JCS040154 Supplementary Material

Files in this Data Supplement:

• Supplemental Figure S1 -

  Fig. S1. Nup358 is required for nuclear localisation of Rev in vivo. A specific siRNA (siRNA Nup358 #3; GGACAGUGGGAUUGUAGUGUUA) targeting base pairs 5347-5368 of the human Nup358 sequence (Joseph et al., 2004) was used at a final concentration of 100 nM for the depletion of Nup358. 55 hours after siRNA transfection, HeLa cells were transfected with a construct for HA-Rev (see Fig. 3A) and analysed after 15 hours for subcellular localisation of the HIV-1 Rev protein. Other Nup358-specific siRNAs had similar effects (data not shown).

• Supplemental Figure S2 -

  Fig. S2. The GR₂-GFP₂-M9core and GR₂-GFP-hnRNP M reporter constructs are specifically imported by the transportin pathway. Constructs coding for GR₂-GFP₂-M9core (A) or GR₂-GFP-hnRNP M (C) were either co-transfected with empty vector (−M9M) or a plasmid coding for Myc-MBP-M9M (+M9M) at a ratio of 1:7. Cells were stained for MBP-M9M, DNA and Rev, as indicated, and analysed by fluorescence microscopy. Bar, 10 µm. (B,D) Quantification of the localisation of GR₂-GFP₂-M9core (B) or GR₂-GFP-hnRNP M (D) in the absence or presence of the Myc-MBP-M9M inhibitor. Error bars represent the standard deviation of four independent experiments with >100 cells analysed each time.

• Supplemental Figure S3 -

  Fig. S3. Nup358 promotes transportin-mediated import. An alternative siRNA (see Fig. S1) was used for the depletion of Nup358. (A) Localisation of the shuttling protein GR₂-GFP₂-M9core was analysed in mock-treated control cells and in siRNA-depleted cells, as indicated. Bar, 10 µm. A quantification of the subcellular localization of the reporter protein (N>C, N=C and N<C) in mock- or Nup358-depleted cells is shown in B. Error bars indicate the standard deviation from the mean of three independent experiments with >100 cells analysed each time.