spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 11 March 2008
doi: 10.1242/jcs.014456


Journal of Cell Science 121, 1025-1035 (2008)
Published by The Company of Biologists 2008
This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow All Versions of this Article:
jcs.014456v1
121/7/1025    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Busche, S.
Right arrow Articles by Posern, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Busche, S.
Right arrow Articles by Posern, G.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Research Article

Epithelial cell-cell contacts regulate SRF-mediated transcription via Rac-actin-MAL signalling

Stephan Busche1, Arnaud Descot1, Sylvia Julien1, Harald Genth2 and Guido Posern1,*

1 Department of Molecular Biology, AG Regulation of Gene Expression, Max-Planck-Institute of Biochemistry, 82152 Martinsried, Germany
2 Institute of Toxicology, Hannover Medical School, 30625 Hannover, Germany

* Author for correspondence (e-mail: posern{at}biochem.mpg.de)

Accepted 16 January 2008


    Summary
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Epithelial cell-cell junctions are specialised structures connecting individual cells in epithelial tissues. They are dynamically and functionally linked to the actin cytoskeleton. Disassembly of these junctions is a key event during physiological and pathological processes, but how this influences gene expression is largely uncharacterised. Here, we investigate whether junction disassembly regulates transcription by serum response factor (SRF) and its coactivator MAL/MRTF. Ca2+-dependent dissociation of epithelial integrity was found to correlate strictly with SRF-mediated transcription. In cells lacking E-cadherin expression, no SRF activation was observed. Direct evidence is provided that signalling occurs via monomeric actin and MAL. Dissociation of epithelial junctions is accompanied by induction of RhoA and Rac1. However, using clostridial cytotoxins, we demonstrate that Rac, but not RhoA, is required for SRF and target gene induction in epithelial cells, in contrast to serum-stimulated fibroblasts. Actomyosin contractility is a prerequisite for signalling but failed to induce SRF activation, excluding a sufficient role of the Rho-ROCK-actomyosin pathway. We conclude that E-cadherin-dependent cell-cell junctions facilitate transcriptional activation via Rac, G-actin, MAL and SRF upon epithelial disintegration.

Key words: Clostridial toxins, Epithelial junctions, Gene expression


    Introduction
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Epithelial monolayers line many body compartments and are characterised by strong adhesions between neighbouring cells to restrict transcellular passage of macromolecules and solutes. These cell-cell contacts include tight junctions and adherens junctions, which are functionally but dynamically connected to the circumferential actin belt (Drees et al., 2005Go; Gumbiner, 2005Go; Halbleib and Nelson, 2006Go; Matter and Balda, 2003Go; Yamada et al., 2005Go). Transmembrane proteins within these apical junctional complexes link adjacent cells together, while they are tethered to cytoplasmic plaque proteins that function as adapters and regulators. A key component of the adherens junctions is E-cadherin, which forms homophilic trans-interactions at sites of cell-cell contacts in the presence of Ca2+ (Gumbiner, 2005Go; Halbleib and Nelson, 2006Go). These are vital for initiating and maintaining epithelial architecture in vitro and in vivo (Gumbiner et al., 1988Go; Larue et al., 1994Go; Perl et al., 1998Go).

Formation of epithelial junctions involves Rho family GTPases and a dynamic and contractile actin cytoskeleton (Braga et al., 1997Go; Braga and Yap, 2005Go; Jou and Nelson, 1998Go; Nakagawa et al., 2001Go; Noren et al., 2001Go; Sahai and Marshall, 2002Go; Vasioukhin et al., 2000Go). However, during embryonic development, tissue remodelling and tumour progression, disintegration of epithelial junctions is a key event, allowing epithelial-mesenchymal transition (EMT). In vitro, junction disassembly can be induced by depletion of extracellular Ca2+ (Klingelhofer et al., 2002Go). Internalisation and breakdown of the apical junctional complexes involves clathrin-mediated endocytosis and actomyosin contractility (de Rooij et al., 2005Go; Ivanov et al., 2004Go). This process is initiated and controlled during physiological and pathological conditions by cytokines, toxins and growth factors such as TGFβ, and leads to developmental or pathological EMT (Grunert et al., 2003Go; Janda et al., 2006Go; Masszi et al., 2004Go). Indeed, Ca2+ depletion activates the promoter of the mesenchymal marker smooth muscle actin, which is potentiated by TGFβ (Fan et al., 2007Go; Masszi et al., 2004Go). The disassembly of epithelial junctions can also be caused by constitutively active or dominant-negative variants of Rho and Rac GTPases (Lozano et al., 2003Go).

Rho-mediated changes in actin dynamics regulate transcription in serum-stimulated fibroblasts (reviewed by Posern and Treisman, 2006Go). A key regulatory step is the release of the transcriptional co-activator MAL/MKL1/MRTF-A from monomeric G-actin (Miralles et al., 2003Go). Upon RhoA-induced dissociation from G-actin and nuclear accumulation, MAL activates serum response factor (SRF)-dependent target genes (Mack et al., 2001Go; Miralles et al., 2003Go; Vartiainen et al., 2007Go). Both MAL and SRF are widely expressed and form complexes with promoter elements termed CArG-boxes (Posern and Treisman, 2006Go). Serum-stimulated SRF activity in fibroblasts is blocked by inhibition of RhoA and ectopic expression of either non-polymerisable actin mutants such as actin R62D or dominant-negative MAL constructs (Hill et al., 1995Go; Miralles et al., 2003Go; Posern et al., 2002Go). Vice versa, Rho family GTPases, LIMK, Dia1 and F-actin stabilising actin mutants such as actin G15S activate SRF (Copeland and Treisman, 2002Go; Hill et al., 1995Go; Posern et al., 2004Go; Sotiropoulos et al., 1999Go). In mice, SRF and the MAL paralogue MRTF-B are essential, whereas MAL/MRTF-A-depleted mice show only minor defects in lactation, probably owing to partial functional redundancy (Arsenian et al., 1998Go; Li et al., 2005Go; Li et al., 2006Go; Oh et al., 2005Go; Sun et al., 2006Go).

Owing to their important role, epithelial junctions have been studied extensively, but how they influence gene expression is less clear. Using the largely serum-insensitive MDCK and EpRas cell lines as model systems, we show here that the dissociation of epithelial junctions activates SRF via actin dynamics and MAL. Time-course experiments, concentration dependence and the use of E-cadherin-deficient cell lines suggest that disruption of epithelial junctions triggers the transcriptional activation following Ca2+ withdrawal. The small GTPase Rac is critically involved in SRF activation and target gene induction in epithelial cells, whereas ROCK and actomyosin contraction are not sufficient.


    Results
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
SRF activation in epithelial cells
Disassembly of cell-cell adhesions is a key process during the disintegration of epithelial sheets and epithelial-mesenchymal transition, but little is known about how this influences transcriptional regulation. To test this, we transiently transfected MDCK cells with a luciferase reporter plasmid for the transcription factor SRF. This reporter is activated by the G-actin-MAL pathway, but not by Ras-MAPK-TCF signalling (Hill et al., 1995Go; Miralles et al., 2003Go). The transfected MDCK cells were allowed to form typical cell-cell junctions in confluent epithelial monolayers. We then exchanged the culture medium with medium containing physiological (1.8 mM) or reduced amounts of Ca2+. We found a significant induction of SRF upon Ca2+ withdrawal (Fig. 1A), as measured by luciferase activity. This effect was concentration dependent, with a threshold of about 0.04 mM Ca2+. By contrast, confluent MDCK cells do not respond significantly to serum (Fig. 1C; P=0.2 in Student's unpaired t-test). Moreover, the induction of the reporter by low Ca2+was strictly dependent on SRF: a mutated reporter lacking functional SRF-binding sites failed to show any induction (Fig. 1C), although its luciferase activities were reduced 20-fold in both conditions (data not shown).


Figure 1
View larger version (36K):
[in this window]
[in a new window]

 
Fig. 1. Dissociation of epithelial junctions activates SRF-mediated transcription. (A) Dose-response curve of SRF activity. 1.5x106 MDCK cells were transiently transfected with SRF reporter p3DA-Luc (1.2 µg). Transfected cells were reseeded to form a confluent monolayer (600,000 per 1-cm diameter) and cultured in DMEM containing the physiological Ca2+ concentration (1.8 mM) for 24 hours. Then the medium was exchanged to the indicated amounts of Ca2+ and luciferase activity was measured 7 hours later. Shown is the relative luciferase activity normalised to protein amount. (B) Morphology and epithelial junction integrity of confluent monolayers after medium exchange to the Ca2+ amounts indicated in A. Cells were fixed and analysed by phase-contrast microscopy or immunostained for E-cadherin (DECMA-1). (C) SRF luciferase reporter activation on tissue culture plastic or in fully polarised cells grown on microporous membranes. Cells were either transfected with p3DA-Luc (3 x SRF) or a reporter containing SRF binding site mutations (mut.) and treated as in A. For comparison, cells were treated for 7 hours with 15% serum following 18 hours starvation (FCS) (left). To form a confluent monolayer 175,000 p3DA-Luc transfected cells were seeded on a Transwell filter (BD Falcon), and medium exchange was 24 hours later (right). (D) SRF activity in cells lacking E-cadherin expression. Rac V12 served as a positive control for the existence of a functional pathway in these cells. Transfection and stimulation was as before. E-cadherin expression (inset) in the three cell lines was determined by western blotting using anti-E-cadherin (clone 36, BD Transduction Laboratories). Mock, medium exchange with 1.8 mM Ca2+; –Ca2+, medium exchange with 0.02 mM Ca2+. Error bars indicate s.e.m. of three independent experiments. Stars indicate statistical significance at P<=0.05 according to Student's unpaired t-test.

 

Withdrawal of extracellular Ca2+ results in the breakdown of cell-cell junctions including tight junctions and the E-cadherin-containing adherens junctions (Capaldo and Macara, 2007Go; Klingelhofer et al., 2002Go; Nakagawa et al., 2001Go). Monitoring E-cadherin localisation by immunofluorescence demonstrated a loss of E-cadherin staining at cell-cell junctions when Ca2+ concentration was reduced (Fig. 1B). Similarly, the disruption of epithelial cell-cell adhesion and the subsequent cell rounding became apparent in phase-contrast microscopy. The threshold Ca2+ concentration of 0.04 mM strictly correlated for all effects, including F-actin rearrangement (Fig. 3C), suggesting that dissociation of epithelial cell-cell contacts is linked to SRF activation. EGTA treatment to deplete Ca2+ ions from confluent MDCK cells led to comparable results, but we observed strong toxicity upon extended treatment, maybe owing to perturbation of the intracellular level of divalent cations (data not shown). By contrast, medium exchange to low Ca2+ did not elicit any apparent harm to MDCK cells for several days (not shown).


Figure 3
View larger version (38K):
[in this window]
[in a new window]

 
Fig. 3. Disrupted cell contacts activate SRF via monomeric actin. (A) MDCK cells were transfected with the SRF reporter p3DA-Luc (1.2 µg), pRL-TK (1 µg) and, if indicated, with 2.5 µg of wild-type actin (wt.) or the non-polymerisable actin mutant R62D and reseeded to form a confluent monolayer. Latrunculin B (LatB, 1 µM) was added 30 minutes before medium exchange. Shown is the mean luciferase activity, measured 7 hours after Ca2+ withdrawal. Error bars indicate s.e.m. (n=4). (B) Junction assembly and disassembly in cells expressing Flag-tagged actins. Cells were transfected with Flag-tagged actin wt., R62D or G15S, and seeded to form a confluent monolayer. 24 hours later, the medium was exchanged as indicated; after 7 hours incubation, cells were fixed and stained for Flag and E-cadherin (DECMA-1). Immunofluorescence micrographs are shown from cells maintained in physiological (upper panels) or low (lower panels) Ca2+. Transfected cells are marked by stars. (C) Correlation of F-actin reorganisation and Ca2+ level. Medium containing the indicated Ca2+ concentration was exchanged on a confluent monolayer of MDCK cells. After 7 hours, cells were fixed and F-actin was visualised with rhodamin-phalloidin. Mock, medium exchange with 1.8 mM Ca2+; –Ca2+, medium exchange with 0.02 mM Ca2+. Bars, 50 µm.

 


Figure 2
View larger version (38K):
[in this window]
[in a new window]

 
Fig. 2. Time course of epithelial disintegration and SRF induction. (A) Scheme of the reporter plasmid for life imaging. Three SRF-binding sites were inserted in front of an EGFP expression cassette containing a PEST domain for fast proteasomal degradation. (B) Time-lapse images of living cells harbouring the EGFP reporter. Confluent monolayers of stably transfected MDCK cells were microscopically analysed to monitor EGFP expression (upper panel) and cell shape changes (lower panel) upon Ca2+ switch to 0.02 mM for the indicated times. Mock indicates medium exchange to normal (1.8 mM) Ca2+ for 7 hours to exclude any potential alterations by addition of fresh medium or shear forces. (C) Induction profile showing the time course of EGFP expression in B. The arbitrary fluorescence intensity was calculated by subtracting the fluorescence at each time point in the mock experiment from the equivalent fluorescence value upon Ca2+ withdrawal.

 
To follow the time course of SRF activation, we engineered a reporter construct harbouring a destabilised EGFP controlled by three SRF-binding sites (Fig. 2A). MDCK cells were stably transfected and EGFP expression and cell shape were analysed by time lapse microscopy. EGFP was observable 3 hours after medium exchange to low Ca2+ and maintained for around 7 hours before it declined, consistent with a transient SRF activation (Fig. 2B and supplementary material Movie 1). Induction was preceded by dissociation of cell-cell adhesions, which was completed within 15 minutes (Fig. 2B and supplementary material Movie 2). Medium exchange alone, however, did not induce EGFP expression (Fig. 2B, mock). Quantitation of the fluorescence intensity showed that EGFP expression peaked at 8 hours (Fig. 2C), consistent with the luciferase reporter activation. Several independently isolated clones showed similar results, with variations mainly in their background and signal-to-noise ratio (data not shown). Together, these data indicate that SRF-mediated transcription is transiently activated by dissociation of cell-cell adhesions in epithelial cells.

Role of E-cadherin containing apical junctions
To ensure proper basolateral polarisation, we repeated the luciferase reporter assay with cells seeded on Transwell filters (Grunert et al., 2003Go). Again, SRF was activated following Ca2+ withdrawal (Fig. 1C). This demonstrates that full epithelial polarisation on microporous membranes neither negatively nor positively influences the required signalling, and that the junctions that form on uncoated tissue culture dishes are sufficient for regulation. Thus, the likely reason for the observed effects of Ca2+ withdrawal on SRF activity is the dissociation of E-cadherin dependent apical junctions. To further test this, cells lacking E-cadherin expression were subjected to Ca2+-reduced medium. Neither MDA-MB 435S cells, a mammary carcinoma cell line, nor AGS cells, a gastric adenocarcinoma cell line, responded to Ca2+ withdrawal (Fig. 1D). There was no indication that basal SRF activity is increased in these cell lines, which could disguise a further activation (not shown). Whereas MDA-MB 435S did not show proper epithelial morphology, AGS cells still formed epithelial sheet-like cell clusters, although both lines lacked any detectable E-cadherin expression (Fig. 1D, inset). However, the principal signalling pathways from Rho family GTPases to SRF are intact, as shown by reporter induction with activated Rac1 (Fig. 1D) and RhoA (not shown). This demonstrates that intact apical junctions function as the Ca2+ sensor responsible for SRF regulation in epithelial cells.

Disrupted cell contacts signal via monomeric actin and MAL
In fibroblasts, serum stimulation of SRF is blocked by increased level of cellular G-actin, because the SRF co-activator MAL/MRTF binds to G-actin and is thereby inhibited (Miralles et al., 2003Go; Posern et al., 2002Go). We thus asked whether elevation of the cellular G-actin by ectopic expression of actin or latrunculin B treatment interferes with signalling to SRF in epithelial cells. Transfection of wild-type β-actin and the non-polymerisable mutant actin R62D efficiently reduced SRF activation by Ca2+ withdrawal (Fig. 3A). Likewise, latrunculin B blocked SRF reporter activity. By contrast, the F-actin stabilising mutant actin G15S activated SRF to similar levels both at physiological and reduced Ca2+ concentrations (Fig. 4A; data not shown), consistent with its effect in fibroblasts (Posern et al., 2004Go). Expression of either actin wild type, R62D or G15S did not change the E-cadherin localisation at normal or low Ca2+ levels, excluding the possibility that the effects of the actin mutants on SRF were caused by altering formation or disruption of epithelial junctions in transfected cells (Fig. 3B). The F-actin cytoskeleton, visualised by phalloidin staining, showed a prominent reorganisation when subjected to low Ca2+ (Fig. 3C). Whereas diffuse F-actin staining disappeared, thick bundles of cortical actin formed in the separating cells when the Ca2+ level dropped below the threshold of 0.04 mM. This suggests that changes in actin dynamics, particular in the G-actin level, transduce a signal to SRF in dissociating epithelial cells.


Figure 4
View larger version (29K):
[in this window]
[in a new window]

 
Fig. 4. Dissociating epithelial junctions regulate SRF via MAL. (A) Effects of MAL constructs or the F-actin stabilising mutant actin G15S. 0.4 µg MAL (f.l.), 2.5 µg MAL {Delta}N{Delta}B1, 2.5 µg MAL {Delta}N{Delta}C, 0.4 µg MAL {Delta}N (scheme) or 2.5 µg actin G15S were co-transfected and Ca2+ exchange was carried out as in Fig. 3A. Luciferase activity is normalised to pRL-TK, with error bars indicating s.e.m. (n=3). (B) Dissociation of the actin-MAL complex upon Ca2+ withdrawal. MDCK cells were electroporated with 10 µg Flag-actin and 10 µg MAL-HA. 36 hours later, the medium was exchanged to low Ca2+ for the times indicated and cell lysates were immunoprecipitated with anti Flag. Proteins were visualised using antibodies against Flag and HA-tags. Latrunculin B (3 µM) or cytochalasin D (10 µM) was added 30 minutes before medium exchange. Relative association was calculated from densitometric analysis. Mock, medium exchange with 1.8 mM Ca2+; –Ca2+, medium exchange with 0.02 mM Ca2+.

 

To investigate the role of the SRF co-activator MAL/MRTF-A, we transfected full-length MAL and a constitutively active form, MAL {Delta}N, which lacks the repressive RPEL motifs responsible for G-actin binding (Miralles et al., 2003Go). Full length MAL (f.l.) activated SRF, which was further elevated by Ca2+ withdrawal, whereas MAL {Delta}N was sufficient to activate SRF fully even in the presence of Ca2+ (Fig. 4A. By contrast, two different dominant-negative forms of MAL, MAL {Delta}N{Delta}B1 and MAL {Delta}N{Delta}C, both slightly but significantly reduced the activity of SRF upon Ca2+ withdrawal (Fig. 4A).

The crucial step in SRF regulation by MAL is the dissociation of the inhibitory G-actin:MAL complex (Vartiainen et al., 2007Go). Using co-immunoprecipitation, we analysed the actin:MAL complex in MDCK cells upon epithelial disintegration. Ca2+ withdrawal resulted in the rapid and transient dissociation of MAL from actin (Fig. 4B). By contrast, latrunculin B stabilised the complex, whereas cytochalasin D, an activator of MAL and SRF, resulted in actin:MAL dissociation. Moreover, the upward shift probably indicates the phosphorylation of MAL, which is associated with SRF activation, similar to the previous observations in fibroblasts (Miralles et al., 2003Go). Together, the results demonstrate that SRF regulation in dissociating epithelial cells occurs via G-actin and MAL/MRTF co-activators.


Figure 5
View larger version (39K):
[in this window]
[in a new window]

 
Fig. 5. SRF activation by dissociating epithelial junctions is dependent on Rac, but not on RhoA or Cdc42 activation. (A) Activity of endogenous RhoA, Rac1 and Cdc42 upon Ca2+ withdrawal. MDCK cells were seeded to form a confluent monolayer. 36 hours later, the medium was exchanged. After the indicated times, cells were lysed and GST-Rhotekin or GST-PAK-CRIB pull-down assays were employed. Uncoupled beads (control) or lysates incubated with GTP{gamma}S served as negative and positive controls, respectively. Precipitated proteins (upper panels) and total lysates (lower panels) were blotted using antibodies against RhoA, Rac1 or Cdc42. Pairwise densitometric analysis of the fold induction is shown below each panel. (B) Effect of the inhibition of Rac1 or RhoA on SRF. MDCK cells were transfected and treated as in Fig. 1A. Prior to medium exchange, cells were preincubated with equipotent concentrations of TcdBF (0.1, 0.25 or 0.75 µg/ml) or TcdB (0.3, 1 or 3 ng/ml) for 4 hours, and with Tat-C3 (0.3, 1 or 3 µM) for 15 hours. Inhibitor treatment was maintained throughout the assay. Shown is the mean luciferase activity normalised to protein. (C) Specificity of TcdBF, TcdB and Tat-C3 on Rac1 and RhoA. When indicated, cells were preincubated with TcdBF (0.25 µg/ml, 4 hours), TcdB (1 ng/ml, 4 hours) or Tat-C3 (1 µM, 15 hours). Activity of Rac1 and RhoA was measured as in A, either 5 or 2 minutes after medium exchange, respectively. (D) E-cadherin localisation of cells treated with TcdBF, Tat-C3, TcdB or vehicle. Confocal immunofluorescence micrographs of MDCK cells treated for 11 hours (TcdBF, TcdB) or 22 hours (Tat-C3) in normal medium, as before. Cells were fixed and stained for E-cadherin. (E) Effect of constitutive active Rac1 or RhoA on SRF activity. 2.5 µg RacV12 or RhoQ63L were co-transfected and cells were treated as in Fig. 3A. Shown is the relative SRF luciferase reporter activity normalised to pRL-TK. (F) Effect of the inhibition of RhoA on SRF in NIH3T3 fibroblasts. Cells (35,000 per 1-cm diameter) were transfected with p3DA-Luc (20 ng) and pRL-TK (50 ng). After transfection, cells were maintained in starvation medium (0.5% FCS) for 20 hours before stimulation with 15% FCS. Tat-C3 treatment of NIH3T3 cells was as in B for MDCK cells. Mock, medium exchange with 1.8 mM Ca2+; –Ca2+, medium exchange with 0.02 mM Ca2+. Error bars indicate s.e.m. (n=3). Stars indicate statistical significance at P<=0.05 according to the Student's unpaired t-test.

 
Involvement of Rho family members
Rho family GTPases are involved in both adherens junction formation and SRF regulation (Braga and Yap, 2005Go; Hill et al., 1995Go; Nakagawa et al., 2001Go). We reasoned that Rho family GTPases are particularly and rapidly sensitive to shear stress. We therefore analysed the GTP loading of RhoA, Rac1 and Cdc42 using Rhotekin-RBD and Pak-CRIB pull-down assays, respectively, in MDCK cells after medium exchange to Ca2+-reduced or normal medium. Rac1 and RhoA, but not Cdc42, were rapidly activated upon Ca2+ reduction (Fig. 5A). Pairwise quantitation showed that the activation of Rac1 and RhoA declined below background level after 2 hours (Fig. 5A). Averaged over three independent experiments, peak activation of Rac at 3 minutes was 3.9±0.9-fold (for Rho it was 3.2±1.0-fold; data are given ± s.e.m.). This transient activation of Rac1 and RhoA indicates a role for Rho GTPases not only in formation of epithelial cell-cell contacts but also in junction disruption.

To determine whether RhoA and Rac1 are able to activate SRF in MDCK cells, cells were transfected with constitutively active versions of either Rac1 or RhoA. Both were sufficient to activate SRF-mediated transcription, as determined by the luciferase reporter (Fig. 5E).

Requirement of Rac
To test directly whether SRF activation upon Ca2+ withdrawal depends on Rho signalling, we took advantage of the cell-permeable exoenzyme C3 from Clostridium botulinum (Tat-C3), a specific inhibitor of RhoA, and two isoforms of Toxin B from C. difficile, the Rho/Rac/Cdc42-inactivating TcdB and the Rac/R-Ras-inactivating TcdBF (Huelsenbeck et al., 2007Go; Sahai and Marshall, 2002Go). Ca2+ was removed from confluent epithelial MDCK cells pretreated with either inhibitor and cells were analysed for SRF activity. Induction of SRF by low Ca2+ was found to be responsive to concentration-dependent inhibition by TcdB and TcdBF, but not by Tat-C3, suggesting that Rac1 rather than RhoA is required (Fig. 5B). Inhibition of either RhoA by Tat-C3 or TcdB or Rac1 by TcdBF was confirmed using the respective effector pull-down assays (Fig. 5C); importantly, Tat-C3 was fully functional in the polarised epithelial cells and completely blocked GTP-loading of RhoA following Ca2+ withdrawal [from 3.7±1.1-fold to 0.99±0.15-fold (n=3)]. Treatment with TcdBF, TcdB or Tat-C3 interfered neither with the preformed epithelial junctions (Fig. 5D) nor with their disruption (data not shown) during the course of the experiment. Prolonged treatment of MDCK cells with the Rho family inhibitors, however, resulted in reticulated dissociation of the epithelial sheets, demonstrating that some activity of Rac1 and RhoA is necessary for the maintenance of proper cell-cell adhesion (data not shown).

In sharp contrast, SRF activation in NIH 3T3 fibroblasts was concentration dependently inhibited by Tat-C3 (Fig. 5F), showing that RhoA is essential for serum-stimulation of fibroblasts as reported (Hill et al., 1995Go). In epithelial cells, however, Rac1 rather than RhoA transmits the signal from dissociating epithelial junctions to SRF.

Target gene induction
We next extended our study of SRF activation to more physiological conditions under which junctions are disassembled or rearranged, independently of the extracellular Ca2+ level. During HGF-induced scattering of MDCK cells, a small but significant induction of SRF activity correlated with the disappearance of cell-cell contacts (Fig. 6A,B). Additionally, we used EpRas cells, which undergo epithelial-mesenchymal transition in vitro and in vivo following TGFβ treatment (Grunert et al., 2003Go). In contrast to the dog kidney MDCK cells, for which it has been questioned whether they have a typical zonula adherens (Miyake et al., 2006Go), EpRas cells are derived from the murine mammary gland and thus also allow monitoring of endogenous gene expression. First, following Ca2+ withdrawal, SRF was activated more than fivefold both in EpRas and the parental EpH4 cells (not shown), comparable with our observations in MDCK. Moreover, treatment of EpRas with TGFβ for 3 days, which results in disassembly of the epithelial junctions and actin reorganisation also induced SRF activity (Fig. 6C,D). This suggests that SRF activation is a general response upon dissociation of epithelial cell junctions.


Figure 6
View larger version (59K):
[in this window]
[in a new window]

 
Fig. 6. Induction of SRF and endogenous target genes during epithelial dissociation and EMT. (A) Relative SRF luciferase reporter activity in HGF-treated MDCK cells. Cells were transfected and 24 hours later HGF (40 ng/ml) was added for 24 hours prior to analysis of luciferase activity. Phase-contrast images of the cells prior to lysis are shown in B. (C) Effect of TGFβ on SRF activity in EpRas murine mammary epithelial cells. 24 hours after reseeding transfected EpRas cells, EMT was induced by TGFβ (5 ng/ml) for 72 hours. Shown is the relative luciferase activity. Phalloidin-stained cells are shown in D following EMT induction for 7 days. (E) Induction of the endogenous target genes for vinculin (vcl) and smooth muscle {alpha}-actin (acta2) upon junction disruption. RNA was isolated from confluent EpRas cells 3 hours after medium exchange and analysed by quantitative RT-PCR. Shown is the fold induction of the endogenous SRF target genes in 0.02 mM Ca2+, normalised to medium exchange with 1.8 mM Ca2+. (F) Effect of inhibiting Rac1 and RhoA on induction of acta2, determined as in E. Where indicated, cells were preincubated with Tat-C3 (1 µM, 15 hours), TcdB (0.3 ng/ml, 4 hours) or TcdBF (0.25 µg/ml, 4 hours). Error bars indicate s.e.m. (n=3). Stars indicate statistical significance at P<=0.01 according to the Student's unpaired t-test.

 

To test the induction of transcription of endogenous SRF target genes, we used quantitative real-time RT-PCR. Vinculin (Vcl) and smooth muscle {alpha}-actin (Acta2) are known SRF target genes which are activated via the actin-MAL, but not by the MAPK-TCF pathway (Du et al., 2004Go; Gineitis and Treisman, 2001Go). Both Vcl and Acta2 mRNAs were upregulated after 3 hours in low Ca2+ (Fig. 6E). The induction of Acta2, A marker for epithelial-mesenchymal transition, was diminished when Rac1 was blocked by either TcdBF or TcdB pretreatment (Fig. 6F). By contrast, inhibition of RhoA with Tat-C3 did not significantly reduce Acta2 induction (Fig. 6F). Consistent with the previous luciferase assays performed in MDCK cells, this result demonstrates the critical role of Rac1 (but not RhoA) in the pathway analysed.

Actomyosin contractility
Previous studies have shown that actomyosin contractility is required for internalisation and disassembly of the apical junctional complexes, as well as cell scattering (de Rooij et al., 2005Go; Ivanov et al., 2004Go). We therefore tested the effect of Blebbistatin, an inhibitor of non-muscle myosin II ATPase activity. Blebbistatin pretreatment inhibited the activation of SRF upon Ca2+ withdrawal (Fig. 7A). Similarly, inhibition of ROCK by Y-27632 abrogated SRF activation (Fig. 7A), in agreement with a recent study (Fan et al., 2007Go). To exclude side effects, we tested the activation of Rac1 and RhoA, which was maintained in Blebbistatin-treated cells (Fig. 7B). The internalisation of E-cadherin from the cell periphery was reduced (Fig. 7C), consistent with previous studies (Ivanov et al., 2004Go). We also observed, however, disorganised F-actin staining, and a loss of cytoskeletal reorganisation and cortical bundling following Ca2+ withdrawal (Fig. 7C). This suggests that actomyosin contractility is involved in SRF activation, probably by perturbing cytoskeletal F-actin structures.


Figure 7
View larger version (65K):
[in this window]
[in a new window]

 
Fig. 7. Actomyosin contractility is not sufficient to activate SRF. (A) Effect of Blebbistatin and Y-27632 on induction of SRF by Ca2+ withdrawal. MDCK cells were transfected and treated as before. Blebbistatin (100 µM, 2.5 hours pretreatment) and Y-27632 (20 µM, 30 minutes pretreatment) was added prior to medium exchange and maintained throughout the assay. (B) Rac1 and RhoA activity following Blebbistatin pretreatment. Pull-down assays were performed as in Fig. 5 for Rac1 or RhoA, either 5 or 2 minutes after medium exchange, respectively. (C) Blebbistatin effect on the actin cytoskeleton. Confluent monolayers were pretreated for 2.5 hours with Blebbistatin prior to medium exchange for 7 hours, as in A. Cells were fixed and stained for E-cadherin and F-actin (phalloidin). Shown are micrographs from cells maintained in normal (left) or low (right) Ca2+. (D) No effect of constitutively active ROCK{Delta}4 or the myosin-phosphatase inhibitor calyculin A on SRF activity. Calyculin A was added 30 minutes before medium exchange and maintained throughout the assay. (E) Influences of ROCK{Delta}4 and calyculin A on the actin cytoskeleton. Cells were transfected or treated as before and stained for myc (ROCK{Delta}4) and F-actin (phalloidin). Mock, medium exchange with 1.8 mM Ca2+; –Ca2+, medium exchange with 0.02 mM Ca2+; CalA, treated with calyculin A (5 nM). Error bars indicate s.e.m. (n=3). Bars, 50 µm.

 
We therefore examined whether actomyosin contractility plays a direct role in SRF-mediated transcription. In cells co-transfected with activated ROCK kinase, an upstream activator of myosin light chain phosphorylation, no elevated SRF activity was observed (Fig. 7D). In addition, inhibiting myosin light chain phosphatase by calyculin A also failed to activate SRF, despite both stimuli resulted in thick contractile F-actin bundles in phalloidin-stained cells (Fig. 7D,E). This demonstrates that actomyosin contractility is not sufficient for SRF activation and may not directly transmit signals from dissociating epithelial junctions to MAL.


    Discussion
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
We demonstrate that the disruption of cell-cell contacts in confluent epithelial monolayers activates specific gene expression in the nucleus. Three components of the signalling pathway, the GTPase Rac, G-actin and MAL/MRTF, are both required and sufficient for activation of the transcription factor SRF in epithelial cells (see Fig. 8). By titrating the extracellular Ca2+ level below a threshold of 0.04 mM, we show that dissociation of E-cadherin-dependent epithelial junctions precedes the induction of transcription in a SRF reporter cell line. This SRF activation correlates with changes in the actin cytoskeleton and dissociation of the G-actin:MAL complex. Ectopic expression of non-polymerisable mutant actins that bind to and inhibit MAL (Posern et al., 2002Go) block SRF activation. Conversely, F-actin stabilising mutant actins (Posern et al., 2004Go) activate SRF even in the presence of Ca2+, demonstrating an inhibitory role for monomeric actin in transcriptional activation of disintegrating epithelial sheets.


Figure 8
View larger version (18K):
[in this window]
[in a new window]

 
Fig. 8. Model of the regulation of MAL/SRF-dependent transcription by epithelial junctions. Disassembly of E-cadherin-mediated cell-cell contacts leads to transient activation of Rac and alterations in actin treadmilling. This releases the G-actin-mediated inhibition of MAL. GTP-loaded Rac is both required and sufficient for MAL and SRF activation upon epithelial disintegration, and subsequent transcription of endogenous target genes such as vinculin (vcl) and smooth muscle {alpha}-actin (acta2). Actomyosin contractility is a prerequisite for appropriate actin remodelling during this process. Blue bars represent transmembrane proteins.

 

Both adherens junctions and tight junctions are dynamically connected to the actin cytoskeleton, and disrupting them would expectedly interfere with F-actin structures. However, we demonstrate here that the small GTPase Rac is critically involved. The relationship between junctions and Rho family GTPases has been studied extensively, but mainly during formation of junctions (Braga et al., 1997Go; Noren et al., 2001Go) or HGF-induced scattering (Lynch et al., 2006Go; Zondag et al., 2000Go). We provide evidence that both Rac1 and RhoA are quickly and transiently GTP loaded when epithelial sheets are subjected to 0.02 mM Ca2+. By contrast, treatment with EGTA for 30 minutes has previously been shown to inhibit Rac localisation and activation, whereas RhoA remained unchanged under such conditions (Balzac et al., 2005Go; Nakagawa et al., 2001Go). This apparent discrepancy is probably explained either by junction-independent effects of EGTA, consistent with our observed toxicity upon extended treatment, or by the transient nature of the Rac and Rho activation, which previously might have been missed.

Activated forms of both RhoA and Rac are sufficient to activate SRF. However, only Rac proved to be required for activation of SRF-mediated transcription. We used clostridial cytotoxins to investigate the involvement of GTPases. Tat-C3 is a cell-permeable RhoA-specific ADP-ribosyltransferase (Sahai and Marshall, 2002Go). TcdB inhibits RhoA and Rac/Cdc42 by glucosylating Thr-37 and Thr-35 within the effector region, respectively (Huelsenbeck et al., 2007Go). Finally, TcdBF harbours the same receptor-binding and internalisation domain as TcdB, but has an altered glucosyltransferase specificity, targeting selectively Rac and R-Ras (Chaves-Olarte et al., 2003Go; Huelsenbeck et al., 2007Go). Comparing the effects of these toxins allows us to address the specific requirements for GTPases, unlike the expression of dominant-negative constructs that already interfere with the formation of junctions when reseeded to form confluent epithelial sheets (data not shown) (Braga et al., 1997Go; Jou and Nelson, 1998Go). Moreover, overexpression of RacN17 or RhoN19 may not necessarily result in the specificity previously anticipated (Wells et al., 2004Go). With the concentrations and times used here, the toxins efficiently blocked their specific target GTPase, while neither perturbing existing junctions (Fig. 5) nor junction disassembly following Ca2+ withdrawal (data not shown).

The specific requirement for Rac, but not for Rho, during SRF activation by dissociating epithelial junctions is contrasted by the situation in serum-stimulated fibroblasts. In NIH3T3 cells, the RhoA-inactivating C3 exoenzyme efficiently blocks SRF (Fig. 5F) (Hill et al., 1995Go). The effect of TcdBF is difficult to assess in fibroblasts, because these cells quickly round up and detach upon treatment; however, in detached cells, no concentration-dependent reduction of serum-induced SRF activity was observed (data not shown). In addition, confluent epithelial cells are hardly stimulatable by serum (Fig. 1C). These findings indicate that epithelial disintegration and serum stimulation use distinct upstream pathways, which converge at the level of G-actin to activate MAL/SRF dependent transcription.

Our studies with the toxins also exclude a role for R-Ras following Ca2+ withdrawal, as TcdB, which does not block R-Ras, inhibits SRF. A close relative to R-Ras, Rap1, has also been implicated in the regulation of cell-cell contacts of epithelial cells (Kooistra et al., 2007Go). Neither overexpression of RalGDS-RBD, a R-Ras- and Rap1-specific inhibitor, nor the Rap1-specific exchange factor Epac (with deleted regulatory cAMP-binding domain) affected SRF activity, suggesting that Rap1 is not directly involved (data not shown).

What is the function of RhoA activation following dissociation of transcellular junctions, if it is not involved in SRF activation? The Rho-ROCK signalling axis has been shown to disrupt junctions, and endocytosis and disassembly of the apical junctional complexes following Ca2+ withdrawal, as well as scattering of MDCK cells, depends on actomyosin contractility (de Rooij et al., 2005Go; Ivanov et al., 2004Go; Sahai and Marshall, 2002Go). Thus, RhoA may affect the internalisation and degradation of the junctional protein complexes via ROCK and regulation of non-muscle myosin II activity. Consistent with this, junctional proteins fail to internalise following Ca2+ withdrawal when pretreated with Blebbistatin (Fig. 7C) (Ivanov et al., 2004Go). This does not contradict a Rac-dependent signal from the junctions to MAL: the homophilic interactions are disrupted and Rac is still activated by Ca2+ withdrawal (Fig. 7B), but internalisation and actin remodelling is blocked (Fig. 7C). The low level of basal RhoA activity which is maintained during our Tat-C3 treatment appears to be sufficient to permit the Ca2+-induced actin remodelling and internalisation of junctional complexes (not shown), despite the complete block of induced GTP-loading (Fig. 5C).

The activation of SRF-mediated transcription and the loss of E-cadherin staining at sites of cell-cell contacts both exhibit a comparable concentration dependency on Ca2+, suggesting a causative connection between the two effects. It is important to note that the Ca2+ threshold reported here is considerably lower than that required for junction formation, however. This demonstrates that data from such reverse experiments are not directly comparable. Our experimental setup depends on the ability of the medium to deplete Ca2+ from existing cell junctions in a confluent monolayer, which probably explains the low concentration reported here and in previous studies (Capaldo and Macara, 2007Go; Klingelhofer et al., 2002Go; Pokutta et al., 1994Go).

Some mammary breast carcinoma and gastric adenocarcinoma cell lines lack the expression of E-cadherin. These cells do not only fail to form adherens junctions, but also lack proper tight junctions and desmosomes. We found that these E-cadherin deficient cells do not show any SRF activation in response to low Ca2+, suggesting a role of either E-cadherin or affected transmembrane proteins, including TJ components, in the cellular machinery sensing cell-cell dissociation. Future work will identify the molecular nature of the sensor and will characterise the link to Rac-dependent SRF-mediated transcription.

The ROCK inhibitor Y-27632 and the myosin ATPase inhibitor Blebbistatin blocked induction of SRF. While this manuscript was in preparation, another study showed that the smooth muscle {alpha}-actin promoter, which is regulated by MAL and SRF, is induced by disruption of intercellular contacts (Fan et al., 2007Go), consistent with our findings. In addition, they also showed that Y-27632 and Blebbistatin suppresses the smooth muscle {alpha}-actin promoter (Fan et al., 2007Go). At first sight, this indicates a role for actomyosin contractility. We showed, however, that Blebbistatin treatment leads to disassembly of the cellular F-actin and abrogates the cytoskeletal changes elicited by Ca2+ withdrawal (Fig. 7C). Consistent with this, loss of force has been shown to trigger the breakdown of F-actin and adhesion sites (Giannone and Sheetz, 2006Go). Thus, we speculate that a basal level of ROCK activity, myosin light chain phosphorylation and actomyosin contractility (Fan et al., 2007Go) is required for maintaining the integrity and treadmilling of the actin cytoskeleton, which is a prerequisite for signal transmission from Rac to MAL (Fig. 8). However, we cannot exclude more general effects of Blebbistatin on gene expression.

A direct role for actomyosin in SRF regulation is also inconsistent with our finding that inducing contractility with calyculin A or activated ROCK is not sufficient to induce SRF in epithelial cells (Fig. 7). Moreover, ROCK also fails to induce SRF in fibroblasts (Sahai et al., 1998Go). By contrast, activated mouse Dia1, which does not facilitate bundling or contraction but Rho- and ROCK-independent actin polymerisation, activates SRF in epithelial cells even in the presence of Ca2+ (data not shown). Thus, changing the treadmilling cycle of actin, and thereby the G-actin population in the cell, provides a critical signal, whereas the ROCK-actomyosin signalling axis is not sufficient for SRF regulation in epithelial cells.

The disintegration of epithelial junctions is a key event during epithelial-mesenchymal transition (EMT), which occurs during development and cancer metastasis. We demonstrate here the induction of the MAL-dependent SRF gene expression program during epithelial disintegration. The two known MAL-dependent SRF targets we tested, the genes encoding smooth muscle {alpha}-actin and vinculin, were upregulated in mouse mammary epithelial cells. The induction of vinculin could potentially result in stabilisation of cell-cell and cell-matrix adhesions (Ziegler et al., 2006Go). By contrast, smooth muscle actin is considered a mesenchymal marker, also in the EpRas EMT model system we used (Grunert et al., 2003Go). This raises exciting questions about the functional outcome of the dissociation-induced MAL and SRF activation, potentially pointing towards a positive feed-forward loop during EMT. Indeed, a very recent report showed that MRTFs are crucial mediators of EMT induced by TGFβ (Morita et al., 2007Go). The precise nature of these regulatory circuits remains to be elucidated.


    Materials and Methods
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Reagents, plasmids and cells
Details are available upon request. (–)-Blebbistatin, latrunculin B and calyculin A were purchased from Calbiochem. SRF luciferase reporter and actin mutants have been described previously (Posern et al., 2004Go; Posern et al., 2002Go). The control reporter lacking functional SRF-binding sites was derived from p3DA-Luc, with CCATATTAGG mutated to CCCAATCGGG (Hill and Treisman, 1995Go). Deletions in murine MAL were as follows: {Delta}N, 1-171; {Delta}B1, 316-341; {Delta}C, 563-1021; numbering based on pEF-MAL-HA (f.l.) (Miralles et al., 2003Go). Other plasmids were for Rac V12 (Hill et al., 1995Go), myc-ROCK{Delta}4 and RhoQ63L in pcDNA3 (gifts from Reinhard Faessler). The degradable EGFP expression plasmid p3DA-d2EGFP was generated by replacing the CMV promoter of pd2EGFP-N1 (BD Clontech) with three SRF-binding sites in front of a Xenopus actin TATA-box (Mohun et al., 1987Go). TcdB and TcdBF were purified as described from Clostridium difficile strains VPI 10463 and 1470, respectively (Huelsenbeck et al., 2007Go). The Tat-C3 expression plasmid was a gift from Eric Sahai (Cancer Research UK, London), and the fusion protein was expressed and purified from E. coli BL21 (Sahai and Olson, 2006Go).

Cells were grown in DMEM (Gibco) supplemented with 10% foetal calf serum (FCS, Gibco), except for EpRas cells, which require 4% FCS. For cells grown in confluent monolayers, the medium was refreshed every 24 hours. To disrupt Ca2+-dependent cell-cell contacts cells were washed once and then cultured in low calcium medium (calcium-free DMEM (Gibco) with 0.02 mM Ca2+ and FCS). For this medium, FCS was depleted of divalent cations using the Chelex 100 resin (Biorad) as described (Brennan et al., 1975Go). To generate MDCK cells stably expressing the SRF-EGFP reporter, transfected cells were selected in 600 µg/ml G418 and further maintained at 300 µg/ml.

Transfections, luciferase reporter assays and immunoprecipitations
Transfections were carried out using Lipofectamine (Invitrogen) for MDCK, NIH3T3, AGS and EpRas cells, and TransFast (Promega) for MDA-MB-435S cells, according to the manufacturers' protocols. 1.5x106 cells per 10-cm diameter dish were transfected with 1.2 µg p3DA-Luc, 1 µg pRL-TK, together with the indicated plasmids in a total of 5 µg vector. 18 hours after transfection cells were reseeded to form confluent monolayers (600,000 per 1-cm diameter or 175,000 per transwell filter). 24 hours after reseeding, the medium was exchanged and 7 hours later cells were lysed. Cells were pretreated with Tat-C3 for 15 hours, TcdBF or TcdB for 4 hours, Blebbistatin for 2.5 hours, latrunculin B or calyculin A for 30 minutes. NIH3T3 cells were transfected and serum stimulated as described (Posern et al., 2002Go). Firefly luciferase activity was normalized to either protein content or pRL-TK luciferase activity, as indicated. Figures show mean ± s.e.m. of at least three independent experiments. For each immunoprecipitation, 1x107 MDCK cells were electroporated with 20 µg of DNA in a GenePulser Xcell with CE and PC module (BioRad) using the square wave protocol (voltage, 250 V; pulse length, 10 ms; number of pulses, 3; pulse interval, 0.1 seconds) in a 4 mm GenePulser cuvette (Biorad). Cells were seeded in a 6-cm diameter dish. 36 hours later, medium was exchanged and cells were lysed in RIPA and immunoprecipitated in 1% Triton-X buffer (Miralles et al., 2003Go) for 2 hours, using M2 anti-flag agarose beads (Sigma-Aldrich).

Immunofluorescence microscopy and live cell imaging
For immunofluorescence microscopy, cells were fixed with 4% paraformaldehyde, permeabilized in 0.2% Triton X-100 and blocked with 10% FCS, 1% gelatine, 0.05% Triton X-100 in PBS. Staining condition were as follows: E-cadherin (DECMA-1, Sigma-Aldrich), 1:1000; M2 anti-Flag (Sigma-Aldrich), 1:500; rhodamin phalloidin (Molecular Probes), 1:40; anti-Myc (9E10, CR-UK), 1:100; Alexa Fluor 488 goat anti-mouse IgG (H+L) (Molecular Probes), 1:1000; TRITC anti-rabbit (Dako Cytomation), 1:40. Micrographs were taken using a Zeiss Axioplan 2 with MetaVue software (Molecular Devices), or a LEICA TCS SP2 AOBS confocal laser-scanning microscope. Live cell imaging was carried out on a Zeiss Axiovert microscope with MetaMorph software. The induction profile showing the time course of EGFP expression was calculated by subtracting the arbitrary fluorescence intensity at each time point in the mock experiment from the equivalent arbitrary fluorescence intensity upon Ca2+ withdrawal.

Quantitative RT-PCR
For quantitative RT-PCR, murine epithelial EpRas cells were seeded to form a confluent monolayer (550,000 per 1-cm diameter). 36 hours later the medium was exchanged, and after 3 hours RNA was isolated. Cells were pretreated with 1 µM Tat-C3 (15 hours), 0.25 µg/ml TcdBF (4 hours) or 0.3 ng/ml TcdB (4 hours). The inhibitor treatment was maintained throughout the assay. RNA preparation (Qiagen) and first-strand cDNA synthesis (ABgene) were carried out according to the manufacturers' protocol. For cDNA synthesis, 1 µg of RNA and anchored oligo-dT primers were used. For cDNA quantitation, 1/40th of the RT reaction was mixed with gene-specific primers (0.5 µM), MgCl2 (3 mM) and LightCycler FastStart DNA Master SYBR Green I mix (1.5 µl; Roche) to a total volume of 15.5 µl. The primers used are: hprt, tcagtcaacgggggacataaa (forward), ggggctgtactgcttaaccag (reverse); acta2, tgacgctgaagtatccgataga (forward), gtacgtccagaggcatagagg (reverse); and vinc, ggccggaccaacatcagtg (forward), atgtaccagccagatttgacg (reverse). PCR was carried out on a LightCycler instrument (Roche) according to the manufacturer's instructions. Calculations were made using the {Delta}{Delta}Ct method (Winer et al., 1999Go).

Small G-Protein pull-down assays
Preparation of GST-Rhotekin-RBD and GST-PAK-CRIB fusion protein was carried out using E. coli BL21 DE3 Rosetta. Induction of expression by 1 mM IPTG at 30°C for 90 minutes was followed by bacterial lysis in 50 mM Tris (pH 7.5), 1% Triton X-100, 150 mM NaCl, 5 mM MgCl2 and 1 mM DTT. The lysate was sonicated on ice (6x10 seconds) and the 25,000 g supernatant was snap-frozen in aliquots. Optimised amounts of lysate were used for coupling to glutathione sepharose beads (GE Healthcare) directly prior to GTPase pull-down assays (Ren and Schwartz, 2000Go). 1x107 MDCK cells were seeded in 10 cm dishes to form a confluent monolayer and cultured for 36 h. After medium exchange, cells were lysed in Rho lyses buffer [50 mM Tris (pH 7.5), 1% Triton X-100, 500 mM NaCl, 10 mM MgCl2, 0.5% sodium desoxycholate, 0.1% SDS, protease inhibitors]. The cleared lysates were incubated with immobilised GST-Rhotekin-RBD at 4°C for 35 minutes and afterwards washed three times in Rho wash buffer [50 mM Tris (pH 7.5), 1% Triton X-100, 500 mM NaCl, 10 mM MgCl2, protease inhibitors). The Rac1/Cdc42-GTP pull-down assay was performed accordingly, except for 150 mM NaCl in lysis and wash buffer. As controls, cell lysates were incubated either with uncoupled beads alone or preincubated with GTP{gamma}S (1 mM for 10 minutes) prior to precipitation. Bound proteins were detected by western blotting using RhoA (Santa Cruz), Rac1 or Cdc42 (Transduction Laboratories) antibodies. Densitometric analysis of western blots was carried out with AIDA software (Raytest) and normalised to total lysates or ratios.


    Acknowledgments
 
This work was made possible by generous support from Axel Ullrich at the MPI of Biochemistry. We thank Richard Treisman (Cancer Research UK, London) for various constructs, Sina Bartfeld (MPI of Infection Biology, Berlin) for AGS cells, Thomas Wirth (University Ulm) for EpRas cells, Eric Sahai (Cancer Research UK, London) for Tat-C3, and Reinhard Faessler (MPIB, Martinsried) for RhoA, Dia and ROCK. Laura Leitner, Carolin Schächterle and Monika Rex-Haffner helped establishing techniques and reagents in the laboratory. We also thank Michael Sixt for critically reading of the manuscript. Funding was obtained from the Wilhelm Sander-Stiftung to G.P.


    Footnotes
 
Supplementary material available online at http://jcs.biologists.org/cgi/content/full/121/7/1025/DC1


    References
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 

Arsenian, S., Weinhold, B., Oelgeschlager, M., Ruther, U. and Nordheim, A. (1998). Serum response factor is essential for mesoderm formation during mouse embryogenesis. EMBO J. 17, 6289-6299.[CrossRef][Medline]

Balzac, F., Avolio, M., Degani, S., Kaverina, I., Torti, M., Silengo, L., Small, J. V. and Retta, S. F. (2005). E-cadherin endocytosis regulates the activity of Rap1: a traffic light GTPase at the crossroads between cadherin and integrin function. J. Cell Sci. 118, 4765-4783.[Abstract/Free Full Text]

Braga, V. M. and Yap, A. S. (2005). The challenges of abundance: epithelial junctions and small GTPase signalling. Curr. Opin. Cell Biol. 17, 466-474.[CrossRef][Medline]

Braga, V. M., Machesky, L. M., Hall, A. and Hotchin, N. A. (1997). The small GTPases Rho and Rac are required for the establishment of cadherin-dependent cell-cell contacts. J. Cell Biol. 137, 1421-1431.[Abstract/Free Full Text]

Brennan, J. K., Mansky, J., Roberts, G. and Lichtman, M. A. (1975). Improved methods for reducing calcium and magnesium concentrations in tissue culture medium: application to studies of lymphoblast proliferation in vitro. In Vitro 11, 354-360.[Medline]

Capaldo, C. T. and Macara, I. G. (2007). Depletion of E-cadherin disrupts establishment but not maintenance of cell junctions in Madin-Darby canine kidney epithelial cells. Mol. Biol. Cell 18, 189-200.[Abstract/Free Full Text]

Chaves-Olarte, E., Freer, E., Parra, A., Guzman-Verri, C., Moreno, E. and Thelestam, M. (2003). R-Ras glucosylation and transient RhoA activation determine the cytopathic effect produced by toxin B variants from toxin A-negative strains of Clostridium difficile. J. Biol. Chem. 278, 7956-7963.[Abstract/Free Full Text]

Copeland, J. W. and Treisman, R. (2002). The diaphanous-related formin mDia1 controls serum response factor activity through its effects on actin polymerization. Mol. Biol. Cell 13, 4088-4099.[Abstract/Free Full Text]

de Rooij, J., Kerstens, A., Danuser, G., Schwartz, M. A. and Waterman-Storer, C. M. (2005). Integrin-dependent actomyosin contraction regulates epithelial cell scattering. J. Cell Biol. 171, 153-164.[Abstract/Free Full Text]

Drees, F., Pokutta, S., Yamada, S., Nelson, W. J. and Weis, W. I. (2005). Alpha-catenin is a molecular switch that binds E-cadherin-beta-catenin and regulates actin-filament assembly. Cell 123, 903-915.[CrossRef][Medline]

Du, K. L., Chen, M., Li, J., Lepore, J. J., Mericko, P. and Parmacek, M. S. (2004). Megakaryoblastic leukemia factor-1 transduces cytoskeletal signals and induces smooth muscle cell differentiation from undifferentiated embryonic stem cells. J. Biol. Chem. 279, 17578-17586.[Abstract/Free Full Text]

Fan, L., Sebe, A., Peterfi, Z., Masszi, A., Thirone, A. C., Rotstein, O. D., Nakano, H., McCulloch, C. A., Szaszi, K., Mucsi, I. et al. (2007). Cell contact-dependent regulation of epithelial-myofibroblast transition via the Rho-Rho kinase-phospho-myosin pathway. Mol. Biol. Cell 18, 1083-1097.[Abstract/Free Full Text]

Giannone, G. and Sheetz, M. P. (2006). Substrate rigidity and force define form through tyrosine phosphatase and kinase pathways. Trends Cell Biol. 16, 213-223.[CrossRef][Medline]

Gineitis, D. and Treisman, R. (2001). Differential usage of signal transduction pathways defines two types of serum response factor target gene. J. Biol. Chem. 276, 24531-24539.[Abstract/Free Full Text]

Grunert, S., Jechlinger, M. and Beug, H. (2003). Diverse cellular and molecular mechanisms contribute to epithelial plasticity and metastasis. Nat. Rev. Mol. Cell Biol. 4, 657-665.[CrossRef][Medline]

Gumbiner, B. M. (2005). Regulation of cadherin-mediated adhesion in morphogenesis. Nat. Rev. Mol. Cell Biol. 6, 622-634.[Medline]

Gumbiner, B., Stevenson, B. and Grimaldi, A. (1988). The role of the cell adhesion molecule uvomorulin in the formation and maintenance of the epithelial junctional complex. J. Cell Biol. 107, 1575-1587.[Abstract/Free Full Text]

Halbleib, J. M. and Nelson, W. J. (2006). Cadherins in development: cell adhesion, sorting, and tissue morphogenesis. Genes Dev. 20, 3199-3214.[Abstract/Free Full Text]

Hill, C. S. and Treisman, R. (1995). Differential activation of c-fos promoter elements by serum, lysophosphatidic acid, G proteins and polypeptide growth factors. EMBO J. 14, 5037-5047.[Medline]

Hill, C. S., Wynne, J. and Treisman, R. (1995). The Rho family GTPases RhoA, Rac1, and CDC42Hs regulate transcriptional activation by SRF. Cell 81, 1159-1170.[CrossRef][Medline]

Huelsenbeck, J., Dreger, S., Gerhard, R., Barth, H., Just, I. and Genth, H. (2007). Difference in the cytotoxic effects of toxin B from Clostridium difficile strain VPI 10463 and toxin B from variant Clostridium difficile strain 1470. Infect. Immun. 75, 801-809.[Abstract/Free Full Text]

Ivanov, A. I., McCall, I. C., Parkos, C. A. and Nusrat, A. (2004). Role for actin filament turnover and a myosin II motor in cytoskeleton-driven disassembly of the epithelial apical junctional complex. Mol. Biol. Cell 15, 2639-2651.[Abstract/Free Full Text]

Janda, E., Nevolo, M., Lehmann, K., Downward, J., Beug, H. and Grieco, M. (2006). Raf plus TGFbeta-dependent EMT is initiated by endocytosis and lysosomal degradation of E-cadherin. Oncogene 25, 7117-7130.[CrossRef][Medline]

Jou, T. S. and Nelson, W. J. (1998). Effects of regulated expression of mutant RhoA and Rac1 small GTPases on the development of epithelial (MDCK) cell polarity. J. Cell Biol. 142, 85-100.[Abstract/Free Full Text]

Klingelhofer, J., Laur, O. Y., Troyanovsky, R. B. and Troyanovsky, S. M. (2002). Dynamic interplay between adhesive and lateral E-cadherin dimers. Mol. Cell. Biol. 22, 7449-7458.[Abstract/Free Full Text]

Kooistra, M. R., Dube, N. and Bos, J. L. (2007). Rap1: a key regulator in cell-cell junction formation. J. Cell Sci. 120, 17-22.[Abstract/Free Full Text]

Larue, L., Ohsugi, M., Hirchenhain, J. and Kemler, R. (1994). E-cadherin null mutant embryos fail to form a trophectoderm epithelium. Proc. Natl. Acad. Sci. USA 91, 8263-8267.[Abstract/Free Full Text]

Li, J., Zhu, X., Chen, M., Cheng, L., Zhou, D., Lu, M. M., Du, K., Epstein, J. A. and Parmacek, M. S. (2005). Myocardin-related transcription factor B is required in cardiac neural crest for smooth muscle differentiation and cardiovascular development. Proc. Natl. Acad. Sci. USA 102, 8916-8921.[Abstract/Free Full Text]

Li, S., Chang, S., Qi, X., Richardson, J. A. and Olson, E. N. (2006). Requirement of a myocardin-related transcription factor for development of mammary myoepithelial cells. Mol. Cell. Biol. 26, 5797-5808.[Abstract/Free Full Text]

Lozano, E., Betson, M. and Braga, V. M. (2003). Tumor progression: small GTPases and loss of cell-cell adhesion. BioEssays 25, 452-463.[CrossRef][Medline]

Lynch, E. A., Stall, J., Schmidt, G., Chavrier, P. and D'Souza-Schorey, C. (2006). Proteasome-mediated degradation of Rac1-GTP during epithelial cell scattering. Mol. Biol. Cell 17, 2236-2242.[Abstract/Free Full Text]

Mack, C. P., Somlyo, A. V., Hautmann, M., Somlyo, A. P. and Owens, G. K. (2001). Smooth muscle differentiation marker gene expression is regulated by RhoA-mediated actin polymerization. J. Biol. Chem. 276, 341-347.[Abstract/Free Full Text]

Masszi, A., Fan, L., Rosivall, L., McCulloch, C. A., Rotstein, O. D., Mucsi, I. and Kapus, A. (2004). Integrity of cell-cell contacts is a critical regulator of TGF-beta 1-induced epithelial-to-myofibroblast transition: role for beta-catenin. Am. J. Pathol. 165, 1955-1967.[Abstract/Free Full Text]

Matter, K. and Balda, M. S. (2003). Signalling to and from tight junctions. Nat. Rev. Mol. Cell Biol. 4, 225-236.[CrossRef][Medline]

Miralles, F., Posern, G., Zaromytidou, A. I. and Treisman, R. (2003). Actin dynamics control SRF activity by regulation of its coactivator MAL. Cell 113, 329-342.[CrossRef][Medline]

Miyake, Y., Inoue, N., Nishimura, K., Kinoshita, N., Hosoya, H. and Yonemura, S. (2006). Actomyosin tension is required for correct recruitment of adherens junction components and zonula occludens formation. Exp. Cell Res. 312, 1637-1650.[CrossRef][Medline]

Mohun, T., Garrett, N. and Treisman, R. (1987). Xenopus cytoskeletal actin and human c-fos gene promoters share a conserved protein-binding site. EMBO J. 6, 667-673.[Medline]

Morita, T., Mayanagi, T. and Sobue, K. (2007). Dual roles of myocardin-related transcription factors in epithelial mesenchymal transition via slug induction and actin remodeling. J. Cell Biol. 179, 1027-1042.[Abstract/Free Full Text]

Nakagawa, M., Fukata, M., Yamaga, M., Itoh, N. and Kaibuchi, K. (2001). Recruitment and activation of Rac1 by the formation of E-cadherin-mediated cell-cell adhesion sites. J. Cell Sci. 114, 1829-1838.[Abstract]

Noren, N. K., Niessen, C. M., Gumbiner, B. M. and Burridge, K. (2001). Cadherin engagement regulates Rho family GTPases. J. Biol. Chem. 276, 33305-33308.[Abstract/Free Full Text]

Oh, J., Richardson, J. A. and Olson, E. N. (2005). Requirement of myocardin-related transcription factor-B for remodeling of branchial arch arteries and smooth muscle differentiation. Proc. Natl. Acad. Sci. USA 102, 15122-15127.[Abstract/Free Full Text]

Perl, A. K., Wilgenbus, P., Dahl, U., Semb, H. and Christofori, G. (1998). A causal role for E-cadherin in the transition from adenoma to carcinoma. Nature 392, 190-193.[CrossRef][Medline]

Pokutta, S., Herrenknecht, K., Kemler, R. and Engel, J. (1994). Conformational changes of the recombinant extracellular domain of E-cadherin upon calcium binding. Eur. J. Biochem. 223, 1019-1026.[Medline]

Posern, G. and Treisman, R. (2006). Actin' together: serum response factor, its cofactors and the link to signal transduction. Trends Cell Biol. 16, 588-596.[CrossRef][Medline]

Posern, G., Sotiropoulos, A. and Treisman, R. (2002). Mutant actins demonstrate a role for unpolymerized actin in control of transcription by serum response factor. Mol. Biol. Cell 13, 4167-4178.[Abstract/Free Full Text]

Posern, G., Miralles, F., Guettler, S. and Treisman, R. (2004). Mutant actins that stabilise F-actin use distinct mechanisms to activate the SRF coactivator MAL. EMBO J. 23, 3973-3983.[CrossRef][Medline]

Ren, X. D. and Schwartz, M. A. (2000). Determination of GTP loading on Rho. Meth. Enzymol. 325, 264-272.[Medline]

Sahai, E. and Marshall, C. J. (2002). ROCK and Dia have opposing effects on adherens junctions downstream of Rho. Nat. Cell Biol. 4, 408-415.[CrossRef][Medline]

Sahai, E. and Olson, M. F. (2006). Purification of TAT-C3 exoenzyme. Meth. Enzymol. 406, 128-140.[Medline]

Sahai, E., Alberts, A. S. and Treisman, R. (1998). RhoA effector mutants reveal distinct effector pathways for cytoskeletal reorganization, SRF activation and transformation. EMBO J. 17, 1350-1361.[CrossRef][Medline]

Sotiropoulos, A., Gineitis, D., Copeland, J. and Treisman, R. (1999). Signal-regulated activation of serum response factor is mediated by changes in actin dynamics. Cell 98, 159-169.[CrossRef][Medline]

Sun, Y., Boyd, K., Xu, W., Ma, J., Jackson, C. W., Fu, A., Shillingford, J. M., Robinson, G. W., Hennighausen, L., Hitzler, J. K. et al. (2006). Acute myeloid leukemia-associated Mkl1 (Mrtf-a) is a key regulator of mammary gland function. Mol. Cell. Biol. 26, 5809-5826.[Abstract/Free Full Text]

Vartiainen, M. K., Guettler, S., Larijani, B. and Treisman, R. (2007). Nuclear actin regulates dynamic subcellular localization and activity of the SRF cofactor MAL. Science 316, 1749-1752.[Abstract/Free Full Text]

Vasioukhin, V., Bauer, C., Yin, M. and Fuchs, E. (2000). Directed actin polymerization is the driving force for epithelial cell-cell adhesion. Cell 100, 209-219.[CrossRef][Medline]

Wells, C. M., Walmsley, M., Ooi, S., Tybulewicz, V. and Ridley, A. J. (2004). Rac1-deficient macrophages exhibit defects in cell spreading and membrane ruffling but not migration. J. Cell Sci. 117, 1259-1268.[Abstract/Free Full Text]

Winer, J., Jung, C. K., Shackel, I. and Williams, P. M. (1999). Development and validation of real-time quantitative reverse transcriptase-polymerase chain reaction for monitoring gene expression in cardiac myocytes in vitro. Anal. Biochem. 270, 41-49.[CrossRef][Medline]

Yamada, S., Pokutta, S., Drees, F., Weis, W. I. and Nelson, W. J. (2005). Deconstructing the cadherin-catenin-actin complex. Cell 123, 889-901.[CrossRef][Medline]

Ziegler, W. H., Liddington, R. C. and Critchley, D. R. (2006). The structure and regulation of vinculin. Trends Cell Biol. 16, 453-460.[CrossRef][Medline]

Zondag, G. C., Evers, E. E., ten Klooster, J. P., Janssen, L., van der Kammen, R. A. and Collard, J. G. (2000). Oncogenic Ras downregulates Rac activity, which leads to increased Rho activity and epithelial-mesenchymal transition. J. Cell Biol. 149, 775-782.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?



This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow All Versions of this Article:
jcs.014456v1
121/7/1025    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Busche, S.
Right arrow Articles by Posern, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Busche, S.
Right arrow Articles by Posern, G.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?