JCS034850 Supplementary Material

Files in this Data Supplement:

• Supplemental Figure S1 -

  Fig. S1. Laminar flow downregulates SMC marker gene expression with a concomitant decrease of HDAC7. Western blot shows that laminar flow downregulated HDAC7 and SMC marker protein levels.

• Supplemental Figure S2 -

  Fig. S2. Cytoplasmic and nuclear fractions confirm the cellular localization of the short and spliced isoforms of HDAC7. SMCs were infected with Ad-tTA, Ad-HDAC7-1, Ad-HDAC7-2. 48 hours later, the cells were harvested and cytoplasmic and nuclear protein fractions were separated. HA detected the exogenous HDAC7, whereas HDAC7 detected the total HDAC7. The short HDAC7 (HDAC7-2) was localized in the cytoplasm, however, a weak band was detected in this case in the nuclear fraction because of cytoplasmic contamination, because α-tubulin was also detected. The spliced HDAC7 (HDAC7-1) was localized in both the cytoplasm and nucleus. Neither HDAC7-1 nor HDAC7-2 could interfere with MEF2C cellular compartmentalization.

• Supplemental Figure S3 -

  Fig. S3. RT-RCR analysis for MEF2C in HDAC7-1, and HDAC7-2 overexpressing cells. HDAC7-1 and HDAC7-2 had no effect on MEF2C and SRF mRNA levels. Primer sets: SRF forward, CAGAGTCGTCTGGAGCGGGAG and reverse, CCTGTCAGCGTGGACAGCTCA (NM_020493); MEF2C forward, CACCGAGTACAACGAGCCGCA and reverse, CTGGTGCCTGCACCGGATGTC (NM_025282) (left panel). Real-time PCR primer sets: MEF2C forward, AAGCCAAATCTCCTCCCCCTAT and reverse, TGATTCACTGATGGCATCGTGT (right panel).

• Supplemental Figure S4 -

  Fig. S4. Deletion of CarG boxes ablated the spliced HDAC7-induced SM22 reporter gene expression. These findings strongly support the hypothesis that the spliced HDAC7 induces SMC differentiation through modulation of the myocardin-SRF complex.

• Supplemental Table S1 - Adobe PDF