Cig2, a B-type cyclin, promotes the onset of S in Schizosaccharomyces pombe. Mol. Cell. Biol. 16, 1527-1533.[Abstract]
Moreno, S., Hayles, J. and Nurse, P. (1989). Regulation of p34cdc2 protein kinase during mitosis. Cell 58, 361-372.[CrossRef][Medline]
Moreno, S., Klar, A. and Nurse, P. (1991). Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Meth. Enzymol. 194, 795-823.[Medline]
Morrell, J. L., Tomlin, G. C., Rajagopalan, S., Venkatram, S., Feoktistova, A. S., Tasto, J. J., Mehta, S., Jennings, J. L., Link, A., Balasubramanian, M. K. et al. (2004). Sid4p-Cdc11p assembles the septation initiation network and its regulators at the S. pombe SPB. Curr. Biol. 14, 579-584.[CrossRef][Medline]
Mulvihill, D. P., Petersen, J., Ohkura, H., Glover, D. M. and Hagan, I. M. (1999). Plo1 kinase recruitment to the spindle pole body and its role in cell division in Schizosaccharomyces pombe. Mol. Biol. Cell 10, 2771-2785.
Munoz, M. J. and Jimenez, J. (1999). Genetic interactions between Hsp90 and the Cdc2 mitotic machinery in the fission yeast Schizosaccharomyces pombe. Mol. Gen. Genet. 261, 242-250.[CrossRef][Medline]
Nakaseko, Y., Niwa, O. and Yanagida, M. (1984). A meiotic mutant of the fission yeast Schizosaccharomyces pombe that produces mature asci containing two diploid spores. J. Bacteriol. 157, 334-336.
Nasmyth, K. and Nurse, P. (1981). Cell division cycle mutants altered in DNA replication and mitosis in the fission yeast Schizosaccharomyces pombe. Mol. Gen. Genet. 182, 119-124.[CrossRef][Medline]
Nurse, P. and Bissett, Y. (1981). Gene required in G1 for commitment to cell cycle and in G2 for control of mitosis in fission yeast. Nature 292, 558-560.[CrossRef][Medline]
Nurse, P., Thuriaux, P. and Nasmyth, K. (1976). Genetic control of the cell division cycle in the fission yeast Schizosaccharomyces pombe. Mol. Gen. Genet. 146, 167-178.[CrossRef][Medline]
Ohkura, H. and Yanagida, M. (1991). S. pombe gene sds22+ essential for a midmitotic transition encodes a leucine-rich repeat protein that positively modulates protein phosphatase-1. Cell 64, 149-157.[CrossRef][Medline]
Paulson, J. R. (2007). Inactivation of Cdk1/Cyclin B in metaphase-arrested mouse FT210 cells induces exit from mitosis without chromosome segregation or cytokinesis and allows passage through another cell cycle. Chromosoma 116, 215-225.[CrossRef][Medline]
Pereira, G., Manson, C., Grindlay, J. and Schiebel, E. (2002). Regulation of the Bfa1p-Bub2p complex at spindle pole bodies by the cell cycle phosphatase Cdc14p. J. Cell Biol. 157, 367-379.
Potapova, T. A., Daum, J. R., Pittman, B. D., Hudson, J. R., Jones, T. N., Satinover, D. L., Stukenberg, P. T. and Gorbsky, G. J. (2006). The reversibility of mitotic exit in vertebrate cells. Nature 440, 954-958.[CrossRef][Medline]
Rosenberg, J. A., Tomlin, G. C., McDonald, W. H., Snydsman, B. E., Muller, E. G., Yates, J. R., 3rd and Gould, K. L. (2006). Ppc89 links multiple proteins, including the septation initiation network, to the core of the fission yeast spindle-pole body. Mol. Biol. Cell 17, 3793-3805.
Russell, P. and Nurse, P. (1986). cdc25+ functions as an inducer in the mitotic control of fission yeast. Cell 45, 145-153.[CrossRef][Medline]
Russell, P. and Nurse, P. (1987). Negative regulation of mitosis by wee1+, a gene encoding a protein kinase homolog. Cell 49, 559-567.[CrossRef][Medline]
Salimova, E., Sohrmann, M., Fournier, N. and Simanis, V. (2000). The S. pombe orthologue of the S. cerevisiae mob1 gene is essential and functions in signalling the onset of septum formation. J. Cell Sci. 113, 1695-1704.[Abstract]
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning. New York: Cold Spring Harbor Laboratory Press.
Sazer, S. and Sherwood, S. W. (1990). Mitochondrial growth and DNA synthesis occur in the absence of nuclear DNA replication in fission yeast. J. Cell Sci. 97, 509-516.
Schmidt, S., Sohrmann, M., Hofmann, K., Woollard, A. and Simanis, V. (1997). The Spg1p GTPase is an essential, dosage-dependent inducer of septum formation in Schizosaccharomyces pombe. Genes Dev. 11, 1519-1534.
Seshan, A. and Amon, A. (2004). Linked for life: temporal and spatial coordination of late mitotic events. Curr. Opin. Cell Biol. 16, 41-48.[CrossRef][Medline]
Simanis, V. (2003). Events at the end of mitosis in the budding and fission yeasts. J. Cell Sci. 116, 4263-4275.
Skoufias, D. A., Indorato, R. L., Lacroix, F., Panopoulos, A. and Margolis, R. L. (2007). Mitosis persists in the absence of Cdk1 activity when proteolysis or protein phosphatase activity is suppressed. J. Cell Biol. 179, 671-685.
Snaith, H. A. and Forsburg, S. L. (1999). Rereplication phenomenon in fission yeast requires MCM proteins and other S phase genes. Genetics 152, 839-851.
Sohrmann, M., Schmidt, S., Hagan, I. and Simanis, V. (1998). Asymmetric segregation on spindle poles of the Schizosaccharomyces pombe septum-inducing protein kinase Cdc7p. Genes Dev. 12, 84-94.
Song, K., Mach, K. E., Chen, C. Y., Reynolds, T. and Albright, C. F. (1996). A novel suppressor of ras1 in fission yeast, byr4, is a dosage-dependent inhibitor of cytokinesis. J. Cell Biol. 133, 1307-1319.
Sparks, C. A., Morphew, M. and McCollum, D. (1999). Sid2p, a spindle pole body kinase that regulates the onset of cytokinesis. J. Cell Biol. 146, 777-790.
Stegmeier, F. and Amon, A. (2004). Closing mitosis: the functions of the Cdc14 phosphatase and its regulation. Annu. Rev. Genet. 38, 203-232.[CrossRef][Medline]
Surana, U., Robitsch, H., Price, C., Schuster, T., Fitch, I., Futcher, A. B. and Nasmyth, K. (1991). The role of CDC28 and cyclins during mitosis in the budding yeast S. cerevisiae. Cell 65, 145-161.[CrossRef][Medline]
Tanaka, K., Petersen, J., MacIver, F., Mulvihill, D. P., Glover, D. M. and Hagan, I. M. (2001). The role of Plo1 kinase in mitotic commitment and septation in Schizosaccharomyces pombe. EMBO J. 20, 1259-1270.[CrossRef][Medline]
Tomlin, G. C., Morrell, J. L. and Gould, K. L. (2002). The spindle pole body protein cdc11p links sid4p to the fission yeast septation initiation network. Mol. Biol. Cell 13, 1203-1214.
Trautmann, S. and McCollum, D. (2002). Cell cycle: new functions for Cdc14 family phosphatases. Curr. Biol. 12, R733-R735.[CrossRef][Medline]
Trautmann, S. and McCollum, D. (2005). Distinct nuclear and cytoplasmic functions of the S. pombe Cdc14-like phosphatase Clp1p/Flp1p and a role for nuclear shuttling in its regulation. Curr. Biol. 15, 1384-1389.[CrossRef][Medline]
Trautmann, S., Wolfe, B. A., Jorgensen, P., Tyers, M., Gould, K. L. and McCollum, D. (2001). Fission yeast Clp1p phosphatase regulates G2/M transition and coordination of cytokinesis with cell cycle progression. Curr. Biol. 11, 931-940.[CrossRef][Medline]
Trautmann, S., Rajagopalan, S. and McCollum, D. (2004). The S. pombe Cdc14-like phosphatase Clp1p regulates chromosome biorientation and interacts with Aurora kinase. Dev. Cell 7, 755-762.[CrossRef][Medline]
Turnbull, E. L., Martin, I. V. and Fantes, P. A. (2006). Activity of Cdc2 and its interaction with the cyclin Cdc13 depend on the molecular chaperone Cdc37 in Schizosaccharomyces pombe. J. Cell Sci. 119, 292-302.
Umesono, K., Toda, T., Hayashi, S. and Yanagida, M. (1983). Cell division cycle genes nda2 and nda3 of the fission yeast Schizosaccharomyces pombe control microtubular organization and sensitivity to anti-mitotic benzimidazole compounds. J. Mol. Biol. 168, 271-284.[CrossRef][Medline]
VerPlank, L. and Li, R. (2005). Cell cycle-regulated trafficking of Chs2 controls actomyosin ring stability during cytokinesis. Mol. Biol. Cell 16, 2529-2543.
Wolfe, B. A. and Gould, K. L. (2004). Fission yeast Clp1p phosphatase affects G2/M transition and mitotic exit through Cdc25p inactivation. EMBO J. 23, 919-929.[CrossRef][Medline]
Wolfe, B. A. and Gould, K. L. (2005). Split decisions: coordinating cytokinesis in yeast. Trends Cell Biol. 15, 10-18.[CrossRef][Medline]
Woods, A., Sherwin, T., Sasse, R., MacRae, T. H., Baines, A. J. and Gull, K. (1989). Definition of individual components within the cytoskeleton of Trypanosoma brucei by a library of monoclonal antibodies. J. Cell Sci. 93, 491-500.
Wuarin, J., Buck, V., Nurse, P. and Millar, J. B. (2002). Stable association of mitotic cyclin B/Cdc2 to replication origins prevents endoreduplication. Cell 111, 419-431.[CrossRef][Medline]
Yamano, H., Gannon, J. and Hunt, T. (1996). The role of proteolysis in cell cycle progression in Schizosaccharomyces pombe. EMBO J. 15, 5268-5279.[Medline]
Yanagida, M., Yamashita, Y. M., Tatebe, H., Ishii, K., Kumada, K. and Nakaseko, Y. (1999). Control of metaphase-anaphase progression by proteolysis: cyclosome function regulated by the protein kinase A pathway, ubiquitination and localization. Philos. Trans. R. Soc. Lond. B Biol. Sci. 354, 1559-1569; discussion 1569-1570.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||