|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 11 March 2008
doi: 10.1242/jcs.014456
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
1 Department of Molecular Biology, AG Regulation of Gene Expression, Max-Planck-Institute of Biochemistry, 82152 Martinsried, Germany
2 Institute of Toxicology, Hannover Medical School, 30625 Hannover, Germany
* Author for correspondence (e-mail: posern{at}biochem.mpg.de)
Accepted 16 January 2008
| Summary |
|---|
|
|
|---|
Key words: Clostridial toxins, Epithelial junctions, Gene expression
| Introduction |
|---|
|
|
|---|
Formation of epithelial junctions involves Rho family GTPases and a dynamic and contractile actin cytoskeleton (Braga et al., 1997
; Braga and Yap, 2005
; Jou and Nelson, 1998
; Nakagawa et al., 2001
; Noren et al., 2001
; Sahai and Marshall, 2002
; Vasioukhin et al., 2000
). However, during embryonic development, tissue remodelling and tumour progression, disintegration of epithelial junctions is a key event, allowing epithelial-mesenchymal transition (EMT). In vitro, junction disassembly can be induced by depletion of extracellular Ca2+ (Klingelhofer et al., 2002
). Internalisation and breakdown of the apical junctional complexes involves clathrin-mediated endocytosis and actomyosin contractility (de Rooij et al., 2005
; Ivanov et al., 2004
). This process is initiated and controlled during physiological and pathological conditions by cytokines, toxins and growth factors such as TGFβ, and leads to developmental or pathological EMT (Grunert et al., 2003
; Janda et al., 2006
; Masszi et al., 2004
). Indeed, Ca2+ depletion activates the promoter of the mesenchymal marker smooth muscle actin, which is potentiated by TGFβ (Fan et al., 2007
; Masszi et al., 2004
). The disassembly of epithelial junctions can also be caused by constitutively active or dominant-negative variants of Rho and Rac GTPases (Lozano et al., 2003
).
Rho-mediated changes in actin dynamics regulate transcription in serum-stimulated fibroblasts (reviewed by Posern and Treisman, 2006
). A key regulatory step is the release of the transcriptional co-activator MAL/MKL1/MRTF-A from monomeric G-actin (Miralles et al., 2003
). Upon RhoA-induced dissociation from G-actin and nuclear accumulation, MAL activates serum response factor (SRF)-dependent target genes (Mack et al., 2001
; Miralles et al., 2003
; Vartiainen et al., 2007
). Both MAL and SRF are widely expressed and form complexes with promoter elements termed CArG-boxes (Posern and Treisman, 2006
). Serum-stimulated SRF activity in fibroblasts is blocked by inhibition of RhoA and ectopic expression of either non-polymerisable actin mutants such as actin R62D or dominant-negative MAL constructs (Hill et al., 1995
; Miralles et al., 2003
; Posern et al., 2002
). Vice versa, Rho family GTPases, LIMK, Dia1 and F-actin stabilising actin mutants such as actin G15S activate SRF (Copeland and Treisman, 2002
; Hill et al., 1995
; Posern et al., 2004
; Sotiropoulos et al., 1999
). In mice, SRF and the MAL paralogue MRTF-B are essential, whereas MAL/MRTF-A-depleted mice show only minor defects in lactation, probably owing to partial functional redundancy (Arsenian et al., 1998
; Li et al., 2005
; Li et al., 2006
; Oh et al., 2005
; Sun et al., 2006
).
Owing to their important role, epithelial junctions have been studied extensively, but how they influence gene expression is less clear. Using the largely serum-insensitive MDCK and EpRas cell lines as model systems, we show here that the dissociation of epithelial junctions activates SRF via actin dynamics and MAL. Time-course experiments, concentration dependence and the use of E-cadherin-deficient cell lines suggest that disruption of epithelial junctions triggers the transcriptional activation following Ca2+ withdrawal. The small GTPase Rac is critically involved in SRF activation and target gene induction in epithelial cells, whereas ROCK and actomyosin contraction are not sufficient.
| Results |
|---|
|
|
|---|
|
Withdrawal of extracellular Ca2+ results in the breakdown of cell-cell junctions including tight junctions and the E-cadherin-containing adherens junctions (Capaldo and Macara, 2007
; Klingelhofer et al., 2002
; Nakagawa et al., 2001
). Monitoring E-cadherin localisation by immunofluorescence demonstrated a loss of E-cadherin staining at cell-cell junctions when Ca2+ concentration was reduced (Fig. 1B). Similarly, the disruption of epithelial cell-cell adhesion and the subsequent cell rounding became apparent in phase-contrast microscopy. The threshold Ca2+ concentration of 0.04 mM strictly correlated for all effects, including F-actin rearrangement (Fig. 3C), suggesting that dissociation of epithelial cell-cell contacts is linked to SRF activation. EGTA treatment to deplete Ca2+ ions from confluent MDCK cells led to comparable results, but we observed strong toxicity upon extended treatment, maybe owing to perturbation of the intracellular level of divalent cations (data not shown). By contrast, medium exchange to low Ca2+ did not elicit any apparent harm to MDCK cells for several days (not shown).
|
|
Role of E-cadherin containing apical junctions
To ensure proper basolateral polarisation, we repeated the luciferase reporter assay with cells seeded on Transwell filters (Grunert et al., 2003
). Again, SRF was activated following Ca2+ withdrawal (Fig. 1C). This demonstrates that full epithelial polarisation on microporous membranes neither negatively nor positively influences the required signalling, and that the junctions that form on uncoated tissue culture dishes are sufficient for regulation. Thus, the likely reason for the observed effects of Ca2+ withdrawal on SRF activity is the dissociation of E-cadherin dependent apical junctions. To further test this, cells lacking E-cadherin expression were subjected to Ca2+-reduced medium. Neither MDA-MB 435S cells, a mammary carcinoma cell line, nor AGS cells, a gastric adenocarcinoma cell line, responded to Ca2+ withdrawal (Fig. 1D). There was no indication that basal SRF activity is increased in these cell lines, which could disguise a further activation (not shown). Whereas MDA-MB 435S did not show proper epithelial morphology, AGS cells still formed epithelial sheet-like cell clusters, although both lines lacked any detectable E-cadherin expression (Fig. 1D, inset). However, the principal signalling pathways from Rho family GTPases to SRF are intact, as shown by reporter induction with activated Rac1 (Fig. 1D) and RhoA (not shown). This demonstrates that intact apical junctions function as the Ca2+ sensor responsible for SRF regulation in epithelial cells.
Disrupted cell contacts signal via monomeric actin and MAL
In fibroblasts, serum stimulation of SRF is blocked by increased level of cellular G-actin, because the SRF co-activator MAL/MRTF binds to G-actin and is thereby inhibited (Miralles et al., 2003
; Posern et al., 2002
). We thus asked whether elevation of the cellular G-actin by ectopic expression of actin or latrunculin B treatment interferes with signalling to SRF in epithelial cells. Transfection of wild-type β-actin and the non-polymerisable mutant actin R62D efficiently reduced SRF activation by Ca2+ withdrawal (Fig. 3A). Likewise, latrunculin B blocked SRF reporter activity. By contrast, the F-actin stabilising mutant actin G15S activated SRF to similar levels both at physiological and reduced Ca2+ concentrations (Fig. 4A; data not shown), consistent with its effect in fibroblasts (Posern et al., 2004
). Expression of either actin wild type, R62D or G15S did not change the E-cadherin localisation at normal or low Ca2+ levels, excluding the possibility that the effects of the actin mutants on SRF were caused by altering formation or disruption of epithelial junctions in transfected cells (Fig. 3B). The F-actin cytoskeleton, visualised by phalloidin staining, showed a prominent reorganisation when subjected to low Ca2+ (Fig. 3C). Whereas diffuse F-actin staining disappeared, thick bundles of cortical actin formed in the separating cells when the Ca2+ level dropped below the threshold of 0.04 mM. This suggests that changes in actin dynamics, particular in the G-actin level, transduce a signal to SRF in dissociating epithelial cells.
|
To investigate the role of the SRF co-activator MAL/MRTF-A, we transfected full-length MAL and a constitutively active form, MAL
N, which lacks the repressive RPEL motifs responsible for G-actin binding (Miralles et al., 2003
). Full length MAL (f.l.) activated SRF, which was further elevated by Ca2+ withdrawal, whereas MAL
N was sufficient to activate SRF fully even in the presence of Ca2+ (Fig. 4A. By contrast, two different dominant-negative forms of MAL, MAL
N
B1 and MAL
N
C, both slightly but significantly reduced the activity of SRF upon Ca2+ withdrawal (Fig. 4A).
The crucial step in SRF regulation by MAL is the dissociation of the inhibitory G-actin:MAL complex (Vartiainen et al., 2007
). Using co-immunoprecipitation, we analysed the actin:MAL complex in MDCK cells upon epithelial disintegration. Ca2+ withdrawal resulted in the rapid and transient dissociation of MAL from actin (Fig. 4B). By contrast, latrunculin B stabilised the complex, whereas cytochalasin D, an activator of MAL and SRF, resulted in actin:MAL dissociation. Moreover, the upward shift probably indicates the phosphorylation of MAL, which is associated with SRF activation, similar to the previous observations in fibroblasts (Miralles et al., 2003
). Together, the results demonstrate that SRF regulation in dissociating epithelial cells occurs via G-actin and MAL/MRTF co-activators.
|
To determine whether RhoA and Rac1 are able to activate SRF in MDCK cells, cells were transfected with constitutively active versions of either Rac1 or RhoA. Both were sufficient to activate SRF-mediated transcription, as determined by the luciferase reporter (Fig. 5E).
Requirement of Rac
To test directly whether SRF activation upon Ca2+ withdrawal depends on Rho signalling, we took advantage of the cell-permeable exoenzyme C3 from Clostridium botulinum (Tat-C3), a specific inhibitor of RhoA, and two isoforms of Toxin B from C. difficile, the Rho/Rac/Cdc42-inactivating TcdB and the Rac/R-Ras-inactivating TcdBF (Huelsenbeck et al., 2007
; Sahai and Marshall, 2002
). Ca2+ was removed from confluent epithelial MDCK cells pretreated with either inhibitor and cells were analysed for SRF activity. Induction of SRF by low Ca2+ was found to be responsive to concentration-dependent inhibition by TcdB and TcdBF, but not by Tat-C3, suggesting that Rac1 rather than RhoA is required (Fig. 5B). Inhibition of either RhoA by Tat-C3 or TcdB or Rac1 by TcdBF was confirmed using the respective effector pull-down assays (Fig. 5C); importantly, Tat-C3 was fully functional in the polarised epithelial cells and completely blocked GTP-loading of RhoA following Ca2+ withdrawal [from 3.7±1.1-fold to 0.99±0.15-fold (n=3)]. Treatment with TcdBF, TcdB or Tat-C3 interfered neither with the preformed epithelial junctions (Fig. 5D) nor with their disruption (data not shown) during the course of the experiment. Prolonged treatment of MDCK cells with the Rho family inhibitors, however, resulted in reticulated dissociation of the epithelial sheets, demonstrating that some activity of Rac1 and RhoA is necessary for the maintenance of proper cell-cell adhesion (data not shown).
In sharp contrast, SRF activation in NIH 3T3 fibroblasts was concentration dependently inhibited by Tat-C3 (Fig. 5F), showing that RhoA is essential for serum-stimulation of fibroblasts as reported (Hill et al., 1995
). In epithelial cells, however, Rac1 rather than RhoA transmits the signal from dissociating epithelial junctions to SRF.
Target gene induction
We next extended our study of SRF activation to more physiological conditions under which junctions are disassembled or rearranged, independently of the extracellular Ca2+ level. During HGF-induced scattering of MDCK cells, a small but significant induction of SRF activity correlated with the disappearance of cell-cell contacts (Fig. 6A,B). Additionally, we used EpRas cells, which undergo epithelial-mesenchymal transition in vitro and in vivo following TGFβ treatment (Grunert et al., 2003
). In contrast to the dog kidney MDCK cells, for which it has been questioned whether they have a typical zonula adherens (Miyake et al., 2006
), EpRas cells are derived from the murine mammary gland and thus also allow monitoring of endogenous gene expression. First, following Ca2+ withdrawal, SRF was activated more than fivefold both in EpRas and the parental EpH4 cells (not shown), comparable with our observations in MDCK. Moreover, treatment of EpRas with TGFβ for 3 days, which results in disassembly of the epithelial junctions and actin reorganisation also induced SRF activity (Fig. 6C,D). This suggests that SRF activation is a general response upon dissociation of epithelial cell junctions.
|
To test the induction of transcription of endogenous SRF target genes, we used quantitative real-time RT-PCR. Vinculin (Vcl) and smooth muscle
-actin (Acta2) are known SRF target genes which are activated via the actin-MAL, but not by the MAPK-TCF pathway (Du et al., 2004
; Gineitis and Treisman, 2001
). Both Vcl and Acta2 mRNAs were upregulated after 3 hours in low Ca2+ (Fig. 6E). The induction of Acta2, A marker for epithelial-mesenchymal transition, was diminished when Rac1 was blocked by either TcdBF or TcdB pretreatment (Fig. 6F). By contrast, inhibition of RhoA with Tat-C3 did not significantly reduce Acta2 induction (Fig. 6F). Consistent with the previous luciferase assays performed in MDCK cells, this result demonstrates the critical role of Rac1 (but not RhoA) in the pathway analysed.
Actomyosin contractility
Previous studies have shown that actomyosin contractility is required for internalisation and disassembly of the apical junctional complexes, as well as cell scattering (de Rooij et al., 2005
; Ivanov et al., 2004
). We therefore tested the effect of Blebbistatin, an inhibitor of non-muscle myosin II ATPase activity. Blebbistatin pretreatment inhibited the activation of SRF upon Ca2+ withdrawal (Fig. 7A). Similarly, inhibition of ROCK by Y-27632 abrogated SRF activation (Fig. 7A), in agreement with a recent study (Fan et al., 2007
). To exclude side effects, we tested the activation of Rac1 and RhoA, which was maintained in Blebbistatin-treated cells (Fig. 7B). The internalisation of E-cadherin from the cell periphery was reduced (Fig. 7C), consistent with previous studies (Ivanov et al., 2004
). We also observed, however, disorganised F-actin staining, and a loss of cytoskeletal reorganisation and cortical bundling following Ca2+ withdrawal (Fig. 7C). This suggests that actomyosin contractility is involved in SRF activation, probably by perturbing cytoskeletal F-actin structures.
|
| Discussion |
|---|
|
|
|---|
|
Both adherens junctions and tight junctions are dynamically connected to the actin cytoskeleton, and disrupting them would expectedly interfere with F-actin structures. However, we demonstrate here that the small GTPase Rac is critically involved. The relationship between junctions and Rho family GTPases has been studied extensively, but mainly during formation of junctions (Braga et al., 1997
; Noren et al., 2001
) or HGF-induced scattering (Lynch et al., 2006
; Zondag et al., 2000
). We provide evidence that both Rac1 and RhoA are quickly and transiently GTP loaded when epithelial sheets are subjected to 0.02 mM Ca2+. By contrast, treatment with EGTA for 30 minutes has previously been shown to inhibit Rac localisation and activation, whereas RhoA remained unchanged under such conditions (Balzac et al., 2005
; Nakagawa et al., 2001
). This apparent discrepancy is probably explained either by junction-independent effects of EGTA, consistent with our observed toxicity upon extended treatment, or by the transient nature of the Rac and Rho activation, which previously might have been missed.
Activated forms of both RhoA and Rac are sufficient to activate SRF. However, only Rac proved to be required for activation of SRF-mediated transcription. We used clostridial cytotoxins to investigate the involvement of GTPases. Tat-C3 is a cell-permeable RhoA-specific ADP-ribosyltransferase (Sahai and Marshall, 2002
). TcdB inhibits RhoA and Rac/Cdc42 by glucosylating Thr-37 and Thr-35 within the effector region, respectively (Huelsenbeck et al., 2007
). Finally, TcdBF harbours the same receptor-binding and internalisation domain as TcdB, but has an altered glucosyltransferase specificity, targeting selectively Rac and R-Ras (Chaves-Olarte et al., 2003
; Huelsenbeck et al., 2007
). Comparing the effects of these toxins allows us to address the specific requirements for GTPases, unlike the expression of dominant-negative constructs that already interfere with the formation of junctions when reseeded to form confluent epithelial sheets (data not shown) (Braga et al., 1997
; Jou and Nelson, 1998
). Moreover, overexpression of RacN17 or RhoN19 may not necessarily result in the specificity previously anticipated (Wells et al., 2004
). With the concentrations and times used here, the toxins efficiently blocked their specific target GTPase, while neither perturbing existing junctions (Fig. 5) nor junction disassembly following Ca2+ withdrawal (data not shown).
The specific requirement for Rac, but not for Rho, during SRF activation by dissociating epithelial junctions is contrasted by the situation in serum-stimulated fibroblasts. In NIH3T3 cells, the RhoA-inactivating C3 exoenzyme efficiently blocks SRF (Fig. 5F) (Hill et al., 1995
). The effect of TcdBF is difficult to assess in fibroblasts, because these cells quickly round up and detach upon treatment; however, in detached cells, no concentration-dependent reduction of serum-induced SRF activity was observed (data not shown). In addition, confluent epithelial cells are hardly stimulatable by serum (Fig. 1C). These findings indicate that epithelial disintegration and serum stimulation use distinct upstream pathways, which converge at the level of G-actin to activate MAL/SRF dependent transcription.
Our studies with the toxins also exclude a role for R-Ras following Ca2+ withdrawal, as TcdB, which does not block R-Ras, inhibits SRF. A close relative to R-Ras, Rap1, has also been implicated in the regulation of cell-cell contacts of epithelial cells (Kooistra et al., 2007
). Neither overexpression of RalGDS-RBD, a R-Ras- and Rap1-specific inhibitor, nor the Rap1-specific exchange factor Epac (with deleted regulatory cAMP-binding domain) affected SRF activity, suggesting that Rap1 is not directly involved (data not shown).
What is the function of RhoA activation following dissociation of transcellular junctions, if it is not involved in SRF activation? The Rho-ROCK signalling axis has been shown to disrupt junctions, and endocytosis and disassembly of the apical junctional complexes following Ca2+ withdrawal, as well as scattering of MDCK cells, depends on actomyosin contractility (de Rooij et al., 2005
; Ivanov et al., 2004
; Sahai and Marshall, 2002
). Thus, RhoA may affect the internalisation and degradation of the junctional protein complexes via ROCK and regulation of non-muscle myosin II activity. Consistent with this, junctional proteins fail to internalise following Ca2+ withdrawal when pretreated with Blebbistatin (Fig. 7C) (Ivanov et al., 2004
). This does not contradict a Rac-dependent signal from the junctions to MAL: the homophilic interactions are disrupted and Rac is still activated by Ca2+ withdrawal (Fig. 7B), but internalisation and actin remodelling is blocked (Fig. 7C). The low level of basal RhoA activity which is maintained during our Tat-C3 treatment appears to be sufficient to permit the Ca2+-induced actin remodelling and internalisation of junctional complexes (not shown), despite the complete block of induced GTP-loading (Fig. 5C).
The activation of SRF-mediated transcription and the loss of E-cadherin staining at sites of cell-cell contacts both exhibit a comparable concentration dependency on Ca2+, suggesting a causative connection between the two effects. It is important to note that the Ca2+ threshold reported here is considerably lower than that required for junction formation, however. This demonstrates that data from such reverse experiments are not directly comparable. Our experimental setup depends on the ability of the medium to deplete Ca2+ from existing cell junctions in a confluent monolayer, which probably explains the low concentration reported here and in previous studies (Capaldo and Macara, 2007
; Klingelhofer et al., 2002
; Pokutta et al., 1994
).
Some mammary breast carcinoma and gastric adenocarcinoma cell lines lack the expression of E-cadherin. These cells do not only fail to form adherens junctions, but also lack proper tight junctions and desmosomes. We found that these E-cadherin deficient cells do not show any SRF activation in response to low Ca2+, suggesting a role of either E-cadherin or affected transmembrane proteins, including TJ components, in the cellular machinery sensing cell-cell dissociation. Future work will identify the molecular nature of the sensor and will characterise the link to Rac-dependent SRF-mediated transcription.
The ROCK inhibitor Y-27632 and the myosin ATPase inhibitor Blebbistatin blocked induction of SRF. While this manuscript was in preparation, another study showed that the smooth muscle
-actin promoter, which is regulated by MAL and SRF, is induced by disruption of intercellular contacts (Fan et al., 2007
), consistent with our findings. In addition, they also showed that Y-27632 and Blebbistatin suppresses the smooth muscle
-actin promoter (Fan et al., 2007
). At first sight, this indicates a role for actomyosin contractility. We showed, however, that Blebbistatin treatment leads to disassembly of the cellular F-actin and abrogates the cytoskeletal changes elicited by Ca2+ withdrawal (Fig. 7C). Consistent with this, loss of force has been shown to trigger the breakdown of F-actin and adhesion sites (Giannone and Sheetz, 2006
). Thus, we speculate that a basal level of ROCK activity, myosin light chain phosphorylation and actomyosin contractility (Fan et al., 2007
) is required for maintaining the integrity and treadmilling of the actin cytoskeleton, which is a prerequisite for signal transmission from Rac to MAL (Fig. 8). However, we cannot exclude more general effects of Blebbistatin on gene expression.
A direct role for actomyosin in SRF regulation is also inconsistent with our finding that inducing contractility with calyculin A or activated ROCK is not sufficient to induce SRF in epithelial cells (Fig. 7). Moreover, ROCK also fails to induce SRF in fibroblasts (Sahai et al., 1998
). By contrast, activated mouse Dia1, which does not facilitate bundling or contraction but Rho- and ROCK-independent actin polymerisation, activates SRF in epithelial cells even in the presence of Ca2+ (data not shown). Thus, changing the treadmilling cycle of actin, and thereby the G-actin population in the cell, provides a critical signal, whereas the ROCK-actomyosin signalling axis is not sufficient for SRF regulation in epithelial cells.
The disintegration of epithelial junctions is a key event during epithelial-mesenchymal transition (EMT), which occurs during development and cancer metastasis. We demonstrate here the induction of the MAL-dependent SRF gene expression program during epithelial disintegration. The two known MAL-dependent SRF targets we tested, the genes encoding smooth muscle
-actin and vinculin, were upregulated in mouse mammary epithelial cells. The induction of vinculin could potentially result in stabilisation of cell-cell and cell-matrix adhesions (Ziegler et al., 2006
). By contrast, smooth muscle actin is considered a mesenchymal marker, also in the EpRas EMT model system we used (Grunert et al., 2003
). This raises exciting questions about the functional outcome of the dissociation-induced MAL and SRF activation, potentially pointing towards a positive feed-forward loop during EMT. Indeed, a very recent report showed that MRTFs are crucial mediators of EMT induced by TGFβ (Morita et al., 2007
). The precise nature of these regulatory circuits remains to be elucidated.
| Materials and Methods |
|---|
|
|
|---|
N, 1-171;
B1, 316-341;
C, 563-1021; numbering based on pEF-MAL-HA (f.l.) (Miralles et al., 2003
4 and RhoQ63L in pcDNA3 (gifts from Reinhard Faessler). The degradable EGFP expression plasmid p3DA-d2EGFP was generated by replacing the CMV promoter of pd2EGFP-N1 (BD Clontech) with three SRF-binding sites in front of a Xenopus actin TATA-box (Mohun et al., 1987
Cells were grown in DMEM (Gibco) supplemented with 10% foetal calf serum (FCS, Gibco), except for EpRas cells, which require 4% FCS. For cells grown in confluent monolayers, the medium was refreshed every 24 hours. To disrupt Ca2+-dependent cell-cell contacts cells were washed once and then cultured in low calcium medium (calcium-free DMEM (Gibco) with 0.02 mM Ca2+ and FCS). For this medium, FCS was depleted of divalent cations using the Chelex 100 resin (Biorad) as described (Brennan et al., 1975
). To generate MDCK cells stably expressing the SRF-EGFP reporter, transfected cells were selected in 600 µg/ml G418 and further maintained at 300 µg/ml.
Transfections, luciferase reporter assays and immunoprecipitations
Transfections were carried out using Lipofectamine (Invitrogen) for MDCK, NIH3T3, AGS and EpRas cells, and TransFast (Promega) for MDA-MB-435S cells, according to the manufacturers' protocols. 1.5x106 cells per 10-cm diameter dish were transfected with 1.2 µg p3DA-Luc, 1 µg pRL-TK, together with the indicated plasmids in a total of 5 µg vector. 18 hours after transfection cells were reseeded to form confluent monolayers (600,000 per 1-cm diameter or 175,000 per transwell filter). 24 hours after reseeding, the medium was exchanged and 7 hours later cells were lysed. Cells were pretreated with Tat-C3 for 15 hours, TcdBF or TcdB for 4 hours, Blebbistatin for 2.5 hours, latrunculin B or calyculin A for 30 minutes. NIH3T3 cells were transfected and serum stimulated as described (Posern et al., 2002
). Firefly luciferase activity was normalized to either protein content or pRL-TK luciferase activity, as indicated. Figures show mean ± s.e.m. of at least three independent experiments. For each immunoprecipitation, 1x107 MDCK cells were electroporated with 20 µg of DNA in a GenePulser Xcell with CE and PC module (BioRad) using the square wave protocol (voltage, 250 V; pulse length, 10 ms; number of pulses, 3; pulse interval, 0.1 seconds) in a 4 mm GenePulser cuvette (Biorad). Cells were seeded in a 6-cm diameter dish. 36 hours later, medium was exchanged and cells were lysed in RIPA and immunoprecipitated in 1% Triton-X buffer (Miralles et al., 2003
) for 2 hours, using M2 anti-flag agarose beads (Sigma-Aldrich).
Immunofluorescence microscopy and live cell imaging
For immunofluorescence microscopy, cells were fixed with 4% paraformaldehyde, permeabilized in 0.2% Triton X-100 and blocked with 10% FCS, 1% gelatine, 0.05% Triton X-100 in PBS. Staining condition were as follows: E-cadherin (DECMA-1, Sigma-Aldrich), 1:1000; M2 anti-Flag (Sigma-Aldrich), 1:500; rhodamin phalloidin (Molecular Probes), 1:40; anti-Myc (9E10, CR-UK), 1:100; Alexa Fluor 488 goat anti-mouse IgG (H+L) (Molecular Probes), 1:1000; TRITC anti-rabbit (Dako Cytomation), 1:40. Micrographs were taken using a Zeiss Axioplan 2 with MetaVue software (Molecular Devices), or a LEICA TCS SP2 AOBS confocal laser-scanning microscope. Live cell imaging was carried out on a Zeiss Axiovert microscope with MetaMorph software. The induction profile showing the time course of EGFP expression was calculated by subtracting the arbitrary fluorescence intensity at each time point in the mock experiment from the equivalent arbitrary fluorescence intensity upon Ca2+ withdrawal.
Quantitative RT-PCR
For quantitative RT-PCR, murine epithelial EpRas cells were seeded to form a confluent monolayer (550,000 per 1-cm diameter). 36 hours later the medium was exchanged, and after 3 hours RNA was isolated. Cells were pretreated with 1 µM Tat-C3 (15 hours), 0.25 µg/ml TcdBF (4 hours) or 0.3 ng/ml TcdB (4 hours). The inhibitor treatment was maintained throughout the assay. RNA preparation (Qiagen) and first-strand cDNA synthesis (ABgene) were carried out according to the manufacturers' protocol. For cDNA synthesis, 1 µg of RNA and anchored oligo-dT primers were used. For cDNA quantitation, 1/40th of the RT reaction was mixed with gene-specific primers (0.5 µM), MgCl2 (3 mM) and LightCycler FastStart DNA Master SYBR Green I mix (1.5 µl; Roche) to a total volume of 15.5 µl. The primers used are: hprt, tcagtcaacgggggacataaa (forward), ggggctgtactgcttaaccag (reverse); acta2, tgacgctgaagtatccgataga (forward), gtacgtccagaggcatagagg (reverse); and vinc, ggccggaccaacatcagtg (forward), atgtaccagccagatttgacg (reverse). PCR was carried out on a LightCycler instrument (Roche) according to the manufacturer's instructions. Calculations were made using the 
Ct method (Winer et al., 1999
).
Small G-Protein pull-down assays
Preparation of GST-Rhotekin-RBD and GST-PAK-CRIB fusion protein was carried out using E. coli BL21 DE3 Rosetta. Induction of expression by 1 mM IPTG at 30°C for 90 minutes was followed by bacterial lysis in 50 mM Tris (pH 7.5), 1% Triton X-100, 150 mM NaCl, 5 mM MgCl2 and 1 mM DTT. The lysate was sonicated on ice (6x10 seconds) and the 25,000 g supernatant was snap-frozen in aliquots. Optimised amounts of lysate were used for coupling to glutathione sepharose beads (GE Healthcare) directly prior to GTPase pull-down assays (Ren and Schwartz, 2000
). 1x107 MDCK cells were seeded in 10 cm dishes to form a confluent monolayer and cultured for 36 h. After medium exchange, cells were lysed in Rho lyses buffer [50 mM Tris (pH 7.5), 1% Triton X-100, 500 mM NaCl, 10 mM MgCl2, 0.5% sodium desoxycholate, 0.1% SDS, protease inhibitors]. The cleared lysates were incubated with immobilised GST-Rhotekin-RBD at 4°C for 35 minutes and afterwards washed three times in Rho wash buffer [50 mM Tris (pH 7.5), 1% Triton X-100, 500 mM NaCl, 10 mM MgCl2, protease inhibitors). The Rac1/Cdc42-GTP pull-down assay was performed accordingly, except for 150 mM NaCl in lysis and wash buffer. As controls, cell lysates were incubated either with uncoupled beads alone or preincubated with GTP
S (1 mM for 10 minutes) prior to precipitation. Bound proteins were detected by western blotting using RhoA (Santa Cruz), Rac1 or Cdc42 (Transduction Laboratories) antibodies. Densitometric analysis of western blots was carried out with AIDA software (Raytest) and normalised to total lysates or ratios.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Arsenian, S., Weinhold, B., Oelgeschlager, M., Ruther, U. and Nordheim, A. (1998). Serum response factor is essential for mesoderm formation during mouse embryogenesis. EMBO J. 17, 6289-6299.[CrossRef][Medline]
Balzac, F., Avolio, M., Degani, S., Kaverina, I., Torti, M., Silengo, L., Small, J. V. and Retta, S. F. (2005). E-cadherin endocytosis regulates the activity of Rap1: a traffic light GTPase at the crossroads between cadherin and integrin function. J. Cell Sci. 118, 4765-4783.
Braga, V. M. and Yap, A. S. (2005). The challenges of abundance: epithelial junctions and small GTPase signalling. Curr. Opin. Cell Biol. 17, 466-474.[CrossRef][Medline]
Braga, V. M., Machesky, L. M., Hall, A. and Hotchin, N. A. (1997). The small GTPases Rho and Rac are required for the establishment of cadherin-dependent cell-cell contacts. J. Cell Biol. 137, 1421-1431.
Brennan, J. K., Mansky, J., Roberts, G. and Lichtman, M. A. (1975). Improved methods for reducing calcium and magnesium concentrations in tissue culture medium: application to studies of lymphoblast proliferation in vitro. In Vitro 11, 354-360.[Medline]
Capaldo, C. T. and Macara, I. G. (2007). Depletion of E-cadherin disrupts establishment but not maintenance of cell junctions in Madin-Darby canine kidney epithelial cells. Mol. Biol. Cell 18, 189-200.
Chaves-Olarte, E., Freer, E., Parra, A., Guzman-Verri, C., Moreno, E. and Thelestam, M. (2003). R-Ras glucosylation and transient RhoA activation determine the cytopathic effect produced by toxin B variants from toxin A-negative strains of Clostridium difficile. J. Biol. Chem. 278, 7956-7963.
Copeland, J. W. and Treisman, R. (2002). The diaphanous-related formin mDia1 controls serum response factor activity through its effects on actin polymerization. Mol. Biol. Cell 13, 4088-4099.
de Rooij, J., Kerstens, A., Danuser, G., Schwartz, M. A. and Waterman-Storer, C. M. (2005). Integrin-dependent actomyosin contraction regulates epithelial cell scattering. J. Cell Biol. 171, 153-164.
Drees, F., Pokutta, S., Yamada, S., Nelson, W. J. and Weis, W. I. (2005). Alpha-catenin is a molecular switch that binds E-cadherin-beta-catenin and regulates actin-filament assembly. Cell 123, 903-915.[CrossRef][Medline]
Du, K. L., Chen, M., Li, J., Lepore, J. J., Mericko, P. and Parmacek, M. S. (2004). Megakaryoblastic leukemia factor-1 transduces cytoskeletal signals and induces smooth muscle cell differentiation from undifferentiated embryonic stem cells. J. Biol. Chem. 279, 17578-17586.
Fan, L., Sebe, A., Peterfi, Z., Masszi, A., Thirone, A. C., Rotstein, O. D., Nakano, H., McCulloch, C. A., Szaszi, K., Mucsi, I. et al. (2007). Cell contact-dependent regulation of epithelial-myofibroblast transition via the Rho-Rho kinase-phospho-myosin pathway. Mol. Biol. Cell 18, 1083-1097.
Giannone, G. and Sheetz, M. P. (2006). Substrate rigidity and force define form through tyrosine phosphatase and kinase pathways. Trends Cell Biol. 16, 213-223.[CrossRef][Medline]
Gineitis, D. and Treisman, R. (2001). Differential usage of signal transduction pathways defines two types of serum response factor target gene. J. Biol. Chem. 276, 24531-24539.
Grunert, S., Jechlinger, M. and Beug, H. (2003). Diverse cellular and molecular mechanisms contribute to epithelial plasticity and metastasis. Nat. Rev. Mol. Cell Biol. 4, 657-665.[CrossRef][Medline]
Gumbiner, B. M. (2005). Regulation of cadherin-mediated adhesion in morphogenesis. Nat. Rev. Mol. Cell Biol. 6, 622-634.[Medline]
Gumbiner, B., Stevenson, B. and Grimaldi, A. (1988). The role of the cell adhesion molecule uvomorulin in the formation and maintenance of the epithelial junctional complex. J. Cell Biol. 107, 1575-1587.
Halbleib, J. M. and Nelson, W. J. (2006). Cadherins in development: cell adhesion, sorting, and tissue morphogenesis. Genes Dev. 20, 3199-3214.
Hill, C. S. and Treisman, R. (1995). Differential activation of c-fos promoter elements by serum, lysophosphatidic acid, G proteins and polypeptide growth factors. EMBO J. 14, 5037-5047.[Medline]
Hill, C. S., Wynne, J. and Treisman, R. (1995). The Rho family GTPases RhoA, Rac1, and CDC42Hs regulate transcriptional activation by SRF. Cell 81, 1159-1170.[CrossRef][Medline]
Huelsenbeck, J., Dreger, S., Gerhard, R., Barth, H., Just, I. and Genth, H. (2007). Difference in the cytotoxic effects of toxin B from Clostridium difficile strain VPI 10463 and toxin B from variant Clostridium difficile strain 1470. Infect. Immun. 75, 801-809.
Ivanov, A. I., McCall, I. C., Parkos, C. A. and Nusrat, A. (2004). Role for actin filament turnover and a myosin II motor in cytoskeleton-driven disassembly of the epithelial apical junctional complex. Mol. Biol. Cell 15, 2639-2651.
Janda, E., Nevolo, M., Lehmann, K., Downward, J., Beug, H. and Grieco, M. (2006). Raf plus TGFbeta-dependent EMT is initiated by endocytosis and lysosomal degradation of E-cadherin. Oncogene 25, 7117-7130.[CrossRef][Medline]
Jou, T. S. and Nelson, W. J. (1998). Effects of regulated expression of mutant RhoA and Rac1 small GTPases on the development of epithelial (MDCK) cell polarity. J. Cell Biol. 142, 85-100.
Klingelhofer, J., Laur, O. Y., Troyanovsky, R. B. and Troyanovsky, S. M. (2002). Dynamic interplay between adhesive and lateral E-cadherin dimers. Mol. Cell. Biol. 22, 7449-7458.
Kooistra, M. R., Dube, N. and Bos, J. L. (2007). Rap1: a key regulator in cell-cell junction formation. J. Cell Sci. 120, 17-22.
Larue, L., Ohsugi, M., Hirchenhain, J. and Kemler, R. (1994). E-cadherin null mutant embryos fail to form a trophectoderm epithelium. Proc. Natl. Acad. Sci. USA 91, 8263-8267.
Li, J., Zhu, X., Chen, M., Cheng, L., Zhou, D., Lu, M. M., Du, K., Epstein, J. A. and Parmacek, M. S. (2005). Myocardin-related transcription factor B is required in cardiac neural crest for smooth muscle differentiation and cardiovascular development. Proc. Natl. Acad. Sci. USA 102, 8916-8921.
Li, S., Chang, S., Qi, X., Richardson, J. A. and Olson, E. N. (2006). Requirement of a myocardin-related transcription factor for development of mammary myoepithelial cells. Mol. Cell. Biol. 26, 5797-5808.
Lozano, E., Betson, M. and Braga, V. M. (2003). Tumor progression: small GTPases and loss of cell-cell adhesion. BioEssays 25, 452-463.[CrossRef][Medline]
Lynch, E. A., Stall, J., Schmidt, G., Chavrier, P. and D'Souza-Schorey, C. (2006). Proteasome-mediated degradation of Rac1-GTP during epithelial cell scattering. Mol. Biol. Cell 17, 2236-2242.
Mack, C. P., Somlyo, A. V., Hautmann, M., Somlyo, A. P. and Owens, G. K. (2001). Smooth muscle differentiation marker gene expression is regulated by RhoA-mediated actin polymerization. J. Biol. Chem. 276, 341-347.
Masszi, A., Fan, L., Rosivall, L., McCulloch, C. A., Rotstein, O. D., Mucsi, I. and Kapus, A. (2004). Integrity of cell-cell contacts is a critical regulator of TGF-beta 1-induced epithelial-to-myofibroblast transition: role for beta-catenin. Am. J. Pathol. 165, 1955-1967.
Matter, K. and Balda, M. S. (2003). Signalling to and from tight junctions. Nat. Rev. Mol. Cell Biol. 4, 225-236.[CrossRef][Medline]
Miralles, F., Posern, G., Zaromytidou, A. I. and Treisman, R. (2003). Actin dynamics control SRF activity by regulation of its coactivator MAL. Cell 113, 329-342.[CrossRef][Medline]
Miyake, Y., Inoue, N., Nishimura, K., Kinoshita, N., Hosoya, H. and Yonemura, S. (2006). Actomyosin tension is required for correct recruitment of adherens junction components and zonula occludens formation. Exp. Cell Res. 312, 1637-1650.[CrossRef][Medline]
Mohun, T., Garrett, N. and Treisman, R. (1987). Xenopus cytoskeletal actin and human c-fos gene promoters share a conserved protein-binding site. EMBO J. 6, 667-673.[Medline]
Morita, T., Mayanagi, T. and Sobue, K. (2007). Dual roles of myocardin-related transcription factors in epithelial mesenchymal transition via slug induction and actin remodeling. J. Cell Biol. 179, 1027-1042.
Nakagawa, M., Fukata, M., Yamaga, M., Itoh, N. and Kaibuchi, K. (2001). Recruitment and activation of Rac1 by the formation of E-cadherin-mediated cell-cell adhesion sites. J. Cell Sci. 114, 1829-1838.[Abstract]
Noren, N. K., Niessen, C. M., Gumbiner, B. M. and Burridge, K. (2001). Cadherin engagement regulates Rho family GTPases. J. Biol. Chem. 276, 33305-33308.
Oh, J., Richardson, J. A. and Olson, E. N. (2005). Requirement of myocardin-related transcription factor-B for remodeling of branchial arch arteries and smooth muscle differentiation. Proc. Natl. Acad. Sci. USA 102, 15122-15127.
Perl, A. K., Wilgenbus, P., Dahl, U., Semb, H. and Christofori, G. (1998). A causal role for E-cadherin in the transition from adenoma to carcinoma. Nature 392, 190-193.[CrossRef][Medline]
Pokutta, S., Herrenknecht, K., Kemler, R. and Engel, J. (1994). Conformational changes of the recombinant extracellular domain of E-cadherin upon calcium binding. Eur. J. Biochem. 223, 1019-1026.[Medline]
Posern, G. and Treisman, R. (2006). Actin' together: serum response factor, its cofactors and the link to signal transduction. Trends Cell Biol. 16, 588-596.[CrossRef][Medline]
Posern, G., Sotiropoulos, A. and Treisman, R. (2002). Mutant actins demonstrate a role for unpolymerized actin in control of transcription by serum response factor. Mol. Biol. Cell 13, 4167-4178.
Posern, G., Miralles, F., Guettler, S. and Treisman, R. (2004). Mutant actins that stabilise F-actin use distinct mechanisms to activate the SRF coactivator MAL. EMBO J. 23, 3973-3983.[CrossRef][Medline]
Ren, X. D. and Schwartz, M. A. (2000). Determination of GTP loading on Rho. Meth. Enzymol. 325, 264-272.[Medline]
Sahai, E. and Marshall, C. J. (2002). ROCK and Dia have opposing effects on adherens junctions downstream of Rho. Nat. Cell Biol. 4, 408-415.[CrossRef][Medline]
Sahai, E. and Olson, M. F. (2006). Purification of TAT-C3 exoenzyme. Meth. Enzymol. 406, 128-140.[Medline]
Sahai, E., Alberts, A. S. and Treisman, R. (1998). RhoA effector mutants reveal distinct effector pathways for cytoskeletal reorganization, SRF activation and transformation. EMBO J. 17, 1350-1361.[CrossRef][Medline]
Sotiropoulos, A., Gineitis, D., Copeland, J. and Treisman, R. (1999). Signal-regulated activation of serum response factor is mediated by changes in actin dynamics. Cell 98, 159-169.[CrossRef][Medline]
Sun, Y., Boyd, K., Xu, W., Ma, J., Jackson, C. W., Fu, A., Shillingford, J. M., Robinson, G. W., Hennighausen, L., Hitzler, J. K. et al. (2006). Acute myeloid leukemia-associated Mkl1 (Mrtf-a) is a key regulator of mammary gland function. Mol. Cell. Biol. 26, 5809-5826.
Vartiainen, M. K., Guettler, S., Larijani, B. and Treisman, R. (2007). Nuclear actin regulates dynamic subcellular localization and activity of the SRF cofactor MAL. Science 316, 1749-1752.
Vasioukhin, V., Bauer, C., Yin, M. and Fuchs, E. (2000). Directed actin polymerization is the driving force for epithelial cell-cell adhesion. Cell 100, 209-219.[CrossRef][Medline]
Wells, C. M., Walmsley, M., Ooi, S., Tybulewicz, V. and Ridley, A. J. (2004). Rac1-deficient macrophages exhibit defects in cell spreading and membrane ruffling but not migration. J. Cell Sci. 117, 1259-1268.
Winer, J., Jung, C. K., Shackel, I. and Williams, P. M. (1999). Development and validation of real-time quantitative reverse transcriptase-polymerase chain reaction for monitoring gene expression in cardiac myocytes in vitro. Anal. Biochem. 270, 41-49.[CrossRef][Medline]
Yamada, S., Pokutta, S., Drees, F., Weis, W. I. and Nelson, W. J. (2005). Deconstructing the cadherin-catenin-actin complex. Cell 123, 889-901.[CrossRef][Medline]
Ziegler, W. H., Liddington, R. C. and Critchley, D. R. (2006). The structure and regulation of vinculin. Trends Cell Biol. 16, 453-460.[CrossRef][Medline]
Zondag, G. C., Evers, E. E., ten Klooster, J. P., Janssen, L., van der Kammen, R. A. and Collard, J. G. (2000). Oncogenic Ras downregulates Rac activity, which leads to increased Rho activity and epithelial-mesenchymal transition. J. Cell Biol. 149, 775-782.
This article has been cited by other articles:
![]() |
A. Masszi, P. Speight, E. Charbonney, M. Lodyga, H. Nakano, K. Szaszi, and A. Kapus Fate-determining mechanisms in epithelial-myofibroblast transition: major inhibitory role for Smad3 J. Cell Biol., February 8, 2010; 188(3): 383 - 399. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Huet, Y. Merot, F. Percevault, C. Tiffoche, J.-F. Arnal, N. Boujrad, F. Pakdel, R. Metivier, and G. Flouriot Repression of the Estrogen Receptor-{alpha} Transcriptional Activity by the Rho/Megakaryoblastic Leukemia 1 Signaling Pathway J. Biol. Chem., December 4, 2009; 284(49): 33729 - 33739. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||